ID: 1062562468

View in Genome Browser
Species Human (GRCh38)
Location 9:137147773-137147795
Sequence CTGTGTCAGTCCTGAGTGGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 308
Summary {0: 1, 1: 2, 2: 3, 3: 29, 4: 273}

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1062562468_1062562479 18 Left 1062562468 9:137147773-137147795 CCTCCCACTCAGGACTGACACAG 0: 1
1: 2
2: 3
3: 29
4: 273
Right 1062562479 9:137147814-137147836 GGGGCCACACAGCAGGTGCACGG No data
1062562468_1062562478 11 Left 1062562468 9:137147773-137147795 CCTCCCACTCAGGACTGACACAG 0: 1
1: 2
2: 3
3: 29
4: 273
Right 1062562478 9:137147807-137147829 CACTGCTGGGGCCACACAGCAGG No data
1062562468_1062562476 -2 Left 1062562468 9:137147773-137147795 CCTCCCACTCAGGACTGACACAG 0: 1
1: 2
2: 3
3: 29
4: 273
Right 1062562476 9:137147794-137147816 AGGTTGGAGTGGGCACTGCTGGG No data
1062562468_1062562485 28 Left 1062562468 9:137147773-137147795 CCTCCCACTCAGGACTGACACAG 0: 1
1: 2
2: 3
3: 29
4: 273
Right 1062562485 9:137147824-137147846 AGCAGGTGCACGGCAGGGTGGGG No data
1062562468_1062562475 -3 Left 1062562468 9:137147773-137147795 CCTCCCACTCAGGACTGACACAG 0: 1
1: 2
2: 3
3: 29
4: 273
Right 1062562475 9:137147793-137147815 CAGGTTGGAGTGGGCACTGCTGG No data
1062562468_1062562477 -1 Left 1062562468 9:137147773-137147795 CCTCCCACTCAGGACTGACACAG 0: 1
1: 2
2: 3
3: 29
4: 273
Right 1062562477 9:137147795-137147817 GGTTGGAGTGGGCACTGCTGGGG No data
1062562468_1062562486 29 Left 1062562468 9:137147773-137147795 CCTCCCACTCAGGACTGACACAG 0: 1
1: 2
2: 3
3: 29
4: 273
Right 1062562486 9:137147825-137147847 GCAGGTGCACGGCAGGGTGGGGG No data
1062562468_1062562483 26 Left 1062562468 9:137147773-137147795 CCTCCCACTCAGGACTGACACAG 0: 1
1: 2
2: 3
3: 29
4: 273
Right 1062562483 9:137147822-137147844 ACAGCAGGTGCACGGCAGGGTGG No data
1062562468_1062562481 22 Left 1062562468 9:137147773-137147795 CCTCCCACTCAGGACTGACACAG 0: 1
1: 2
2: 3
3: 29
4: 273
Right 1062562481 9:137147818-137147840 CCACACAGCAGGTGCACGGCAGG No data
1062562468_1062562484 27 Left 1062562468 9:137147773-137147795 CCTCCCACTCAGGACTGACACAG 0: 1
1: 2
2: 3
3: 29
4: 273
Right 1062562484 9:137147823-137147845 CAGCAGGTGCACGGCAGGGTGGG No data
1062562468_1062562482 23 Left 1062562468 9:137147773-137147795 CCTCCCACTCAGGACTGACACAG 0: 1
1: 2
2: 3
3: 29
4: 273
Right 1062562482 9:137147819-137147841 CACACAGCAGGTGCACGGCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1062562468 Original CRISPR CTGTGTCAGTCCTGAGTGGG AGG (reversed) Intronic
904402990 1:30269118-30269140 CTGTGACATTCCTGAGTGCTGGG - Intergenic
905283175 1:36861925-36861947 CAGTGTCAGTAGGGAGTGGGGGG + Intronic
905284751 1:36871936-36871958 CTGTGTCAGGCCGGGCTGGGCGG + Intronic
905379348 1:37549511-37549533 CTGAGTAGCTCCTGAGTGGGAGG - Intronic
905921337 1:41721318-41721340 CTGTCTCAGCCCCGAGTAGGTGG + Intronic
906043575 1:42809182-42809204 CTGTTTCTGTTCTTAGTGGGTGG - Intronic
906789142 1:48643449-48643471 CTGCTTGAGTCCTGAGTGAGTGG - Intronic
