ID: 1062562471

View in Genome Browser
Species Human (GRCh38)
Location 9:137147777-137147799
Sequence CAACCTGTGTCAGTCCTGAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 164
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 152}

Found 12 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1062562471_1062562477 -5 Left 1062562471 9:137147777-137147799 CCACTCAGGACTGACACAGGTTG 0: 1
1: 0
2: 0
3: 11
4: 152
Right 1062562477 9:137147795-137147817 GGTTGGAGTGGGCACTGCTGGGG No data
1062562471_1062562475 -7 Left 1062562471 9:137147777-137147799 CCACTCAGGACTGACACAGGTTG 0: 1
1: 0
2: 0
3: 11
4: 152
Right 1062562475 9:137147793-137147815 CAGGTTGGAGTGGGCACTGCTGG No data
1062562471_1062562481 18 Left 1062562471 9:137147777-137147799 CCACTCAGGACTGACACAGGTTG 0: 1
1: 0
2: 0
3: 11
4: 152
Right 1062562481 9:137147818-137147840 CCACACAGCAGGTGCACGGCAGG No data
1062562471_1062562485 24 Left 1062562471 9:137147777-137147799 CCACTCAGGACTGACACAGGTTG 0: 1
1: 0
2: 0
3: 11
4: 152
Right 1062562485 9:137147824-137147846 AGCAGGTGCACGGCAGGGTGGGG No data
1062562471_1062562483 22 Left 1062562471 9:137147777-137147799 CCACTCAGGACTGACACAGGTTG 0: 1
1: 0
2: 0
3: 11
4: 152
Right 1062562483 9:137147822-137147844 ACAGCAGGTGCACGGCAGGGTGG No data
1062562471_1062562487 28 Left 1062562471 9:137147777-137147799 CCACTCAGGACTGACACAGGTTG 0: 1
1: 0
2: 0
3: 11
4: 152
Right 1062562487 9:137147828-137147850 GGTGCACGGCAGGGTGGGGGCGG No data
1062562471_1062562478 7 Left 1062562471 9:137147777-137147799 CCACTCAGGACTGACACAGGTTG 0: 1
1: 0
2: 0
3: 11
4: 152
Right 1062562478 9:137147807-137147829 CACTGCTGGGGCCACACAGCAGG No data
1062562471_1062562479 14 Left 1062562471 9:137147777-137147799 CCACTCAGGACTGACACAGGTTG 0: 1
1: 0
2: 0
3: 11
4: 152
Right 1062562479 9:137147814-137147836 GGGGCCACACAGCAGGTGCACGG No data
1062562471_1062562482 19 Left 1062562471 9:137147777-137147799 CCACTCAGGACTGACACAGGTTG 0: 1
1: 0
2: 0
3: 11
4: 152
Right 1062562482 9:137147819-137147841 CACACAGCAGGTGCACGGCAGGG No data
1062562471_1062562486 25 Left 1062562471 9:137147777-137147799 CCACTCAGGACTGACACAGGTTG 0: 1
1: 0
2: 0
3: 11
4: 152
Right 1062562486 9:137147825-137147847 GCAGGTGCACGGCAGGGTGGGGG No data
1062562471_1062562476 -6 Left 1062562471 9:137147777-137147799 CCACTCAGGACTGACACAGGTTG 0: 1
1: 0
2: 0
3: 11
4: 152
Right 1062562476 9:137147794-137147816 AGGTTGGAGTGGGCACTGCTGGG No data
1062562471_1062562484 23 Left 1062562471 9:137147777-137147799 CCACTCAGGACTGACACAGGTTG 0: 1
1: 0
2: 0
3: 11
4: 152
Right 1062562484 9:137147823-137147845 CAGCAGGTGCACGGCAGGGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1062562471 Original CRISPR CAACCTGTGTCAGTCCTGAG TGG (reversed) Intronic
902891571 1:19448054-19448076 CCACCTGTGCCAGGCCTGAGAGG - Intronic
903664761 1:24999528-24999550 CAGCCTGTGACAGTGCTGTGGGG - Intergenic
