ID: 1062564534

View in Genome Browser
Species Human (GRCh38)
Location 9:137158295-137158317
Sequence AGGGAGAAGCAGCAGGGGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1662
Summary {0: 1, 1: 1, 2: 7, 3: 173, 4: 1480}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1062564521_1062564534 20 Left 1062564521 9:137158252-137158274 CCGGCAGGAGAAGGAGCAGGGAG 0: 1
1: 0
2: 9
3: 92
4: 725
Right 1062564534 9:137158295-137158317 AGGGAGAAGCAGCAGGGGGAAGG 0: 1
1: 1
2: 7
3: 173
4: 1480

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1062564534 Original CRISPR AGGGAGAAGCAGCAGGGGGA AGG Intronic
900187145 1:1337836-1337858 AGGGCGGAGCAGCAGCGGGGTGG + Intronic
900204456 1:1426143-1426165 AGGGAGACGGAGGAGGAGGAGGG + Exonic
900226659 1:1536278-1536300 AGGGCACAGCAGCGGGGGGAAGG - Intronic
900339430 1:2181065-2181087 GGGGAGAAGCAGCAGGGCTGGGG - Intronic
900344109 1:2203070-2203092 GGAGAAAAGCAGAAGGGGGATGG - Intronic
900546348 1:3231440-3231462 AGGCAGATGCCCCAGGGGGACGG - Intronic
900868044 1:5282783-5282805 AGGGAGAGGCAGCAGGGACAGGG + Intergenic
900877109 1:5350635-5350657 AAGGAGAAGGTGGAGGGGGAGGG + Intergenic
900927156 1:5712917-5712939 AGAGACAAGGAGCAGGGTGAGGG - Intergenic
900988857 1:6088774-6088796 GGGGGGCAGCAGCAGGGGGTGGG - Intronic
901002318 1:6154905-6154927 GGGGAGAGGCAGGAGGGTGAGGG + Intronic
901031132 1:6307620-6307642 AGGGAACAGCAACAGGCGGAGGG + Intronic
901078979 1:6572953-6572975 AAGGAGGAGCAGCAGTGGGCAGG - Intronic
901105124 1:6749445-6749467 AAGGAGAAGAAGGAGGAGGAGGG - Intergenic
901420898 1:9150421-9150443 CGGGAGAAGCAGCAGAGGCTGGG + Intergenic
901428065 1:9196085-9196107 AGGGAAAGGCTGGAGGGGGAAGG + Intergenic
901637793 1:10678399-10678421 AGGGAGAGGCAGCAGGTGGGTGG + Intronic
901657146 1:10775920-10775942 ACGGAGAGGCTGCAGCGGGAGGG - Intronic
902214443 1:14925230-14925252 GGGGGGAAGGGGCAGGGGGAAGG - Intronic
902216144 1:14935683-14935705 AGGGAGAAGGGGAAGGGAGAGGG - Intronic
902517637 1:16997881-16997903 AGGGGGAAGGAGGAGGGGGAGGG + Intronic
902654826 1:17859961-17859983 AGGGAGGAGCAGGTGGAGGAAGG + Intergenic
902690967 1:18109915-18109937 AGAGAGACGCGGCAGGGTGAAGG + Intronic
902726698 1:18340953-18340975 AAGGAGAAGAAGGAGGGGGAGGG - Intronic
903223782 1:21883742-21883764 AGTGAGACTCAGCAGGGTGAGGG + Intronic
903282381 1:22257392-22257414 AGGAGGAAGGGGCAGGGGGAGGG - Intergenic
903354981 1:22741029-22741051 AGGGAGAAGGGGCAGGCAGAGGG - Intronic
903480869 1:23652407-23652429 AGGGAGAGGGAGGAGGGGGAAGG + Intergenic
903632852 1:24789977-24789999 AGGGAAAAGGAGAAGGGAGATGG + Intronic
903655973 1:24948942-24948964 AGGGGCAAGCAGCAGGAGGCAGG - Intronic
903664095 1:24996159-24996181 AGGGAGGAGCAGCATGGAGGGGG - Intergenic
904010052 1:27384075-27384097 TAGGAGAAGCAGATGGGGGAAGG - Intergenic
904259224 1:29278984-29279006 AGGGAAAGGCAGCAGGGGCCAGG - Intronic
904293924 1:29505609-29505631 AGGGAGAAGCGGGAGGAGGTCGG + Intergenic