906866924 1:49431887-49431909 CTGTTTCAGTACTGACTGAGTGG + Intronic
909100102 1:71339698-71339720 CTGTGTGAGTTCTGAGAAGGGGG + Intergenic
909733779 1:78930690-78930712 CTTTGTGAGTCCAAAGTGGGTGG - Intronic
909792279 1:79694420-79694442 CTGTTTCAGTACTGACTGAGTGG + Intergenic
910151895 1:84158150-84158172 CTGTCTCAGTCTTGAGTAGCTGG + Intronic
910363432 1:86438158-86438180 CAGTGTCATCCCTGAGTGGGTGG + Intronic
912280302 1:108305476-108305498 CCATGTCACTCCTGGGTGGGTGG + Intergenic
912287924 1:108388881-108388903 CCATGTCACTCCTGGGTGGGTGG - Intronic
912439264 1:109686349-109686371 CTGTTTCAGTACTGACTGAGTGG + Intronic
912744057 1:112230477-112230499 CTGTCTCAGGCCAGAGTGGAAGG - Intergenic
913536211 1:119775195-119775217 CTGTTTCAGTACTGACTGAGTGG - Intergenic
913544605 1:119854989-119855011 CTGTTTCAGTACTGACTGAGTGG + Intergenic
914719556 1:150278555-150278577 CTGTGCCTGTAGTGAGTGGGAGG + Intronic
914846932 1:151288608-151288630 CCATGTCTGTCCTGAGTGTGGGG + Exonic
915077842 1:153325826-153325848 CTTTGGGAGTCCGGAGTGGGTGG + Intergenic
915510453 1:156384148-156384170 CTGTGCCCCTCCTGTGTGGGAGG + Intronic
916428678 1:164706974-164706996 CTGTGTTTGTCCTGAGTTAGTGG + Intronic
916470536 1:165118569-165118591 CTAGGTCAATCCTGAGTGGCGGG - Intergenic
916641016 1:166729314-166729336 CTGTGCCAATCCAGGGTGGGTGG - Intergenic
917095857 1:171398258-171398280 CTGTTTCAGTACTGATTGAGTGG - Intergenic
919155775 1:193764405-193764427 CTGTTTCAGACCTGAGTGATAGG + Intergenic
919161794 1:193840104-193840126 CTGTGTCATTCTATAGTGGGAGG + Intergenic
920156922 1:203959734-203959756 CTGCCTCAGTCCTGAGTAGCTGG - Intergenic
922130463 1:222772228-222772250 CTGTGTAAGTGTTGTGTGGGGGG + Intergenic
922976694 1:229790790-229790812 CTGTGTTTGTCCTGATTGGCTGG - Intergenic
923071334 1:230567372-230567394 CTGTTTCAGTACTGACTGAGTGG - Intergenic
923167578 1:231381148-231381170 CTTTGTGAGGCCAGAGTGGGAGG - Intronic
923712706 1:236399884-236399906 CTGGGGCTGTCCTGAGTTGGTGG - Intronic
1062942448 10:1434440-1434462 CTGTTTCAGTATTGACTGGGTGG + Intronic
1063515805 10:6693886-6693908 CTGTGTTACTTCAGAGTGGGAGG - Intergenic
1067327957 10:45287576-45287598 CTGTTTCAGTACTGACTGAGTGG + Intergenic
1067580802 10:47444265-47444287 CTGTGTCTCTCCAGAGTGTGGGG - Intergenic
1067722998 10:48743745-48743767 CTGAGTCAGTACTGGGTTGGAGG + Intronic
1067980668 10:51080775-51080797 CGGTGTCAGAACTGAGTGTGAGG - Intronic
1069070834 10:63989105-63989127 CTGTGTGAGTCCTGTGAAGGGGG - Intergenic
1071280085 10:84093714-84093736 CTGTGTCAGCCCCAAGTGGCTGG + Intergenic
1072118483 10:92385839-92385861 CTGAGTCAGTCCTCAGGAGGTGG + Intergenic
1073470437 10:103718748-103718770 GTGTGTGTGTCCTGATTGGGGGG - Intronic
1073484285 10:103806819-103806841 CTGGGTCAGTCCAGACTGAGGGG + Intronic
1074679965 10:115895555-115895577 CTGTGGCTTTCCTGAGTGGAGGG - Intronic
1075720055 10:124579250-124579272 CTGAGTCAGTCCTGCCTGGGAGG + Intronic
1076901795 10:133342877-133342899 CTTTGGGAGGCCTGAGTGGGAGG + Intronic
1077429573 11:2509438-2509460 CTGGGTCTGTGCTGTGTGGGGGG + Intronic