903747457 1:25597581-25597603 CATCCTGTGTCTCTCCTGCGTGG - Intergenic
905266868 1:36760360-36760382 CCACCTGGGTCAGTGCTGATGGG + Intergenic
906928208 1:50141691-50141713 CAACTTCTATCAGTCCTGAGGGG + Intronic
907318141 1:53585675-53585697 CAACCTGTTCCATTCCTGATGGG + Intronic
909468497 1:76000991-76001013 CAACCTGTGAGAGTTCTGAGTGG - Intergenic
911404991 1:97425964-97425986 CAACATTTGTCAGTTCTGAGTGG + Intronic
913263473 1:117022292-117022314 CAAGCTGTGTCATTCCAGTGGGG + Intronic
914492172 1:148159437-148159459 CAACCTGTGGCGGGCGTGAGAGG + Intergenic
915572089 1:156750386-156750408 TAACCTGTCTCAGTCCTTAGGGG + Intronic
916470539 1:165118573-165118595 CCACCTAGGTCAATCCTGAGTGG - Intergenic
918299121 1:183186202-183186224 CTACCTGACTCAGTCCTGACAGG - Intergenic
924742276 1:246801760-246801782 CATCATTTGTTAGTCCTGAGGGG + Intergenic
1064004792 10:11691165-11691187 CAGCCTGTGCCCATCCTGAGGGG - Intergenic
1069601173 10:69709213-69709235 TCAACTGTGTCAGTCCTGAAAGG - Intergenic
1070874031 10:79784475-79784497 CAGCCTGTGCCAGTCCTTAGTGG + Intergenic
1071640963 10:87306614-87306636 CAGCCTCTGCCAGTCCTTAGTGG + Intergenic
1071654273 10:87431322-87431344 CAGCCTCTGCCAGTCCTTAGTGG - Intergenic
1076682228 10:132179050-132179072 CACCCTGTGTCAGCCCTGGGTGG + Intronic
1079492580 11:21005936-21005958 CCACCTGTGTCAGTTATTAGTGG + Intronic
1082691002 11:56304769-56304791 CTTCCTGTGTCAATCTTGAGAGG + Intergenic
1083502102 11:63118959-63118981 CAATATGTGCCAGTCCTGAATGG + Exonic
1091590136 12:1837822-1837844 AGACCTGTGCCAGGCCTGAGAGG - Intronic
1092058271 12:5524687-5524709 CACCATTTGTCAGTCATGAGAGG - Intergenic
1095400620 12:41810648-41810670 CTTCCTGTTTCAGTCTTGAGAGG + Intergenic
1097520887 12:60669546-60669568 CTTCCTGTTTCAGTCTTGAGAGG + Intergenic
1097730069 12:63118628-63118650 ATACCTGAGTCAGTCCAGAGAGG - Intergenic
1099259948 12:80365925-80365947 GAATCTTTGTCAGTCCTGATAGG + Intronic
1102295407 12:111732840-111732862 CAAACTTTGTCAGAACTGAGTGG + Intronic
1102779934 12:115555569-115555591 CAACCTGGGACACTCCTGGGGGG - Intergenic
1108158644 13:47614967-47614989 CTTCCTGATTCAGTCCTGAGTGG + Intergenic
1112838676 13:103548435-103548457 ATACCTGTGTCAGTCTTGGGAGG - Intergenic
1115470384 14:33762854-33762876 TAACCTGTGTCAGTGCCGTGGGG + Intronic
1117842382 14:59873048-59873070 CAAGCTTTGTCAGTTCAGAGCGG - Intergenic
1117933541 14:60874423-60874445 CAACTTGTGCCAGACCTCAGAGG - Intronic
1119899602 14:78248686-78248708 CAATCTGTGTCAGCTCTGAATGG + Intronic
1120907643 14:89634191-89634213 CATTCTATGTCAGTCCTGGGTGG - Intronic
1122245652 14:100401503-100401525 CAACCTGAGGCAGCCCTGAACGG - Intronic
1122534503 14:102452721-102452743 CAACCTGTGAGAGTTCTGAGGGG + Intronic
1125579176 15:40773723-40773745 TCACCTTTGACAGTCCTGAGTGG + Exonic
1125685511 15:41561089-41561111 GAACATGTGTCAGCCTTGAGAGG - Intronic
