ID: 1062562470

View in Genome Browser
Species Human (GRCh38)
Location 9:137147776-137147798
Sequence AACCTGTGTCAGTCCTGAGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 153
Summary {0: 1, 1: 0, 2: 1, 3: 13, 4: 138}

Found 12 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1062562470_1062562479 15 Left 1062562470 9:137147776-137147798 CCCACTCAGGACTGACACAGGTT 0: 1
1: 0
2: 1
3: 13
4: 138
Right 1062562479 9:137147814-137147836 GGGGCCACACAGCAGGTGCACGG No data
1062562470_1062562486 26 Left 1062562470 9:137147776-137147798 CCCACTCAGGACTGACACAGGTT 0: 1
1: 0
2: 1
3: 13
4: 138
Right 1062562486 9:137147825-137147847 GCAGGTGCACGGCAGGGTGGGGG No data
1062562470_1062562483 23 Left 1062562470 9:137147776-137147798 CCCACTCAGGACTGACACAGGTT 0: 1
1: 0
2: 1
3: 13
4: 138
Right 1062562483 9:137147822-137147844 ACAGCAGGTGCACGGCAGGGTGG No data
1062562470_1062562484 24 Left 1062562470 9:137147776-137147798 CCCACTCAGGACTGACACAGGTT 0: 1
1: 0
2: 1
3: 13
4: 138
Right 1062562484 9:137147823-137147845 CAGCAGGTGCACGGCAGGGTGGG No data
1062562470_1062562487 29 Left 1062562470 9:137147776-137147798 CCCACTCAGGACTGACACAGGTT 0: 1
1: 0
2: 1
3: 13
4: 138
Right 1062562487 9:137147828-137147850 GGTGCACGGCAGGGTGGGGGCGG No data
1062562470_1062562481 19 Left 1062562470 9:137147776-137147798 CCCACTCAGGACTGACACAGGTT 0: 1
1: 0
2: 1
3: 13
4: 138
Right 1062562481 9:137147818-137147840 CCACACAGCAGGTGCACGGCAGG No data
1062562470_1062562485 25 Left 1062562470 9:137147776-137147798 CCCACTCAGGACTGACACAGGTT 0: 1
1: 0
2: 1
3: 13
4: 138
Right 1062562485 9:137147824-137147846 AGCAGGTGCACGGCAGGGTGGGG No data
1062562470_1062562475 -6 Left 1062562470 9:137147776-137147798 CCCACTCAGGACTGACACAGGTT 0: 1
1: 0
2: 1
3: 13
4: 138
Right 1062562475 9:137147793-137147815 CAGGTTGGAGTGGGCACTGCTGG No data
1062562470_1062562476 -5 Left 1062562470 9:137147776-137147798 CCCACTCAGGACTGACACAGGTT 0: 1
1: 0
2: 1
3: 13
4: 138
Right 1062562476 9:137147794-137147816 AGGTTGGAGTGGGCACTGCTGGG No data
1062562470_1062562478 8 Left 1062562470 9:137147776-137147798 CCCACTCAGGACTGACACAGGTT 0: 1
1: 0
2: 1
3: 13
4: 138
Right 1062562478 9:137147807-137147829 CACTGCTGGGGCCACACAGCAGG No data
1062562470_1062562482 20 Left 1062562470 9:137147776-137147798 CCCACTCAGGACTGACACAGGTT 0: 1
1: 0
2: 1
3: 13
4: 138
Right 1062562482 9:137147819-137147841 CACACAGCAGGTGCACGGCAGGG No data
1062562470_1062562477 -4 Left 1062562470 9:137147776-137147798 CCCACTCAGGACTGACACAGGTT 0: 1
1: 0
2: 1
3: 13
4: 138
Right 1062562477 9:137147795-137147817 GGTTGGAGTGGGCACTGCTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1062562470 Original CRISPR AACCTGTGTCAGTCCTGAGT GGG (reversed) Intronic
