ID: 1062561059

View in Genome Browser
Species Human (GRCh38)
Location 9:137142092-137142114
Sequence TCTACCGCATACCCGTGCTG GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 33
Summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 30}

Found 12 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1062561043_1062561059 29 Left 1062561043 9:137142040-137142062 CCTACCCCCAACGACCACTTCAC 0: 1
1: 0
2: 1
3: 16
4: 195
Right 1062561059 9:137142092-137142114 TCTACCGCATACCCGTGCTGGGG 0: 1
1: 0
2: 0
3: 2
4: 30
1062561054_1062561059 -1 Left 1062561054 9:137142070-137142092 CCTGTCTCCTACACAGCCGGCTT 0: 1
1: 4
2: 47
3: 194
4: 376
Right 1062561059 9:137142092-137142114 TCTACCGCATACCCGTGCTGGGG 0: 1
1: 0
2: 0
3: 2
4: 30
1062561052_1062561059 1 Left 1062561052 9:137142068-137142090 CCCCTGTCTCCTACACAGCCGGC 0: 1
1: 0
2: 3
3: 17
4: 191
Right 1062561059 9:137142092-137142114 TCTACCGCATACCCGTGCTGGGG 0: 1
1: 0
2: 0
3: 2
4: 30
1062561046_1062561059 23 Left 1062561046 9:137142046-137142068 CCCAACGACCACTTCACTCCCAC 0: 1
1: 1
2: 0
3: 11
4: 124
Right 1062561059 9:137142092-137142114 TCTACCGCATACCCGTGCTGGGG 0: 1
1: 0
2: 0
3: 2
4: 30
1062561048_1062561059 15 Left 1062561048 9:137142054-137142076 CCACTTCACTCCCACCCCTGTCT 0: 1
1: 1
2: 12
3: 105
4: 902
Right 1062561059 9:137142092-137142114 TCTACCGCATACCCGTGCTGGGG 0: 1
1: 0
2: 0
3: 2
4: 30
1062561055_1062561059 -8 Left 1062561055 9:137142077-137142099 CCTACACAGCCGGCTTCTACCGC 0: 1
1: 0
2: 0
3: 3
4: 69
Right 1062561059 9:137142092-137142114 TCTACCGCATACCCGTGCTGGGG 0: 1
1: 0
2: 0
3: 2
4: 30
1062561045_1062561059 24 Left 1062561045 9:137142045-137142067 CCCCAACGACCACTTCACTCCCA 0: 1
1: 0
2: 0
3: 24
4: 163
Right 1062561059 9:137142092-137142114 TCTACCGCATACCCGTGCTGGGG 0: 1
1: 0
2: 0
3: 2
4: 30
1062561047_1062561059 22 Left 1062561047 9:137142047-137142069 CCAACGACCACTTCACTCCCACC 0: 1
1: 0
2: 1
3: 13
4: 221
Right 1062561059 9:137142092-137142114 TCTACCGCATACCCGTGCTGGGG 0: 1
1: 0
2: 0
3: 2
4: 30
1062561044_1062561059 25 Left 1062561044 9:137142044-137142066 CCCCCAACGACCACTTCACTCCC 0: 1
1: 0
2: 0
3: 8
4: 214
Right 1062561059 9:137142092-137142114 TCTACCGCATACCCGTGCTGGGG 0: 1
1: 0
2: 0
3: 2
4: 30
1062561053_1062561059 0 Left 1062561053 9:137142069-137142091 CCCTGTCTCCTACACAGCCGGCT 0: 1
1: 1
2: 4
3: 24
4: 207
Right 1062561059 9:137142092-137142114 TCTACCGCATACCCGTGCTGGGG 0: 1
1: 0
2: 0
3: 2
4: 30
1062561050_1062561059 4 Left 1062561050 9:137142065-137142087 CCACCCCTGTCTCCTACACAGCC 0: 1
1: 0
2: 2
3: 57
4: 572
Right 1062561059 9:137142092-137142114 TCTACCGCATACCCGTGCTGGGG 0: 1
1: 0
2: 0
3: 2
4: 30
1062561049_1062561059 5 Left 1062561049 9:137142064-137142086 CCCACCCCTGTCTCCTACACAGC 0: 1
1: 0
2: 3
3: 53
4: 589
Right 1062561059 9:137142092-137142114 TCTACCGCATACCCGTGCTGGGG 0: 1
1: 0
2: 0
3: 2
4: 30

