ID: 1062563878

View in Genome Browser
Species Human (GRCh38)
Location 9:137155244-137155266
Sequence CGCTATCAAAGTGCCCACCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 65
Summary {0: 1, 1: 0, 2: 0, 3: 1, 4: 63}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1062563878_1062563886 19 Left 1062563878 9:137155244-137155266 CCCTGGTGGGCACTTTGATAGCG 0: 1
1: 0
2: 0
3: 1
4: 63
Right 1062563886 9:137155286-137155308 CGTGTGGTGTTGGGTCTTGCTGG No data
1062563878_1062563883 9 Left 1062563878 9:137155244-137155266 CCCTGGTGGGCACTTTGATAGCG 0: 1
1: 0
2: 0
3: 1
4: 63
Right 1062563883 9:137155276-137155298 TGCCATGACACGTGTGGTGTTGG No data
1062563878_1062563882 3 Left 1062563878 9:137155244-137155266 CCCTGGTGGGCACTTTGATAGCG 0: 1
1: 0
2: 0
3: 1
4: 63
Right 1062563882 9:137155270-137155292 ATGCTGTGCCATGACACGTGTGG No data
1062563878_1062563884 10 Left 1062563878 9:137155244-137155266 CCCTGGTGGGCACTTTGATAGCG 0: 1
1: 0
2: 0
3: 1
4: 63
Right 1062563884 9:137155277-137155299 GCCATGACACGTGTGGTGTTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1062563878 Original CRISPR CGCTATCAAAGTGCCCACCA GGG (reversed) Intronic
905061596 1:35144446-35144468 GTCTATAAAAGTGGCCACCAAGG - Intergenic
908265384 1:62373733-62373755 CTCAAACAAACTGCCCACCATGG - Intergenic
916102944 1:161408359-161408381 GTCTATAAAAGTGGCCACCAAGG - Intergenic
1064992155 10:21265627-21265649 CGTTATCAAAGTGGCCACTGTGG + Intergenic
1065349742 10:24784815-24784837 AGCTATTAATGTGACCACCAGGG - Intergenic
1067069508 10:43121551-43121573 TGCTGGCAAAGTGCCCAACATGG + Intronic
1067783083 10:49223175-49223197 CCCGAACAAAGTCCCCACCAGGG - Intergenic
1068612399 10:59074716-59074738 TGCTATCGAAGTGACCACCCAGG + Intergenic
1072754643 10:98011148-98011170 CGATCTCAAAGTCCCCATCATGG + Exonic
1076113208 10:127876782-127876804 GGCTAGCACAGTGCTCACCAGGG - Intergenic
1084265070 11:68000892-68000914 CGCTTATAAAGTGCCCAGCACGG + Intronic
1085746623 11:79120422-79120444 CACTAACTTAGTGCCCACCATGG + Intronic
1089495681 11:118907721-118907743 GGCTGGCGAAGTGCCCACCATGG - Intronic
1096852321 12:54448563-54448585 TGCTCTTAAATTGCCCACCATGG + Intergenic
1097261757 12:57724496-57724518 TGCCATCAAAGGGACCACCAAGG - Intronic
1101661416 12:106768910-106768932 GGCTGTCAAAGTGGCCAGCAAGG - Intronic
1102784691 12:115594853-115594875 TGCTATCCAAGTGCGCACCATGG - Intergenic
1102876781 12:116455157-116455179 CGGGATCTAAGTTCCCACCAGGG - Intergenic
1104117765 12:125766048-125766070 TGCAATCAAAGTGCCAGCCAAGG + Intergenic
1107795689 13:44049204-44049226 CCCTACCAGAGTGTCCACCAGGG - Intergenic
1110628625 13:77679598-77679620 CAGTATCAAACTCCCCACCATGG + Intergenic
1115883474 14:37945928-37945950 TGCTAGCACTGTGCCCACCAAGG - Intronic
1119889558 14:78172682-78172704 CGCTATTAAAGTGAGCAACAGGG + Intergenic
1125059157 15:35398268-35398290 GGCTATCCAGGAGCCCACCAAGG - Intronic