900598624 1:3493673-3493695 TACCTGTGCCAGTCCTGGGCTGG - Intronic
903747456 1:25597580-25597602 ATCCTGTGTCTCTCCTGCGTGGG - Intergenic
904287888 1:29464550-29464572 TATCTGTATCAGTTCTGAGTTGG + Intergenic
904307826 1:29601626-29601648 AGGCTGTGCCAGTCCTGAGCTGG + Intergenic
904316208 1:29665833-29665855 AATTTGTGTCAGTTCTAAGTTGG - Intergenic
904416912 1:30368600-30368622 AACCTGTCACAGTGCAGAGTAGG + Intergenic
908285001 1:62587611-62587633 AACGTTTATCAGTACTGAGTTGG + Intronic
909468496 1:76000990-76001012 AACCTGTGAGAGTTCTGAGTGGG - Intergenic
913164421 1:116171825-116171847 AACCTGTGTCACTCTGGAGCAGG - Intergenic
915951408 1:160192034-160192056 TACCTGAGTCTGTGCTGAGTGGG + Intronic
922315918 1:224441968-224441990 AAACTCTGTTAGTCCTGAGTTGG - Intronic
923243440 1:232108495-232108517 AACCAGTGTCAGCCCACAGTAGG - Intergenic
923514721 1:234685643-234685665 GATCTGTGTCAGTCCTGGATTGG - Intergenic
924911036 1:248513592-248513614 AACCTGTGTCACACCTATGTGGG - Intergenic
924913065 1:248534448-248534470 AACCTGTGTCACACCTATGTGGG + Intergenic
924939840 1:248805393-248805415 AACCTGAGCAAGTCCAGAGTTGG - Intergenic
924946818 1:248852030-248852052 AAGTTGTGTCTATCCTGAGTTGG - Intronic
1066156772 10:32686705-32686727 AACATGTCTCACTCCTGAGGAGG - Intronic
1067722997 10:48743742-48743764 AATCTGAGTCAGTACTGGGTTGG + Intronic
1069601172 10:69709212-69709234 CAACTGTGTCAGTCCTGAAAGGG - Intergenic
1070874032 10:79784476-79784498 AGCCTGTGCCAGTCCTTAGTGGG + Intergenic
1071640964 10:87306615-87306637 AGCCTCTGCCAGTCCTTAGTGGG + Intergenic
1071654272 10:87431321-87431343 AGCCTCTGCCAGTCCTTAGTGGG - Intergenic
1074592594 10:114827343-114827365 ACTCTGTGTCATGCCTGAGTTGG + Intronic
1076631745 10:131855969-131855991 ATGCTGTGTCAGCCCTGAATGGG - Intergenic
1082911820 11:58385693-58385715 TACATTTGTCAGTCCTTAGTTGG + Intergenic
1083502481 11:63123109-63123131 AAGTTGTGTCAGTCTTGATTTGG + Intronic
1083689849 11:64400742-64400764 ATCCTCTGTCAGTCCAAAGTGGG - Intergenic
1085677880 11:78542141-78542163 AACCTTTCTCAGGGCTGAGTGGG - Intronic
1086755481 11:90557208-90557230 CATCTGTGTCAGTCGTGAATTGG - Intergenic
1087340599 11:96901189-96901211 GACCTGAATCAGTCCTCAGTTGG + Intergenic
1089371276 11:117960338-117960360 TATCTGTGTCAGTTCTGGGTTGG - Intergenic
1091590135 12:1837821-1837843 GACCTGTGCCAGGCCTGAGAGGG - Intronic
1093726177 12:22511518-22511540 CAACCTTGTCAGTCCTGAGTTGG - Intronic
1097097664 12:56562570-56562592 AAGCTGTGTCAGCCGTAAGTTGG + Exonic
1098036676 12:66310331-66310353 ATCCTGTGACAGTCATAAGTGGG + Exonic
1099259949 12:80365926-80365948 AATCTTTGTCAGTCCTGATAGGG + Intronic
1099860280 12:88217901-88217923 GCTCTGTGCCAGTCCTGAGTGGG - Intergenic