1127696914 15:61459236-61459258 CAACCTGGGGCAGAGCTGAGAGG - Intergenic
1128215919 15:65934039-65934061 CAGCCTGTGTCAGCTGTGAGGGG - Intronic
1129994285 15:79991190-79991212 CATCATGTGTCTGCCCTGAGGGG + Intergenic
1130726472 15:86444544-86444566 CAACCTGCCTAAGACCTGAGTGG + Intronic
1132104421 15:99052489-99052511 AATCCTGTGTCAGCCCTGGGTGG - Intergenic
1132381974 15:101372325-101372347 CAAGCAGTGTAACTCCTGAGAGG - Intronic
1132607497 16:799776-799798 GAACTTGTGGCAGTTCTGAGGGG - Intronic
1134391658 16:13825480-13825502 CAAATCGTGTCTGTCCTGAGAGG + Intergenic
1134492762 16:14707947-14707969 CCACCTGTGCCAGCCCTGTGAGG - Intergenic
1134498143 16:14747069-14747091 CCACCTGTGCCAGCCCTGTGAGG - Intronic
1134582430 16:15382024-15382046 CCACCTGTGCCAGCCCTGTGAGG + Intergenic
1134590963 16:15452963-15452985 AAACCAGTGTCATTCCTTAGTGG - Intronic
1138956292 16:61974341-61974363 CAACCTGTGTCAGGGAAGAGGGG + Intronic
1139491657 16:67289164-67289186 CCACCTGTGTTCTTCCTGAGGGG - Exonic
1140574120 16:76144930-76144952 CAAACTGGGGCACTCCTGAGAGG + Intergenic
1140905765 16:79407746-79407768 CAACTTGTGTCAGGACGGAGGGG - Intergenic
1142516901 17:437593-437615 TAACCTGTTTCAGGGCTGAGTGG + Intergenic
1144520193 17:15947927-15947949 CAGCCTGTGTCAGTCAAGTGAGG - Intronic
1148353762 17:46960039-46960061 TAGCCTGAATCAGTCCTGAGAGG - Intronic
1149161415 17:53698086-53698108 GAACCTGTGTCAGCCCTTTGGGG - Intergenic
1150649890 17:67003029-67003051 GAGTCTGTGTCAGTCCTGATAGG + Intronic
1151207256 17:72516931-72516953 CAGCCTGTGTGTGTCCTGTGGGG - Intergenic
1151869605 17:76827407-76827429 GAACCAGTGTCAGGACTGAGGGG - Intergenic
1152333303 17:79685876-79685898 AAAGCTGGGTCTGTCCTGAGGGG - Intergenic
1152715645 17:81899289-81899311 CAGCCTGTGCCTGTCCTGGGAGG + Exonic
1158949519 18:62480180-62480202 CACCCTGTGTCAGTCCTTCAAGG - Intergenic
1159800526 18:72893892-72893914 CAGCCTGTTTTAGTCCTGACTGG - Intergenic
1160623969 18:80190348-80190370 CAAACTCTGGCAGGCCTGAGAGG + Intronic
1161215976 19:3095196-3095218 CAGCCTGTGTCTGTCCTGTCTGG + Intronic
1163397165 19:17070362-17070384 CAGCCTGTCTCAGCCCTGAAGGG - Intronic
1165660911 19:37579247-37579269 CAACCTGTGTGAGACCTGAAGGG - Intronic
1168126477 19:54286178-54286200 CAGCGTGTGTGAGTCCTGAAGGG - Intergenic
1168175417 19:54624686-54624708 CAGCGTGTGTGAGTCCTGAAGGG + Intronic
927038339 2:19203779-19203801 CATCCTGTGTCAGAGGTGAGAGG - Intergenic
927101889 2:19794106-19794128 GAACCTGTGTAATCCCTGAGAGG - Intergenic
927857624 2:26537306-26537328 CAGTCTGTGTCAGTCCCCAGGGG - Intronic
930655150 2:54000500-54000522 AAACCTGTGTCAGTCAGGATAGG + Intronic
934691462 2:96363784-96363806 CAGCCTGTCTCATTCCTGAATGG - Intronic
938220218 2:129560001-129560023 CAACTTGTCTGAGTCCTGTGAGG - Intergenic
938391718 2:130911968-130911990 CAAGCTATGTCAATGCTGAGAGG + Intronic
943325010 2:186486721-186486743 AACCCTGTGCCAGTCCCGAGGGG - Intronic