1077471362 11:2762166-2762188 GTGTGTCAGGCCTGGGAGGGGGG + Intronic
1078062626 11:8057894-8057916 CTGTTTCAGTACTGACTGAGTGG - Intronic
1079672268 11:23185448-23185470 ATTTGCCAGTCCTGGGTGGGGGG + Intergenic
1081437496 11:43042876-43042898 CTGAGTGATTCCTGAGTCGGGGG + Intergenic
1083198269 11:61103825-61103847 GTGTGTGAGTACTGTGTGGGGGG + Intronic
1083198298 11:61104094-61104116 GTGTGTGAGTACTGTGTGGGGGG + Intronic
1084945692 11:72637172-72637194 CTATTTCAGCCCAGAGTGGGAGG - Intronic
1087018567 11:93579019-93579041 TTGTATCTGTCCTGAGAGGGAGG - Intergenic
1090085258 11:123644916-123644938 CAGTGTCAGTTCTGGGTGGTTGG - Intronic
1090095928 11:123741594-123741616 CTGTTTCGGTCGGGAGTGGGTGG - Exonic
1090421021 11:126575017-126575039 CTCTGTCAGTCCACAGAGGGTGG + Intronic
1090662116 11:128890279-128890301 CTGTGTCTGCCCTGAGAGAGGGG + Intergenic
1091191604 11:133700137-133700159 GTGTGGCAGTACTGAGTGGTGGG + Intergenic
1091655052 12:2339352-2339374 CTGTGTGAGTCATGAGTGAGTGG + Intronic
1091773713 12:3170575-3170597 CTGAGTCAGTTCTGTGTGGGGGG + Intronic
1092591742 12:9958536-9958558 CTGTTTCAGTACTGACTGAGTGG + Intronic
1094090287 12:26642474-26642496 CTGTGTCATCTCTTAGTGGGAGG - Intronic
1094116361 12:26918923-26918945 CTTTGTGAGTCCTAAGTGGGAGG + Intronic
1094633391 12:32200012-32200034 CTGTTTCAGTACTGACTGAGTGG - Intronic
1096658618 12:53107066-53107088 CTGTTTCAGTACTGACTGAGTGG - Intronic
1096878261 12:54647078-54647100 CTGCCCCAGTCCTGGGTGGGAGG - Intronic
1096969014 12:55650677-55650699 CTGTTTCAGTACTGACTGAGTGG - Intergenic
1097167510 12:57093632-57093654 CTGTGTGGGGCCTGAGTGGCCGG - Intronic
1097923109 12:65098455-65098477 CTGAGCCAGTCCTGACTGGGGGG - Intronic
1098942895 12:76558741-76558763 CTCAGCCAGTCTTGAGTGGGTGG + Intronic
1099796874 12:87410652-87410674 CTGTTTCAGTACTGACTGAGTGG - Intergenic
1099860279 12:88217898-88217920 CTGTGCCAGTCCTGAGTGGGTGG - Intergenic
1100592463 12:96042315-96042337 CTGTTTCAGTACTGACTGAGTGG + Intronic
1100595069 12:96064547-96064569 CTGGGTGAGTAGTGAGTGGGTGG - Intergenic
1100854938 12:98750186-98750208 TTGGGTCAGTGCTGAATGGGAGG + Intronic
1102297665 12:111749358-111749380 CTGAGTCAGTGCTGGGTGCGGGG - Intronic
1107555670 13:41515394-41515416 CTGTGGGAGGCCTAAGTGGGCGG - Intergenic
1107891893 13:44921291-44921313 ATTTGTAAGTCCTGGGTGGGTGG - Intergenic
1109389175 13:61670901-61670923 CTGGGGCAGCCCTGAGTGGCTGG + Intergenic
1111277494 13:85968791-85968813 CTGTTTCAGTGCTGACTGAGTGG - Intergenic
1117999704 14:61511445-61511467 CTCTGGCAGTTCTGGGTGGGGGG - Intronic
1119507457 14:75185323-75185345 GTGTGTCAGTCCTCAGAGGCAGG + Intergenic
1119688239 14:76650391-76650413 CTGGGTCAGGCCTGAGTGCATGG - Intergenic
1121328548 14:93035640-93035662 CTGTGACACTGGTGAGTGGGAGG + Intronic
1122931049 14:104933246-104933268 CTGTGTGAGTCCCGCGCGGGCGG + Exonic
1123113029 14:105881886-105881908 CTGGGTCTGTCCTCTGTGGGAGG + Intergenic
1123115376 14:105892035-105892057 CTGGGTCTGTCCTCTGTGGGAGG + Intergenic
1123117547 14:105901490-105901512 CTGGGTCTGTCCTGTCTGGGTGG + Intergenic