904481055 1:30793576-30793598 AGGCAGCAGCAGCGGTGGGAGGG + Intergenic
904585289 1:31576634-31576656 ACAGAGAAGAAACAGGGGGAGGG + Intronic
904920139 1:34000982-34001004 GGGGAGAAGGAGAAAGGGGAAGG + Intronic
905038228 1:34930546-34930568 GTGGGGAAGCCGCAGGGGGAGGG + Intergenic
905223972 1:36467414-36467436 AGAGAGAAGAAGCTGGGGGCTGG + Intronic
905313073 1:37064091-37064113 AGAGAGGAGCAGAAGGGCGAGGG + Intergenic
905470529 1:38188297-38188319 TGGGAGGAGGAGGAGGGGGAGGG + Intergenic
905654053 1:39674699-39674721 AGAGAGAAGCAGAAGGAGGGAGG + Intergenic
905723599 1:40228904-40228926 AGGCAGAGGCAGCGGGGGGCGGG - Intronic
905872900 1:41415251-41415273 AGGGAGAAGCAGGAAGGTGGAGG - Intergenic
905930459 1:41783258-41783280 AGTGAGAAGCCACAGGAGGAAGG + Intronic
905980565 1:42222007-42222029 GAGGAGAAGGAGAAGGGGGAGGG + Intronic
906124156 1:43416351-43416373 AGGAAGAAGCAGGAGGGTAAGGG + Intronic
906124442 1:43418835-43418857 AAAGAGCAGCAGCAGGAGGAGGG + Intronic
906175616 1:43769443-43769465 AGGAAGTAGCAGGATGGGGAGGG + Intronic
906180896 1:43817827-43817849 AAGGAGAAGAAGAAGGAGGAAGG - Intronic
906416307 1:45623197-45623219 AGGGTGAAGGAGATGGGGGACGG - Exonic
906477933 1:46182333-46182355 ATGGAGAAGGAGCAGTGGGAGGG + Intronic
906750455 1:48253977-48253999 AGGAAGAAGCAACTGAGGGATGG - Intergenic
906852953 1:49271708-49271730 ATGGAGAAGAAGGAGGGGTAGGG - Intronic
906960809 1:50418657-50418679 CCGGAGAAGCAGTAGGGCGAGGG - Exonic
907303532 1:53502196-53502218 AGGGACAAGGAGGCGGGGGAGGG + Intergenic
907797699 1:57733875-57733897 AAGAAGAAGCAGCACAGGGAAGG + Intronic
907798689 1:57742837-57742859 AGTGAGAAGCACCAGTGTGAAGG + Intronic
907834782 1:58098494-58098516 AGGGAGCATCAGCAGAGGGTTGG - Intronic
907861591 1:58358882-58358904 AGAGAGAGGCAGAAGGTGGACGG - Intronic
907878691 1:58522161-58522183 AGGCAGAAAATGCAGGGGGAAGG + Intronic
908141225 1:61187370-61187392 TTGGAGAAGCAGCTGAGGGATGG - Intronic
908571869 1:65419900-65419922 GGGGAGAGGCAGGAGAGGGAAGG - Intergenic
908611716 1:65868597-65868619 AGGCAGATTCAGCAGGTGGATGG + Intronic
909392478 1:75133135-75133157 AGAGAGGACCGGCAGGGGGATGG + Intronic
910217057 1:84853514-84853536 AGAGAGAAGAAGCAGGAAGAGGG - Intronic
910257019 1:85259053-85259075 AGGGAGAAGCTGCAGCGGGGGGG + Intronic
910336604 1:86139165-86139187 AGGGAGAAGGAGAAAGGGGGGGG + Intronic
910455691 1:87395186-87395208 CAGGAAAAGCAGCAGTGGGAGGG + Intergenic
910760713 1:90728792-90728814 AGGGAGGAGGAGGAGGAGGAAGG + Intergenic
911008757 1:93255783-93255805 AGGAAGAAGAAGGAGGGGGGAGG + Intronic
911601274 1:99850316-99850338 GGGGAGAAACAGAAGGGGAAGGG - Intronic
911712894 1:101095763-101095785 AGAGAGCAGCAGCATGGGTAGGG - Intergenic
911820315 1:102411265-102411287 AAGGAGAAGGAGAAGGGGGGTGG + Intergenic
912228633 1:107766232-107766254 AAGAAGAAGGAGGAGGGGGAAGG - Intronic
912439560 1:109687957-109687979 AGTGCGAAGCAGCTGCGGGACGG + Intronic
912449668 1:109761214-109761236 AGGAAGAAGTAGCAGCAGGATGG - Intronic