947502718 2:230683262-230683284 CAGCCTGTGTTTGTGCTGAGAGG + Intergenic
948006110 2:234609002-234609024 GAACCTGACTCAGCCCTGAGTGG + Intergenic
948477478 2:238229507-238229529 GAACCTGTGGGATTCCTGAGAGG + Intronic
948489616 2:238304100-238304122 AAACCAGAGTCAGTCCTGGGAGG - Intergenic
1168864981 20:1078621-1078643 CAGCTTGTTTAAGTCCTGAGAGG - Intergenic
1170554901 20:17506999-17507021 CCGCCTGTTTCTGTCCTGAGTGG - Intronic
1175843343 20:62045206-62045228 GTCCCTGTGACAGTCCTGAGCGG - Intronic
1175998261 20:62820926-62820948 CAACCTGAGGCAGGGCTGAGAGG - Intronic
1176257359 20:64159270-64159292 CAACCCGATTCATTCCTGAGGGG + Intronic
1177287112 21:19065452-19065474 CGGCCTGAGTGAGTCCTGAGCGG + Intergenic
1178399008 21:32267190-32267212 CAACCTGTGGCATCCCTGAAGGG - Intergenic
1180996804 22:19969859-19969881 CCACTTGTGCCAGACCTGAGTGG + Exonic
949293164 3:2489162-2489184 GAACTTATGCCAGTCCTGAGAGG + Intronic
952540060 3:34358106-34358128 CAACAGGTGTCAATCCTGATGGG + Intergenic
953005045 3:38970244-38970266 AAATCTGTTTCATTCCTGAGAGG - Intergenic
953391700 3:42537521-42537543 AAGCCTGTTGCAGTCCTGAGGGG - Exonic
954143034 3:48620174-48620196 CAACCTGGCTGAGCCCTGAGGGG - Intergenic
954680379 3:52342826-52342848 CATCCAGTGTCAGTGTTGAGTGG + Intronic
955092508 3:55766683-55766705 CAACCTGTGCCAGACATAAGAGG - Intronic
957191192 3:77011666-77011688 CTACCTTTTTCAGGCCTGAGTGG + Intronic
962388691 3:134953846-134953868 CCTCCTGTGGCTGTCCTGAGAGG + Intronic
962407031 3:135109185-135109207 CAAACTGCCTCAGTCTTGAGTGG + Intronic
963477537 3:145825844-145825866 CCTCCTGTTTCAGTCTTGAGAGG + Intergenic
964217390 3:154301794-154301816 CTATCATTGTCAGTCCTGAGAGG + Intronic
966537701 3:181052641-181052663 AAACCTGTATAAGACCTGAGAGG - Intergenic
968126980 3:196167279-196167301 CAACCTGGGTCATTCCTGCCGGG - Intergenic
968487778 4:872235-872257 CACCCTGTGCCCGCCCTGAGGGG + Intronic
968915836 4:3496712-3496734 CAGCCTGTGTCACTCTTGGGGGG + Intronic
970437374 4:16048665-16048687 CAACGTGTGTCAGTCCTGCAGGG - Intronic
974036471 4:56822017-56822039 GAACCTGTGACAGTCCTAGGGGG + Intergenic
976793086 4:88902038-88902060 CATCCTGTTTCAGTCTTGGGAGG - Intronic
980103574 4:128565844-128565866 CAACCTCCCTCACTCCTGAGAGG + Intergenic
981448588 4:144869403-144869425 CCACCTCTGTCATTCCTCAGTGG - Intergenic
982349011 4:154394348-154394370 AAACCTGTCTGACTCCTGAGGGG - Intronic
985091941 4:186371993-186372015 CCACGCGCGTCAGTCCTGAGTGG - Intergenic
985091957 4:186372147-186372169 CCACGCGCGTCAGTCCTGAGTGG - Intergenic
985091967 4:186372250-186372272 CCACGCGCGTCAGTCCTGAGTGG - Intergenic
986974868 5:13382488-13382510 CAGCATGTGTGAGTCCTGAAAGG - Intergenic
988054331 5:26073936-26073958 TAACCTCTCACAGTCCTGAGAGG + Intergenic
988265010 5:28937698-28937720 CAACCTGTGTCCATCAAGAGAGG - Intergenic
988593509 5:32569464-32569486 CAGGCTGTGTCAGAGCTGAGGGG - Intronic