1125960426 15:43825532-43825554 CTGTGGGAGGCCGGAGTGGGCGG - Intergenic
1126008616 15:44281949-44281971 CCGTGTCAATCCTGAATGGCCGG + Intergenic
1126346304 15:47697829-47697851 CTGTGTCAGACATGAGATGGTGG - Intronic
1126697008 15:51334914-51334936 CTGTGTCAGGCCAGAGTGACTGG - Intronic
1129060765 15:72858907-72858929 CTGTGTCAGGCCAGAGTGCCAGG + Intergenic
1130270810 15:82445902-82445924 CTGTGTGAGGCTTGCGTGGGAGG + Intergenic
1130317470 15:82809094-82809116 GTGTGTCAGTATTGAGGGGGTGG - Intergenic
1130463150 15:84173225-84173247 CTGTGTGAGGCTTGCGTGGGAGG + Intronic
1130489524 15:84421563-84421585 CTGTGTGAGGCTTGCGTGGGAGG - Intergenic
1130501115 15:84500325-84500347 CTGTGTGAGGCTTGCGTGGGAGG - Intergenic
1131006997 15:88986527-88986549 CTGTTTCAGTACTGACTGAGTGG - Intergenic
1131184506 15:90263422-90263444 ATTTGTCAGTCATGAGTGTGGGG - Exonic
1132792207 16:1697774-1697796 CTGAGTGAGTCCTGATTTGGTGG + Intronic
1134746229 16:16591015-16591037 CTCTGGCAGCCCTGACTGGGTGG + Intergenic
1134916869 16:18079878-18079900 CTGCGTCAGCCCTGAGTAGCTGG - Intergenic
1134999252 16:18762685-18762707 CTCTGGCAGCCCTGACTGGGTGG - Intergenic
1135794295 16:25426407-25426429 CTTTAGCAGTCCTGACTGGGTGG + Intergenic
1136596698 16:31255577-31255599 CTTTGGGAGTCCAGAGTGGGAGG - Intergenic
1138262225 16:55632089-55632111 CTGTGTGAGTCCTGTGAAGGAGG - Intergenic
1138885558 16:61073728-61073750 ATGTGTCAGCCCTGAGAAGGAGG - Intergenic
1138998029 16:62476961-62476983 CCGTGTCACTCCTGAGTGGGTGG + Intergenic
1139913998 16:70417255-70417277 CAGAGTCAGTGCTGTGTGGGAGG - Intronic
1142153766 16:88523938-88523960 CTGTGGCGGTCCCGAGTGGAGGG - Intronic
1142281319 16:89149444-89149466 CTGTGGCAGGCCTGGGTTGGGGG - Intronic
1143628451 17:8123842-8123864 CAGAGCCAGACCTGAGTGGGCGG - Intronic
1144198571 17:12918735-12918757 CTGTGTCAGACATGACTGCGTGG + Intronic
1149866954 17:60156457-60156479 CTGTGTGGGAACTGAGTGGGTGG + Intronic
1151417307 17:73974668-73974690 CTGTTTCAGTACTGACTGAGTGG + Intergenic
1152332529 17:79681367-79681389 CGATGTCTGTCCTGAGAGGGAGG + Intergenic
1156938821 18:42740850-42740872 ATTTGCCAGTCCTGGGTGGGGGG - Intergenic
1157616191 18:48989096-48989118 CTGGGTCAGGCCTGAGCGTGGGG - Intergenic
1157726555 18:49968804-49968826 CTGTTTCAGTACTGAGTGAGTGG - Intronic
1157838809 18:50935019-50935041 GGGTTTCAGTCCAGAGTGGGAGG - Intronic
1158677066 18:59529618-59529640 CTGTGTGGCTCCTGAGTGGGTGG + Intronic
1159800523 18:72893888-72893910 CTGTTTTAGTCCTGACTGGCGGG - Intergenic
1159935997 18:74368051-74368073 CTGAGCCAGTCCTGGGTGGCAGG + Intergenic
1159995522 18:74960647-74960669 CTGAGTCAGTGCTGGGTGGAGGG + Intronic
1159995530 18:74960683-74960705 CTGAGTCAGTGCTGGGTGGAGGG + Intronic
1159995561 18:74960827-74960849 CTGAGTCAGTGCTGGGTGGAGGG + Intronic
1159995568 18:74960863-74960885 CTGAGTCAGTGCTGGGTGGAGGG + Intronic
1162736024 19:12747599-12747621 CTGAGCCAGTGCTGGGTGGGTGG - Intronic
1163855517 19:19698778-19698800 CTGTTTCAGTACTGACTGAGTGG + Intergenic