1102324513 12:111968586-111968608 TATCTGTTTCAGTCCTGGGTAGG - Intronic
1102456439 12:113073675-113073697 AAGCTCTTTCAGCCCTGAGTAGG + Intronic
1102552602 12:113702550-113702572 GAACTGTGTCAGACTTGAGTTGG + Intergenic
1102828035 12:115967239-115967261 AAACTGTATCAATTCTGAGTTGG + Intronic
1104833631 12:131772484-131772506 CCCCTGTGCCAGTCCTGAGAAGG - Intronic
1107072321 13:36284840-36284862 GACCTGTGTCAGGGCTGAGGAGG - Intronic
1107285788 13:38790319-38790341 ATACTGTGGCTGTCCTGAGTGGG - Intronic
1108158645 13:47614968-47614990 TTCCTGATTCAGTCCTGAGTGGG + Intergenic
1111034160 13:82648825-82648847 AAGCTGTGAAAGTGCTGAGTGGG - Intergenic
1111944119 13:94645739-94645761 AGCCTCTCTCAGCCCTGAGTTGG + Intergenic
1113837500 13:113338061-113338083 AGACTGCGTCAGTCATGAGTCGG - Intronic
1117285045 14:54278886-54278908 AAGCTGAGTCAGACCTGACTGGG + Intergenic
1118421641 14:65612059-65612081 CATCTGTGTCAGTTTTGAGTTGG + Intronic
1120907642 14:89634190-89634212 ATTCTATGTCAGTCCTGGGTGGG - Intronic
1122072384 14:99213071-99213093 ACCCTGTGCCAGTGCAGAGTGGG + Intronic
1122534504 14:102452722-102452744 AACCTGTGAGAGTTCTGAGGGGG + Intronic
1125685510 15:41561088-41561110 AACATGTGTCAGCCTTGAGAGGG - Intronic
1127845286 15:62865499-62865521 AACCTTTTTGATTCCTGAGTTGG - Intergenic
1130726473 15:86444545-86444567 AACCTGCCTAAGACCTGAGTGGG + Intronic
1130971412 15:88736539-88736561 ACCTGGGGTCAGTCCTGAGTGGG + Intergenic
1133106212 16:3511446-3511468 AACCATTGTAAGTCCTTAGTGGG + Intronic
1138885559 16:61073731-61073753 AACATGTGTCAGCCCTGAGAAGG - Intergenic
1139469630 16:67171130-67171152 TCCCTGTGTCTGTCCCGAGTAGG + Exonic
1140055720 16:71523843-71523865 AGCCAGTGTCTGGCCTGAGTAGG - Intronic
1142847703 17:2690219-2690241 AGCCCGAGCCAGTCCTGAGTGGG - Exonic
1143100437 17:4501578-4501600 AACCTGTGTCTGTTGTGTGTTGG - Intronic
1147690017 17:42309201-42309223 AACCTGTCTCAGCCCTGGGGAGG + Intronic
1150649891 17:67003030-67003052 AGTCTGTGTCAGTCCTGATAGGG + Intronic
1152758192 17:82095888-82095910 TGCCTGTGTCTGTCCTGAGCTGG - Intronic
1154941329 18:21115341-21115363 AACCAGTGGCAGTCCTTGGTGGG + Intergenic
1155264376 18:24076619-24076641 AACCTGTTTCAGTGCCAAGTTGG + Intronic
1162235580 19:9306410-9306432 GACCTGTGTCAGCCCTGATGTGG + Intronic
1163556007 19:17993227-17993249 TTCCTGGGGCAGTCCTGAGTTGG + Intronic
1165660910 19:37579246-37579268 AACCTGTGTGAGACCTGAAGGGG - Intronic
927926493 2:27017277-27017299 GACCTGAGCGAGTCCTGAGTAGG + Intronic
931125644 2:59273591-59273613 AACCTGTGACAATTCTGGGTGGG - Intergenic
937689070 2:124733980-124734002 AACATGTGTGAAGCCTGAGTAGG + Intronic
941591284 2:167423263-167423285 AGCCAGTGTCAGCCCTGAGCTGG + Intergenic