995565530 5:113430113-113430135 CATACTTTGTCACTCCTGAGTGG - Intronic
999585878 5:153089115-153089137 CAACCTGTGTCCCTCCATAGGGG + Intergenic
1003682482 6:8269616-8269638 CATCTTGTGTCAGTCCTCACAGG - Intergenic
1006904784 6:37525898-37525920 CTCCCTGTCTCAGGCCTGAGTGG + Intergenic
1008909481 6:56717703-56717725 GAACCTGTGTCATTTCTGGGTGG - Intronic
1012971683 6:105738199-105738221 GAGACTGTGTCAGGCCTGAGTGG + Intergenic
1013085121 6:106850360-106850382 CAAACCTTGTCAGTCCTGACTGG + Intergenic
1013300405 6:108799799-108799821 CAAACTGTGTGAGTTCTGAAGGG + Intergenic
1014630951 6:123789466-123789488 AAAGCTGTGGCAGTTCTGAGGGG - Intergenic
1019067343 6:169313383-169313405 CAGCCTGTGTCCATCCTGCGAGG + Intergenic
1023872419 7:44270036-44270058 CACCCTGTGTCAGGCCCGTGTGG - Intronic
1024986658 7:55200035-55200057 CATCCTGTGTTACGCCTGAGGGG - Intronic
1027250825 7:76397779-76397801 GAACCTGTGTCAGGGCCGAGTGG - Exonic
1028827028 7:95285581-95285603 AAACCTGTGTCTGTGCTGTGTGG + Intronic
1034490935 7:151392689-151392711 CAGCCTGTGACAGGCCTGGGAGG - Intronic
1038689345 8:29746951-29746973 CAACCAGTCTCAGTGCTGAAAGG + Intergenic
1041668115 8:60465751-60465773 AAACCTGTGAGTGTCCTGAGTGG - Intergenic
1044494102 8:92855973-92855995 AAACCTTTGTTAGTGCTGAGTGG - Intergenic
1044526871 8:93262179-93262201 CTACCAGTGTCAGCCCAGAGTGG - Intergenic
1047200457 8:122760871-122760893 CACCCTGTGTCAATGCTGATTGG + Intergenic
1047524589 8:125621994-125622016 CAACCTGTGAAAATCCAGAGAGG + Intergenic
1050271016 9:3945098-3945120 CCCCATGTGTCAGTGCTGAGAGG - Intronic
1050423424 9:5490381-5490403 CAACATTTTTCAGACCTGAGTGG - Intergenic
1051812875 9:21070177-21070199 CAGCTTGTGTCAGACTTGAGAGG + Intergenic
1054867532 9:70017793-70017815 TAGCCTGTGAGAGTCCTGAGGGG + Intergenic
1055114304 9:72590642-72590664 CAAACTGTTTCAGTCCAGTGAGG + Intronic
1058027096 9:100153736-100153758 CAAGCTGTGTCATTCCACAGTGG + Intronic
1059025650 9:110626237-110626259 CAACTTATGTCAGTCCTAAGTGG - Intergenic
1059052987 9:110948616-110948638 AATTCTGTGTCAGTCCTAAGAGG + Intronic
1062376478 9:136264049-136264071 CAGCCTGTGCCAGCCCTGCGTGG - Intergenic
1062511948 9:136911075-136911097 CAGCCCTTGTCTGTCCTGAGGGG + Intronic
1062562471 9:137147777-137147799 CAACCTGTGTCAGTCCTGAGTGG - Intronic
1188862047 X:35269645-35269667 CCTCCTGGGTCAGTCCTGGGAGG + Intergenic
1191780707 X:64861816-64861838 CTTCCTGTTTCAGTCTTGAGAGG + Intergenic
1193513232 X:82432387-82432409 CAGTCTGTGCCAGTCCTGGGTGG - Intergenic
1195961276 X:110389434-110389456 CAACTTGTGGCAGACCTAAGTGG - Intronic
1199365124 X:146971714-146971736 CATCCTGGGGCAGCCCTGAGTGG - Intergenic
1199382246 X:147184057-147184079 CATCCTGGGGCAGCCCTGAGTGG + Intergenic
1200315039 X:155123751-155123773 CCAACTGTGTCAATACTGAGAGG - Intronic
1201232683 Y:11879954-11879976 CCACCTCTGTCAGCCCAGAGAGG + Intergenic