1136502264 16:30677882-30677904 GCCTAACAAAGTGCCCAGCATGG - Intergenic
1137850824 16:51740647-51740669 CTCCATCAAAGTCCCAACCATGG - Intergenic
1147553622 17:41462582-41462604 CTCCTTCTAAGTGCCCACCATGG - Intronic
1151050586 17:70974025-70974047 GGCTATCACTGTGCCTACCAGGG - Intergenic
1151349544 17:73523646-73523668 TGAAATCAAAGTGCCCAGCAAGG - Intronic
1156016039 18:32548355-32548377 CTCTATCAACATCCCCACCAGGG + Intergenic
1160070554 18:75624399-75624421 CGCTGTCAAAATTCCCATCATGG + Intergenic
1165067990 19:33240212-33240234 CCATCTGAAAGTGCCCACCAGGG + Intergenic
1168329330 19:55557558-55557580 CACTATCAACATCCCCACCAGGG + Intergenic
937411964 2:121684447-121684469 GTCTATAAAAGTGGCCACCAAGG - Intergenic
1170004020 20:11646559-11646581 CGCCATCACAGTGGCCCCCAGGG - Intergenic
1171480088 20:25448183-25448205 CTCAATCAAGGTGCCCAACAGGG - Exonic
1173071807 20:39775339-39775361 CACAATAAAAGTGCCGACCAGGG + Intergenic
1174280418 20:49435048-49435070 CCCTAACACAGGGCCCACCATGG + Intronic
1181527014 22:23495879-23495901 CGTTTTCCAAGTGCCCTCCAGGG + Intergenic
952886873 3:38017566-38017588 CGCTTCCAATGTGCCCTCCATGG + Intronic
962208419 3:133455311-133455333 TGCAATCAAGGTACCCACCAGGG + Intronic
969647049 4:8437224-8437246 GTCTATAAAAGTGGCCACCAAGG + Intronic
981824489 4:148924581-148924603 AGCTTTCAAAGTGCCTGCCAAGG + Intergenic
987120773 5:14764461-14764483 CGCCAACAAGGAGCCCACCAAGG + Intronic
991946990 5:71907803-71907825 TGCAATCAAAGTGTCAACCAGGG + Intergenic
992402410 5:76423760-76423782 CACTAGCTCAGTGCCCACCATGG - Intronic
992926208 5:81590429-81590451 CTCTATCAAAGAGCTCATCAAGG + Intronic
997906211 5:137819835-137819857 CTCTTTCTAAGTGTCCACCAAGG + Intergenic
1017976045 6:159358241-159358263 TTCTACCAAGGTGCCCACCAAGG - Intergenic
1019395914 7:817382-817404 CGCCTTCAAAGTGCCCAGAATGG + Intronic
1021281484 7:18724807-18724829 CACTAGCAAAGTGTCCAGCATGG + Intronic
1023591696 7:41787450-41787472 GGCAATCAAAGTGGGCACCAAGG - Intergenic
1032805736 7:135352532-135352554 AGTTATCAGAGTGCTCACCACGG - Intergenic
1035289530 7:157828861-157828883 CCCTATAAAAGTGACCTCCAAGG + Intronic
1040291268 8:46126434-46126456 GTCTATAAAAGTGGCCACCAAGG + Intergenic
1041925280 8:63229943-63229965 TGCAATCAAGGTGTCCACCAAGG + Intergenic
1047306574 8:123657724-123657746 CTGAGTCAAAGTGCCCACCATGG - Intergenic
1059511849 9:114855517-114855539 AGCTATCTAGGAGCCCACCAAGG + Intergenic
1060854343 9:126902884-126902906 TGCTATCTAGGGGCCCACCAAGG + Intergenic
1061601986 9:131676323-131676345 CCCAATCTCAGTGCCCACCATGG + Intronic
1062563878 9:137155244-137155266 CGCTATCAAAGTGCCCACCAGGG - Intronic
1188787347 X:34364331-34364353 TGCTGTCAAAGTGCCAGCCATGG + Intergenic
1198469615 X:136934047-136934069 GTCTATAAAAGTGGCCACCAAGG - Intergenic
1199471073 X:148197286-148197308 AACTATCACAGTGCCCAACATGG + Intergenic
1200223603 X:154404524-154404546 CTCTATGAAAGTGGCCAGCAAGG - Intronic