945312295 2:208328263-208328285 TGCCTGTGTCAGTCCTTGGTAGG + Exonic
945716424 2:213362984-213363006 AAACTGTCTCAGTCCAGAGGAGG + Intronic
946536937 2:220640580-220640602 CACCTTTGTCAGTACTGAGTTGG - Intergenic
947441702 2:230127699-230127721 AGCCTGTGTCTGTACTGACTAGG + Intergenic
948489615 2:238304099-238304121 AACCAGAGTCAGTCCTGGGAGGG - Intergenic
948984431 2:241511550-241511572 AACCTGGGTCAGGTGTGAGTTGG + Intergenic
1171428146 20:25061340-25061362 ATCGTGTGGCAGTCCTGAGGTGG - Intergenic
1173724525 20:45288134-45288156 AGACTGTGTCAGTCCAGAGCTGG - Intergenic
1174851614 20:54000927-54000949 CACCTGTGTCAGTTCTGGGTAGG + Intronic
1175243069 20:57563828-57563850 AAACTCTGTTAGTCCAGAGTTGG + Intronic
1175843342 20:62045205-62045227 TCCCTGTGACAGTCCTGAGCGGG - Intronic
1177544756 21:22542495-22542517 AACCTCTGTCATCCCTGAGCTGG + Intergenic
1182549152 22:31091666-31091688 CCCCAGTGTCAGTTCTGAGTGGG - Exonic
1184562859 22:45273492-45273514 ACCCTGAGCCAGTCCTGGGTCGG - Intergenic
949843390 3:8345093-8345115 CATCTGTTTCAGTCCTGGGTTGG - Intergenic
954680380 3:52342827-52342849 ATCCAGTGTCAGTGTTGAGTGGG + Intronic
954861461 3:53694352-53694374 CACCTTTCTCTGTCCTGAGTTGG + Intronic
958185789 3:90117833-90117855 AGCCTGTGTCAGGCATGATTTGG - Intergenic
958807924 3:98834070-98834092 GCCCTGTGTCGTTCCTGAGTGGG + Intronic
961381470 3:126498787-126498809 AAGATGTGCCAGTCCTCAGTGGG - Intronic
962407032 3:135109186-135109208 AAACTGCCTCAGTCTTGAGTGGG + Intronic
963136364 3:141908950-141908972 CACCTGTGTCACTCCTGCTTTGG + Intronic
964572333 3:158122477-158122499 AACCTTTGTCTGTTCTTAGTAGG + Intronic
966537700 3:181052640-181052662 AACCTGTATAAGACCTGAGAGGG - Intergenic
971188131 4:24400969-24400991 AACCTGTATCAGGTCTAAGTAGG + Intergenic
972212186 4:36852166-36852188 AATCTCTGCCAGTCCAGAGTTGG + Intergenic
975161177 4:71125574-71125596 AAGCTTTGTCAGACCTGATTAGG - Intergenic
978238960 4:106492635-106492657 ACTCTGTGTCACTCCTGGGTGGG + Intergenic
979653901 4:123168985-123169007 AACTAGTGTCTGTCCTGAGTTGG + Intronic
982349010 4:154394347-154394369 AACCTGTCTGACTCCTGAGGGGG - Intronic
983160212 4:164403767-164403789 AAGCTATGTCAGTCATGTGTAGG - Intergenic
984466233 4:180102028-180102050 AGTCTGTGCCAGTCCTGAGGAGG + Intergenic
987085280 5:14462066-14462088 AACCTGTGTGAGACTTGAGTCGG - Intronic
989341027 5:40375774-40375796 AACCTGTGTCAGTCACTTGTTGG + Intergenic
991980484 5:72225370-72225392 AGCCAGTGTGAGTCCTGAGAAGG - Intronic
994769169 5:103959421-103959443 GATCTATGTCAGTTCTGAGTTGG - Intergenic
995565529 5:113430112-113430134 ATACTTTGTCACTCCTGAGTGGG - Intronic
998403179 5:141858650-141858672 AATCTGTGGCAGTCCCAAGTGGG - Intronic
1003298940 6:4859385-4859407 AAACCTTCTCAGTCCTGAGTTGG + Intronic
