ID: 1062561473

View in Genome Browser
Species Human (GRCh38)
Location 9:137144120-137144142
Sequence GAGCTCAGCTTGTCCAAAGG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1062561469_1062561473 21 Left 1062561469 9:137144076-137144098 CCCAGGGGGATCTTCGAGGCGCT 0: 1
1: 0
2: 0
3: 1
4: 29
Right 1062561473 9:137144120-137144142 GAGCTCAGCTTGTCCAAAGGTGG No data
1062561470_1062561473 20 Left 1062561470 9:137144077-137144099 CCAGGGGGATCTTCGAGGCGCTA 0: 1
1: 0
2: 0
3: 2
4: 30
Right 1062561473 9:137144120-137144142 GAGCTCAGCTTGTCCAAAGGTGG No data
1062561468_1062561473 22 Left 1062561468 9:137144075-137144097 CCCCAGGGGGATCTTCGAGGCGC 0: 1
1: 0
2: 0
3: 1
4: 39
Right 1062561473 9:137144120-137144142 GAGCTCAGCTTGTCCAAAGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1062561473 Original CRISPR GAGCTCAGCTTGTCCAAAGG TGG Intronic
No off target data available for this crispr