912520213 1:110240079-110240101 AGAGTGAAGAAGCAGAGGGAGGG + Intronic
912575868 1:110672922-110672944 AGTATGAAGCAGCAGGGAGAGGG + Exonic
912703388 1:111894985-111895007 AGGGAGAGGACTCAGGGGGAGGG + Intronic
912776216 1:112508042-112508064 AGGGTGAAGGAGCAGTGGGGAGG + Intronic
913552316 1:119927610-119927632 AGGGGGAAGCAGGAGAAGGAAGG - Intronic
914121095 1:144783192-144783214 AAGGAGGAGGAGGAGGGGGAAGG + Intergenic
914198235 1:145461666-145461688 AGGGAGGAAGGGCAGGGGGAGGG - Intergenic
914477338 1:148034795-148034817 AGGGAGGAAGGGCAGGGGGAGGG - Intergenic
914837203 1:151217334-151217356 GGGGAGCAGCAGCAGTGGGTAGG - Intronic
914869252 1:151459231-151459253 AGGGGGTGGGAGCAGGGGGAGGG + Exonic
914923727 1:151865375-151865397 AGGGAGTTGCAGCAGGAGGAAGG - Intergenic
915191870 1:154157604-154157626 AGGGAGGAGCAGCAGCAGGGTGG + Intronic
915287672 1:154863157-154863179 GGGGAGGAGCAGCTGGGGGCAGG - Intronic
915604422 1:156941682-156941704 AGGGACAAGAAGCAGGGACAGGG + Intronic
915789912 1:158657471-158657493 ATGAAGAAGCAGCTGGGGTAAGG - Exonic
915839397 1:159202668-159202690 AGGGAGGAAAAGCTGGGGGAGGG - Intronic
915953048 1:160202852-160202874 AGCGATAAGCAGGATGGGGAGGG + Intergenic
915953432 1:160205263-160205285 ATGGAGAGGCAGGAGGGGGCGGG - Intergenic
915970243 1:160349833-160349855 AAGGGGAAGCAGGAGAGGGAAGG - Intronic
916075099 1:161196119-161196141 AGGGAGGAGAAGGTGGGGGAGGG - Intronic
916138737 1:161675418-161675440 AGGGAGCAGCAGTGGGAGGATGG + Intronic
916166380 1:161970300-161970322 AGGGAGAGGGAGCCGGGAGAAGG + Intergenic
916332159 1:163628692-163628714 AAGGAGAAGAAGGAGGAGGAGGG - Intergenic
916405887 1:164497485-164497507 AGGGAGAAACAGCAAGGAAATGG + Intergenic
916585899 1:166149914-166149936 AGGAAGGACCAGCAGAGGGAAGG - Intronic
916589073 1:166172907-166172929 AGGGAGAAACAGGAGAAGGAAGG - Intergenic
916641146 1:166729934-166729956 TGGGAGGGGCAGCAGGGGCAGGG - Intergenic
917313592 1:173702588-173702610 AGGAAGAAGGAGAAGGAGGAAGG + Intergenic
917628165 1:176866519-176866541 AGGGAGTGGCAGAAGAGGGAGGG + Intronic
917628233 1:176867308-176867330 AGGGAGAAGAAGAGGGGAGAGGG + Intronic
917880648 1:179332544-179332566 AGGGAGAAGCGGCAGAAGGGAGG - Intronic
918500623 1:185191245-185191267 GGAGGGAAGAAGCAGGGGGAAGG - Intronic
918726288 1:187928600-187928622 AGAGAGAAGAAACAAGGGGAGGG - Intergenic
918761847 1:188420536-188420558 AGGGAGAGACAGAAGGAGGAAGG - Intergenic
918761864 1:188420589-188420611 AGGAAGAAGGAGGAAGGGGAAGG - Intergenic
919016767 1:192048510-192048532 AAGGAGAAGGAGAAGGGGAAGGG + Intergenic
919016798 1:192048676-192048698 AAGGAGAAGGAGAAGGGGAAGGG + Intergenic
919434826 1:197544954-197544976 AGGGAGAAGGAGAAGGAGGAAGG + Intronic
919449341 1:197751886-197751908 AGGGAGGAGGAGGAGGAGGAGGG + Intronic
919467322 1:197938067-197938089 AGGGAGAAGCAGCAGGTGCGTGG - Intergenic
919595850 1:199561547-199561569 AAGGAGAAGGAGGAGGAGGAAGG - Intergenic
919982040 1:202647820-202647842 AGGGGGAGGGAGGAGGGGGAAGG - Intronic