1006723023 6:36172332-36172354 AATCTGTGACAGTCCTCAATAGG + Intergenic
1006965440 6:37979265-37979287 CACCTCTGTCAGTTCTGAGTTGG + Intronic
1010689534 6:78892619-78892641 CATCTGTGTCACTCCTGAGTTGG - Intronic
1011344317 6:86352401-86352423 CAACTGAGTCAGTCCTGAGGAGG + Intergenic
1012494400 6:99818693-99818715 AACCTGAATCAGGCTTGAGTTGG - Intergenic
1014630950 6:123789465-123789487 AAGCTGTGGCAGTTCTGAGGGGG - Intergenic
1022835121 7:34106050-34106072 AGCTCGTCTCAGTCCTGAGTGGG + Intronic
1023782486 7:43669806-43669828 AACCTGGGCAAGTCCTGGGTAGG - Intronic
1035909668 8:3551904-3551926 TACCTGTGTCAGTCCAGACGTGG + Intronic
1036764536 8:11539534-11539556 AACCTGAGATAGTCCAGAGTGGG + Intronic
1037872950 8:22516545-22516567 AACCTCTGTAAGTACTGATTTGG - Intronic
1039835919 8:41256211-41256233 AACCTGCCTCTGCCCTGAGTTGG - Intergenic
1041668114 8:60465750-60465772 AACCTGTGAGTGTCCTGAGTGGG - Intergenic
1043385293 8:79742379-79742401 AACCTGGATCTATCCTGAGTGGG - Intergenic
1046273096 8:111921777-111921799 AACCACTGTCAGCCCTGAGGTGG + Intergenic
1046487617 8:114908466-114908488 GCTCTGTGCCAGTCCTGAGTGGG - Intergenic
1047503414 8:125459948-125459970 AACAAGTGTCAGTCCTCAGTAGG + Intergenic
1048910978 8:139134817-139134839 AACCTGTGTGAACCCTGAATGGG - Intergenic
1050423423 9:5490380-5490402 AACATTTTTCAGACCTGAGTGGG - Intergenic
1050532915 9:6606386-6606408 AAACTGTGTCAGAATTGAGTGGG - Intronic
1056288136 9:85112131-85112153 ACCCGGTCCCAGTCCTGAGTAGG - Intergenic
1056515211 9:87343425-87343447 AACCTGTGTCAGTCCAGAGACGG - Intergenic
1056547463 9:87624665-87624687 ATCCTGTGACACTCCTGAGTTGG + Intronic
1058798695 9:108523357-108523379 AACCTGTGGCAGTTCTCACTAGG - Intergenic
1060442340 9:123653630-123653652 GACATGATTCAGTCCTGAGTGGG + Intronic
1061521678 9:131121919-131121941 TAACTGTCTCAGTCCTGAGCAGG - Exonic
1062143545 9:134974686-134974708 CACCTCTGTCAGTCCTAATTTGG - Intergenic
1062376477 9:136264048-136264070 AGCCTGTGCCAGCCCTGCGTGGG - Intergenic
1062562470 9:137147776-137147798 AACCTGTGTCAGTCCTGAGTGGG - Intronic
1187793788 X:22979492-22979514 CACCTGTGTGAGTACTCAGTGGG - Intergenic
1188032928 X:25284638-25284660 AGCCTGTGTTAGGACTGAGTGGG - Intergenic
1188815452 X:34706751-34706773 AATCTGTTTCAGTCTAGAGTTGG - Intergenic
1190885917 X:54530809-54530831 AGCCTCTGTCTGTCCTGAGGAGG - Intronic
1193513231 X:82432386-82432408 AGTCTGTGCCAGTCCTGGGTGGG - Intergenic
1198083904 X:133265240-133265262 ACCCTGTCTCAGTTTTGAGTTGG - Intergenic
1199365123 X:146971713-146971735 ATCCTGGGGCAGCCCTGAGTGGG - Intergenic
1199382247 X:147184058-147184080 ATCCTGGGGCAGCCCTGAGTGGG + Intergenic
1201902373 Y:19056897-19056919 CACCTGTTTCAGTTCTAAGTTGG - Intergenic