ID: 1062561951

View in Genome Browser
Species Human (GRCh38)
Location 9:137145636-137145658
Sequence ACTGCCGGAACACCCGCCGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 27
Summary {0: 1, 1: 0, 2: 0, 3: 0, 4: 26}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1062561951_1062561959 -9 Left 1062561951 9:137145636-137145658 CCTCCGGCGGGTGTTCCGGCAGT 0: 1
1: 0
2: 0
3: 0
4: 26
Right 1062561959 9:137145650-137145672 TCCGGCAGTGGGAGGCGGGTGGG 0: 1
1: 0
2: 1
3: 24
4: 206
1062561951_1062561963 -2 Left 1062561951 9:137145636-137145658 CCTCCGGCGGGTGTTCCGGCAGT 0: 1
1: 0
2: 0
3: 0
4: 26
Right 1062561963 9:137145657-137145679 GTGGGAGGCGGGTGGGAGGGCGG 0: 1
1: 5
2: 40
3: 473
4: 4167
1062561951_1062561964 -1 Left 1062561951 9:137145636-137145658 CCTCCGGCGGGTGTTCCGGCAGT 0: 1
1: 0
2: 0
3: 0
4: 26
Right 1062561964 9:137145658-137145680 TGGGAGGCGGGTGGGAGGGCGGG 0: 1
1: 0
2: 7
3: 180
4: 1850
1062561951_1062561961 -6 Left 1062561951 9:137145636-137145658 CCTCCGGCGGGTGTTCCGGCAGT 0: 1
1: 0
2: 0
3: 0
4: 26
Right 1062561961 9:137145653-137145675 GGCAGTGGGAGGCGGGTGGGAGG 0: 1
1: 0
2: 12
3: 169
4: 1606
1062561951_1062561965 8 Left 1062561951 9:137145636-137145658 CCTCCGGCGGGTGTTCCGGCAGT 0: 1
1: 0
2: 0
3: 0
4: 26
Right 1062561965 9:137145667-137145689 GGTGGGAGGGCGGGTCCCCGCGG 0: 1
1: 1
2: 2
3: 30
4: 313
1062561951_1062561958 -10 Left 1062561951 9:137145636-137145658 CCTCCGGCGGGTGTTCCGGCAGT 0: 1
1: 0
2: 0
3: 0
4: 26
Right 1062561958 9:137145649-137145671 TTCCGGCAGTGGGAGGCGGGTGG 0: 1
1: 0
2: 0
3: 17
4: 242
1062561951_1062561962 -5 Left 1062561951 9:137145636-137145658 CCTCCGGCGGGTGTTCCGGCAGT 0: 1
1: 0
2: 0
3: 0
4: 26
Right 1062561962 9:137145654-137145676 GCAGTGGGAGGCGGGTGGGAGGG 0: 1
1: 0
2: 8
3: 119
4: 984
1062561951_1062561966 9 Left 1062561951 9:137145636-137145658 CCTCCGGCGGGTGTTCCGGCAGT 0: 1
1: 0
2: 0
3: 0
4: 26
Right 1062561966 9:137145668-137145690 GTGGGAGGGCGGGTCCCCGCGGG 0: 1
1: 1
2: 4
3: 18
4: 192

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1062561951 Original CRISPR ACTGCCGGAACACCCGCCGG AGG (reversed) Intronic
902415511 1:16236625-16236647 ACTTACCAAACACCCGCCGGCGG + Exonic
905824454 1:41017995-41018017 ACTGTCGGAGCACACGCCGCTGG + Exonic
906490881 1:46267505-46267527 ACAGCTTGAACACCAGCCGGCGG + Exonic
915070371 1:153261236-153261258 ACAGCCAGAGCCCCCGCCGGAGG - Exonic
1062882274 10:988426-988448 ACTCCCGGAACTTCCGCCGTCGG - Exonic
1081528370 11:43942417-43942439 TCTCCCGGAACCCCCGCGGGCGG + Exonic
1113926436 13:113944281-113944303 ACTGCCGGGACCCCCTCCAGTGG + Intergenic
1119650170 14:76377450-76377472 GCCTCCGGGACACCCGCCGGGGG - Intronic
1128604164 15:69023508-69023530 ACTGCTGAAACACCAGCTGGTGG - Intronic
1138472129 16:57245762-57245784 ACGGGCGAAACACCTGCCGGGGG - Intronic
1140478612 16:75251070-75251092 CCAGCCGGACCACCCGCCAGAGG + Intronic
1141634709 16:85308012-85308034 GCTGCCGGCACAGCCCCCGGAGG - Intergenic
1142231450 16:88902015-88902037 TCTGTCTGAACACCCCCCGGGGG - Intronic
1161058349 19:2201589-2201611 GATGGCAGAACACCCGCCGGCGG - Intronic
1163617764 19:18340042-18340064 TCTGCCGGAACACACCCCGCAGG - Intergenic
969649527 4:8456590-8456612 ACTGCAGGTACACCAGCAGGCGG + Intronic
983502753 4:168518381-168518403 ACTGCCCGAACACCGTCCAGGGG + Intronic
999129577 5:149272341-149272363 ACTCCCGAAACACCCGCTGTGGG + Intronic
1002204566 5:177553988-177554010 ACGGCCGGAACGCCCGGAGGCGG + Intronic
1006153649 6:32002455-32002477 TGTGCCGGAGCACCCGCCAGCGG + Exonic
1006159957 6:32035192-32035214 TGTGCCGGAGCACCCGCCAGCGG + Exonic
1017532838 6:155314197-155314219 AGTGCCTGGACACCCGCCCGCGG + Intronic
1028135360 7:87219147-87219169 AGTGCGGGAACCCCCTCCGGAGG - Intronic
1029496224 7:100896626-100896648 ACTTCTGGAACCCCCGCGGGTGG + Intronic
1033588510 7:142791913-142791935 ACTGCCTGAGCAGCCGCCTGAGG + Intergenic
1033590011 7:142801260-142801282 ACTGCCTGAGCAGCCGCCTGAGG + Intergenic
1062561951 9:137145636-137145658 ACTGCCGGAACACCCGCCGGAGG - Intronic