920070781 1:203301510-203301532 AGGGAGAAGGAGAAGCAGGAAGG + Intergenic
920093757 1:203472406-203472428 AGGGCCAGGCAGCAGAGGGAGGG - Intergenic
920257588 1:204666011-204666033 AGGAAGAAGCAGGAGTTGGAAGG + Intronic
920330234 1:205202083-205202105 AGGGAGAAGGGGAAGGGAGAGGG + Intronic
920439681 1:205971412-205971434 AGGAAGAACAAGCAGGGAGAGGG - Intergenic
920646496 1:207807749-207807771 AGTGAGTAGCAGGAGGAGGAAGG + Intergenic
921116715 1:212098912-212098934 GGGCAGAATCTGCAGGGGGATGG - Intronic
921334480 1:214072633-214072655 AGAGGGAGGCAGCAGGGGGGAGG - Intergenic
921353370 1:214261003-214261025 AAGGAGAAGGAGGAGGAGGAAGG - Intergenic
922233343 1:223704950-223704972 AGGGAGCGGCAGGAGGGGGCTGG - Intronic
922341633 1:224661478-224661500 AGGGAGCAGAAGCTGAGGGATGG - Intronic
922551753 1:226499093-226499115 AGGGAAGAGGAGCAGGGGCAAGG + Intergenic
922722678 1:227906619-227906641 AGGGAGTAGGAGGAGGGAGAAGG - Intergenic
922722751 1:227906882-227906904 AGGGAGAAGCAGAAGGGAAAGGG - Intergenic
922777665 1:228223949-228223971 GGGGAGAAGTGGCCGGGGGATGG + Intronic
922905008 1:229167645-229167667 AGGGAGAAGTGGGAGGGAGAGGG + Intergenic
923051599 1:230394439-230394461 GGGGAGGAGCAGCACAGGGAGGG - Intronic
923186013 1:231574318-231574340 AGGCAGAAGTTGCAGTGGGACGG - Intronic
923286583 1:232501914-232501936 AGGGAGAAGCAGCCGAAGGAAGG - Intronic
923339831 1:232997827-232997849 AGTGAGAAGCAGGAGAGGGAAGG + Intronic
923342091 1:233016357-233016379 GGGGAGGAGGAGAAGGGGGAGGG - Intronic
923475302 1:234326086-234326108 AGGAAGGAGCAGGAGGAGGATGG + Intergenic
923495584 1:234521719-234521741 ATGGAGAAGCAGCAAGGGGCAGG - Intergenic
923552972 1:234978914-234978936 AAGCAGAGGCAGCAGGGGGCAGG + Intergenic
924062030 1:240185029-240185051 AGGGAGAAAGAGAAGGGGGAAGG - Intronic
924062045 1:240185086-240185108 AGGGAGAAAGAGAAGGGGGAAGG - Intronic
924062053 1:240185115-240185137 AGGGAGAAAGAGAAGGGGGAAGG - Intronic
924062068 1:240185172-240185194 AGGGAGAAAGAGAAGGGGAAAGG - Intronic
924457459 1:244230115-244230137 AGAGACAAGGAACAGGGGGATGG + Intergenic
924538337 1:244957726-244957748 GGGAAGAGGGAGCAGGGGGAGGG - Intergenic
924645324 1:245872345-245872367 TGGGTGAAGCAGCAGGAGGCGGG - Intronic
924683043 1:246257869-246257891 AGGCAGAAGCAGGAGAGGGAAGG - Intronic
924688844 1:246325085-246325107 AGGGAGAAGGAGTCGGGGGGCGG + Intronic
924688900 1:246325228-246325250 AGGGAGAAGGAGTCGGGGGGCGG + Intronic
1062805310 10:415383-415405 AAGGAGAGGCAGCAGGAGGAGGG + Intronic
1062833577 10:622257-622279 AGGGGGAGGGAGGAGGGGGAGGG + Intronic
1062833584 10:622270-622292 AGGGGGAGGGAGGAGGGGGAGGG + Intronic
1062833945 10:624032-624054 AGAGAGAAGGAGCAGGGTGGCGG - Intronic
1062936557 10:1394899-1394921 AGGAAGAAGAAGGAGGAGGAGGG - Intronic
1063114432 10:3063972-3063994 AGGCAGAAACAGCAGGGGAAGGG + Intergenic
1063604092 10:7507909-7507931 AGGCAGAAGGTGCAGGTGGACGG + Intergenic
1063851772 10:10200466-10200488 GGGGAGAAGGAGCTAGGGGAAGG - