ID: 1062563884

View in Genome Browser
Species Human (GRCh38)
Location 9:137155277-137155299
Sequence GCCATGACACGTGTGGTGTT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1062563879_1062563884 9 Left 1062563879 9:137155245-137155267 CCTGGTGGGCACTTTGATAGCGG 0: 1
1: 0
2: 0
3: 3
4: 40
Right 1062563884 9:137155277-137155299 GCCATGACACGTGTGGTGTTGGG No data
1062563878_1062563884 10 Left 1062563878 9:137155244-137155266 CCCTGGTGGGCACTTTGATAGCG 0: 1
1: 0
2: 0
3: 1
4: 63
Right 1062563884 9:137155277-137155299 GCCATGACACGTGTGGTGTTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1062563884 Original CRISPR GCCATGACACGTGTGGTGTT GGG Intronic
No off target data available for this crispr