1164042021 19:21501156-21501178 CTGTTTCAGTACTGACTGAGTGG - Intronic
1164779145 19:30878679-30878701 CTGTGACTCTGCTGAGTGGGTGG - Intergenic
1167665552 19:50821173-50821195 CTGTGTCTCTCCAGAGTGGAGGG + Intronic
1168441455 19:56371278-56371300 CTGTTTCAGTACTGACTGAGTGG + Intergenic
1168692359 19:58384885-58384907 TTGTGTCCATCCTGAGTGGCCGG - Intergenic
924972661 2:143278-143300 CTGTTTCAGTACTGACTGAGTGG - Intergenic
925038194 2:708550-708572 CTGCATTAGCCCTGAGTGGGTGG + Intergenic
925428353 2:3769911-3769933 CTGTGTGTGGCCTGAGTGTGTGG + Intronic
927937196 2:27082695-27082717 CAGTGACAGTGCTGAGTGGGCGG + Exonic
932590753 2:73065511-73065533 CTGCTTCAGTCCTGAGTAGCTGG + Intronic
932832928 2:75008220-75008242 CTGTCTAAGGCCAGAGTGGGTGG + Intergenic
938555276 2:132417895-132417917 CTGAGTGAGTCCTAAGTCGGGGG + Exonic
939039622 2:137172476-137172498 ATGTGGCAGTGCTGAGAGGGTGG + Intronic
939106507 2:137954612-137954634 CTGTTTCAGTACTGACTGAGTGG - Intergenic
939963615 2:148588723-148588745 CTGTGTCAGTTCTGAGGGAAGGG + Intergenic
940707594 2:157124897-157124919 CTGTGCCACTCCTGGGTGGGTGG - Intergenic
944062525 2:195584082-195584104 CTGTGTCTGTCCCTAGTCGGAGG - Intronic
946598976 2:221338622-221338644 CTGTATGAGTCTTGATTGGGGGG - Intergenic
948545540 2:238726016-238726038 CTGTGTCCTTACTGGGTGGGTGG - Intergenic
1169640932 20:7751403-7751425 CTGTGACTGTCCTGAGTTGCAGG + Intergenic
1173119160 20:40273212-40273234 ATTTGCCAGTCCTGGGTGGGGGG - Intergenic
1176309475 21:5142074-5142096 CTGAGGCTGTGCTGAGTGGGTGG + Intronic
1176348759 21:5773486-5773508 CTGTGTTACTCCCGGGTGGGCGG - Intergenic
1176355573 21:5894070-5894092 CTGTGTTACTCCCGGGTGGGCGG - Intergenic
1176496068 21:7550969-7550991 CTGTGTTACTCCCGGGTGGGCGG + Intergenic
1176543080 21:8171556-8171578 CTGTGTTACTCCCGGGTGGGCGG - Intergenic
1176562031 21:8354601-8354623 CTGTGTTACTCCCGGGTGGGCGG - Intergenic
1179847585 21:44119959-44119981 CTGAGGCTGTGCTGAGTGGGTGG - Intronic
1180016155 21:45085860-45085882 CTATGTCAGTTCTGCGTGAGAGG - Intronic
1181041108 22:20193029-20193051 CTGTGTCAGGCCTCTGTGGGAGG + Intergenic
1181084607 22:20433762-20433784 CTGGGTCAGGGCTGGGTGGGTGG - Intronic
1181274117 22:21677766-21677788 CTGTGTCTCTCCTGAATGAGAGG + Intronic
1183047262 22:35229887-35229909 CTGGGTCAAGCCTGAGCGGGAGG + Intergenic
1183382755 22:37498606-37498628 CTGTGTCTTACCTGAGAGGGCGG - Intronic
1183895734 22:40967294-40967316 CCGTCTCAGTTCTGGGTGGGCGG + Intronic
1184015743 22:41784540-41784562 CTGTGACAGAGCTGGGTGGGAGG + Intronic
1184161542 22:42700203-42700225 TTGTGTCAGTCCTAAGGGGCAGG + Intronic
1184562854 22:45273489-45273511 CTGAGCCAGTCCTGGGTCGGGGG - Intergenic
949467656 3:4360438-4360460 CTGGCTCAGTCCTGAGTAGCTGG + Intronic
949946842 3:9196247-9196269 CTTTGGCAGTCCTTAATGGGTGG - Intronic
950187503 3:10954089-10954111 CTGGGTGAGCCCTGAGTGGGGGG - Intergenic
950528647 3:13539818-13539840 CTATGTCATCCCTGTGTGGGCGG + Intergenic
953149737 3:40314014-40314036 CTGTGTGAGTCCAAAGTGGGTGG + Intergenic
953602963 3:44386513-44386535 ATGTCCCAGTCCAGAGTGGGTGG - Intronic
954395513 3:50291425-50291447 CTGGGTGAGTCCTGAGAGGATGG - Intronic
954413256 3:50380514-50380536 ATCTCTCAGTCCTGAGTGGGTGG + Intronic
956179706 3:66505661-66505683 CAGTGTTAGTTCTGAGTGGTTGG - Intergenic
956380149 3:68656632-68656654 CTGTTTCAGTACTGACTGAGTGG + Intergenic
956856478 3:73280160-73280182 TGGTGTCACTGCTGAGTGGGAGG + Intergenic
958807927 3:98834073-98834095 CTGTGTCGTTCCTGAGTGGGTGG + Intronic
959891939 3:111566779-111566801 TTGTGTCATTCCTTTGTGGGAGG + Intronic
959950670 3:112176258-112176280 CTGTGTCACTCCCAGGTGGGTGG + Intronic
959957010 3:112251251-112251273 CTGTGTCACTCCTAGGTGGGTGG - Intronic
961597871 3:128033323-128033345 ATGTGCCAATCCTGAGTGGTGGG - Intergenic
962185985 3:133259873-133259895 CTGTGTCAGTGCAGAATAGGCGG + Intronic
964694345 3:159491099-159491121 CTGTCTCAGTCTTGAATGTGTGG - Intronic
964719174 3:159754990-159755012 CTTTGGGAGGCCTGAGTGGGTGG + Intronic
964748502 3:160033613-160033635 CTTTGGGAGGCCTGAGTGGGCGG - Intergenic
966948638 3:184796038-184796060 CTGGGGCAGTCCAGTGTGGGTGG + Intergenic
968619532 4:1597539-1597561 CTGGGTCAGTTCTGAGGGAGGGG - Intergenic
968729522 4:2262962-2262984 CTGTGTCTGGCCTGAGGGGCAGG + Intergenic
968875998 4:3268308-3268330 CTGAGGCAGTCCTGAGGGTGAGG + Intronic
969596037 4:8149800-8149822 CAGGGCCAGTCCTGAGTGTGAGG - Intronic
970067887 4:12120076-12120098 CTGTTTCAGTACTGACTGAGTGG + Intergenic
973143012 4:46792438-46792460 CTGTTTGAGGCCTCAGTGGGTGG - Intronic
976913372 4:90337441-90337463 ATGTTTCAGTCCTGATTGTGGGG + Intronic
976931797 4:90575291-90575313 CTGTGTCATTCCATAGTGGAAGG + Intronic
977002403 4:91519734-91519756 CTGTGCCACTCCTGGGTGTGTGG + Intronic
977979815 4:103307976-103307998 CTGCGCCACTCCTGGGTGGGTGG + Intergenic
978196005 4:105972848-105972870 GTGTTTCAGTCTTGAGAGGGAGG + Intronic
980626769 4:135382568-135382590 CTGAGTCATTCCTGGGTGGGGGG - Intergenic
980881881 4:138718815-138718837 CTGTTTCAGTACTGACTGAGTGG - Intergenic
981283235 4:142985098-142985120 CTGGCTCAGTCCTGAGTCAGTGG + Intergenic
983453079 4:167930756-167930778 CTGTTTCAGTACTGACTGAGTGG + Intergenic
984466234 4:180102031-180102053 CTGTGCCAGTCCTGAGGAGGTGG + Intergenic
985655036 5:1126918-1126940 CTGTGAATGTCCTGACTGGGAGG + Intergenic
985748506 5:1661356-1661378 CTGTCGCTGTGCTGAGTGGGTGG - Intergenic
987085276 5:14462063-14462085 CTGTGTGAGACTTGAGTCGGGGG - Intronic
987227998 5:15863635-15863657 GTGTGTCAGTCCTGGGAGGTGGG + Intronic
987719166 5:21612633-21612655 CTGTTTCAGTACTGACTGAGTGG - Intergenic
988017415 5:25577106-25577128 CTGAGTCTGTCCTGAGTGTGTGG - Intergenic
989490576 5:42048081-42048103 CTGTGTCAATCCCATGTGGGTGG - Intergenic
990277719 5:54215781-54215803 CTGTTTCAGTCAGGGGTGGGGGG + Intronic
995141773 5:108743163-108743185 CTGTTTCAGTACTGACTGAGTGG - Intergenic
996650357 5:125868472-125868494 CTGTGTCAGGCCATAGTTGGGGG - Intergenic
997734483 5:136203307-136203329 CTGTGTGTGTGTTGAGTGGGGGG - Intergenic
999144214 5:149381838-149381860 CAGTGCCAGGCCTGAGAGGGAGG + Intronic
999270273 5:150292859-150292881 CTGGGACAGTCCTGCGTGGCTGG + Intergenic
1000727167 5:164785584-164785606 CTGTTTCAGTACTGACTGAGTGG - Intergenic
1001144102 5:169169021-169169043 CAGGGTCAGCCCAGAGTGGGGGG + Intronic
1001567071 5:172706750-172706772 CTGTTTAAGCCCTGAGTTGGTGG + Intergenic
1003468288 6:6402658-6402680 ATATGTCAGTCAAGAGTGGGTGG + Intergenic
1004455947 6:15791608-15791630 CTGTTTCAGTACTGACTGAGTGG - Intergenic
1006672750 6:35739716-35739738 CTGTTTCAGTACTGACTGCGTGG - Intronic
1007842846 6:44730810-44730832 CTGTGTCAGTCCAGGGGGGCTGG - Intergenic
1009378245 6:62998215-62998237 CTGTTTCAGTACTGACTGAGTGG - Intergenic
1009484885 6:64208194-64208216 CTGTGTCATTCCTGTGTGTGGGG + Intronic
1009852669 6:69217130-69217152 TTCTTTGAGTCCTGAGTGGGTGG + Intronic
1010295922 6:74195252-74195274 CTGTGTCATTCCTGGGTGGGTGG + Intergenic
1010972270 6:82275565-82275587 CTGACTCTGTCCAGAGTGGGAGG - Intergenic
1011083905 6:83517645-83517667 GTGTGTCAATCCTGAGTAGGTGG + Intronic
1012862304 6:104574279-104574301 CAGTGTCACTCCAGAGGGGGAGG + Intergenic
1013371891 6:109477954-109477976 CTGTTTCAGTACTGACTGAGTGG + Intronic
1014932769 6:127353657-127353679 CTGTGGCAGTACTGAGTGGTGGG - Intergenic
1015631308 6:135234749-135234771 ATGTGTAAGTCCTGAGTGCCTGG + Intergenic
1016289077 6:142507459-142507481 CCGTGTTGCTCCTGAGTGGGTGG + Intergenic
1020685556 7:11289438-11289460 CTGTATCATTCCGGAGTGAGAGG + Intergenic
1021472048 7:21014250-21014272 GTGTGTCAGTCCTGCTTGTGTGG - Intergenic
1021868994 7:24985160-24985182 CTGTTTCAGTACTGACTGAGTGG - Intergenic
1024190981 7:47009475-47009497 CTGTTTCAGTACTGACTGGGTGG + Intergenic
1024732879 7:52272886-52272908 CTGTTTCAGTACTGACTGAGTGG + Intergenic
1025796925 7:64746515-64746537 CTGTTTCAGTACTGACTGAGTGG - Intergenic
1025869884 7:65421831-65421853 CTGTGTCACTCCAGGGTGGGTGG - Intergenic
1025962812 7:66238448-66238470 CTGTTTCAGTACTGACTGAGTGG - Intronic
1026870521 7:73848465-73848487 CTGTTTCAGTACTGACTGAGTGG - Intergenic
1031322135 7:120344275-120344297 CTGGTTCAGTTCTGAGTAGGCGG - Intronic
1033551579 7:142452376-142452398 CTGAGTGAGTGATGAGTGGGTGG + Intergenic
1033556097 7:142489554-142489576 CTGAGTGAGTGATGAGTGGGTGG + Intergenic
1033558466 7:142509000-142509022 CTGAGTGAGTGATGAGTGGGTGG + Intergenic
1035442198 7:158910870-158910892 CTGTGTCAGGCCTGTGAGCGAGG + Intronic
1035556275 8:569466-569488 CTCTGTCAGCCCAGGGTGGGGGG - Intergenic
1035564126 8:629965-629987 GTGAGTCAGTTCTGTGTGGGTGG - Intronic
1035901365 8:3461414-3461436 CTGTGTCAGTCCCCAGAGGCTGG + Intronic
1037390660 8:18387906-18387928 CTGTCTCAGACCTAAGTGGAGGG - Intergenic
1037954978 8:23049186-23049208 CTGTGTCAGTACTGACTGAGTGG + Intronic
1038532379 8:28328880-28328902 CTGGGTTAGTCCTGGGTGGCAGG - Intronic
1039216400 8:35276725-35276747 CTGTTTCAGTACTGACTGAGTGG + Intronic
1045827157 8:106411814-106411836 CTCACTCAGTCCTGAATGGGTGG - Intronic
1046487616 8:114908463-114908485 CTGTGCCAGTCCTGAGTGGGTGG - Intergenic
1047182751 8:122605140-122605162 CTATGTCAGTCCTATGGGGGAGG + Intergenic
1047547914 8:125838377-125838399 CTGTCCCAGTCCTCAGTGGGTGG - Intergenic
1047604990 8:126465913-126465935 CTCTGTGAGTCCTAGGTGGGAGG + Intergenic
1049557931 8:143292709-143292731 CTGCGTCAGCCCTGGGTGGAGGG + Intronic
1050271012 9:3945094-3945116 ATGTGTCAGTGCTGAGAGGTGGG - Intronic
1050939770 9:11443724-11443746 CTGTGTCAGCACTGAGAGGCTGG + Intergenic
1052262952 9:26539193-26539215 CCATGTCACTCCTGGGTGGGTGG - Intergenic
1052576639 9:30299652-30299674 GTGTGCCAGTCCTGGGTGGTGGG - Intergenic
1052863839 9:33453182-33453204 CTGTGTCTCACCTGGGTGGGAGG + Intergenic
1057347736 9:94266223-94266245 CTGTTTCAGTACTGACTGAGTGG - Intronic
1057867545 9:98693261-98693283 CTGTTTTGGCCCTGAGTGGGTGG - Intronic
1058396293 9:104557587-104557609 CTGTTTCAGTACTGACTGAGTGG + Intergenic
1059052988 9:110948620-110948642 CTGTGTCAGTCCTAAGAGGAAGG + Intronic
1059423897 9:114209096-114209118 CTTTGTCTGTCCAGTGTGGGTGG + Intronic
1059779288 9:117508874-117508896 CTGTGCCAGTCCTGGGTGGATGG + Intergenic
1060052062 9:120384667-120384689 TTGTGACAGCCCTGGGTGGGAGG - Intergenic
1060478675 9:124003744-124003766 ATGAATCAGTCCTGATTGGGTGG + Intronic
1060578963 9:124726209-124726231 CTGTGTATGTCCTTAGTGGTAGG + Intronic
1060745070 9:126125985-126126007 CTGTATCAGCCCTGGGAGGGGGG - Intergenic
1060813488 9:126623079-126623101 CATTGTCTGTCCTGCGTGGGAGG + Intronic
1061827760 9:133272451-133272473 CTGTTTCAGTACTGACTGAGTGG + Intronic
1062465399 9:136678540-136678562 CTGTGCCAGCGCTGACTGGGGGG + Intronic
1062562468 9:137147773-137147795 CTGTGTCAGTCCTGAGTGGGAGG - Intronic
1186429917 X:9496438-9496460 CTGTGTCAGCCCTGGGGGAGAGG - Intronic
1186450607 X:9670284-9670306 CTGAGTCATTCCTCAGTAGGGGG - Intronic
1187156691 X:16726548-16726570 CTGTTTCAGTACTGACTGAGTGG - Intronic
1187157260 X:16732601-16732623 CTGTTTCAGTACTGACTGAGTGG - Intronic
1187208844 X:17209263-17209285 CTGTTTCAGTACTGACTGAGTGG + Intergenic
1187376871 X:18763475-18763497 CTGTCTCAGTACTGACTGAGTGG - Intronic
1189679999 X:43505931-43505953 ATGTGTCACAGCTGAGTGGGAGG + Intergenic
1190298380 X:49042021-49042043 GTGTGTGAGCCCTGGGTGGGGGG - Intronic
1190309802 X:49109084-49109106 CTGTGTCATTCCATAGTGGAGGG - Intergenic
1190741428 X:53291477-53291499 CTGTGCCAGCCCTGAGTAGTGGG - Intronic
1194310394 X:92299314-92299336 CTGTTTCAGTACTGACTGAGTGG - Intronic
1194539645 X:95155564-95155586 CTCTGTCACTCCTGGGTGAGGGG - Intergenic
1195280093 X:103324015-103324037 CTGTGTCAGTTTTGAGTGGATGG - Intergenic
1196074125 X:111556122-111556144 CTGTTTCAGTACTGATTGAGTGG - Intergenic
1197092909 X:122559652-122559674 CTGTGTCACTCCTAGGTGGATGG - Intergenic
1197310053 X:124893735-124893757 CTGTGTCATTCCTTAGTAAGGGG - Intronic
1198791786 X:140354349-140354371 CTGTGTCTGTGGGGAGTGGGGGG - Intergenic
1199560126 X:149152536-149152558 CTGCACCAGCCCTGAGTGGGTGG + Intergenic
1199682481 X:150236497-150236519 CTTTGTCATTACTGAGTGGGTGG + Intergenic
1200037892 X:153345225-153345247 ATGTGTGAGCTCTGAGTGGGTGG + Intronic
1201592752 Y:15633665-15633687 GGGTATCAGTGCTGAGTGGGTGG + Intergenic