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1062561059 Original CRISPR TCTACCGCATACCCGTGCTG GGG Exonic
919917730 1:202149223-202149245 TCTGCCCCTTACACGTGCTGAGG + Intronic
921249913 1:213287799-213287821 TCCATGGCATACCCCTGCTGTGG + Intergenic
923735805 1:236605628-236605650 TCTAGCGCATACCGGTGTTTTGG - Intergenic
1083911435 11:65712395-65712417 GCTGCCGCCTACCCGTGCTGCGG + Exonic
1104741345 12:131177078-131177100 GCTACCCCAGACCAGTGCTGGGG - Intergenic
1105855675 13:24370017-24370039 ACTATTGCATAGCCGTGCTGTGG + Intergenic
1114994271 14:28328340-28328362 TCTACTGCTTCCCCTTGCTGGGG + Intergenic
1120991783 14:90383602-90383624 AATACCAAATACCCGTGCTGCGG + Intergenic
1127009596 15:54608394-54608416 TGTACCACATACCTGTGCTCTGG - Intronic
1132627545 16:898690-898712 TCTACAGCAGACCTGTGCTTCGG - Intronic
1142803863 17:2361550-2361572 TCTTCCCCATACCTGTGGTGAGG - Intronic
1146484262 17:33230559-33230581 TCTTCCACATACCCAAGCTGAGG - Intronic
1161884833 19:6986442-6986464 TCTACCACGTACCGATGCTGCGG + Intergenic
933805065 2:85992782-85992804 TCTCCTGCATACCCCAGCTGTGG + Intergenic
939517955 2:143192614-143192636 TCTACAGCAAACCCGTGGAGAGG - Intronic
1170536276 20:17344126-17344148 TGTTCCGCATCACCGTGCTGGGG + Intronic
1177516253 21:22154807-22154829 TTTACCCCATACCCCTGCTCTGG - Intergenic
1179829288 21:43986046-43986068 TCTGCCCCATACCCCTGCCGTGG + Exonic
951129590 3:19025950-19025972 GCTACTACATACCCTTGCTGTGG + Intergenic
955980910 3:64526773-64526795 TTTACAGCAAACCCGTGATGGGG - Intronic
956904554 3:73752402-73752424 TCTGCTGCATACCCATTCTGTGG - Intergenic
973755198 4:54067223-54067245 TCTACCGTATACCCAGGCCGTGG - Intronic
976204562 4:82612225-82612247 CCTACCACACACCCATGCTGTGG - Intergenic
1001700422 5:173702670-173702692 GCTACCGAATACCTGTGATGTGG - Intergenic
1008570690 6:52813844-52813866 CCTATGGCATACCCATGCTGGGG - Intergenic
1020450755 7:8318017-8318039 TCTACCTCATAGACTTGCTGTGG + Intergenic
1023110262 7:36803062-36803084 TCTACCGCATATCACAGCTGTGG + Intergenic
1030115436 7:106059089-106059111 TCTACCCCCTACCCGTACTTCGG - Intergenic
1043412644 8:80014531-80014553 TCTACCGCTTACCAGCTCTGGGG + Intronic
1044951527 8:97440056-97440078 TGTCCAGCATACCCATGCTGTGG - Intergenic
1057859755 9:98631026-98631048 TCTACTGCATAGCGCTGCTGGGG + Intronic
1062561059 9:137142092-137142114 TCTACCGCATACCCGTGCTGGGG + Exonic
1203774836 EBV:67096-67118 TCTACAGCATAGCCCTGCTGCGG + Intergenic