ID: 1062562479

View in Genome Browser
Species Human (GRCh38)
Location 9:137147814-137147836
Sequence GGGGCCACACAGCAGGTGCA CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1062562471_1062562479 14 Left 1062562471 9:137147777-137147799 CCACTCAGGACTGACACAGGTTG 0: 1
1: 0
2: 0
3: 11
4: 152
Right 1062562479 9:137147814-137147836 GGGGCCACACAGCAGGTGCACGG No data
1062562468_1062562479 18 Left 1062562468 9:137147773-137147795 CCTCCCACTCAGGACTGACACAG 0: 1
1: 2
2: 3
3: 29
4: 273
Right 1062562479 9:137147814-137147836 GGGGCCACACAGCAGGTGCACGG No data
1062562470_1062562479 15 Left 1062562470 9:137147776-137147798 CCCACTCAGGACTGACACAGGTT 0: 1
1: 0
2: 1
3: 13
4: 138
Right 1062562479 9:137147814-137147836 GGGGCCACACAGCAGGTGCACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1062562479 Original CRISPR GGGGCCACACAGCAGGTGCA CGG Intronic
No off target data available for this crispr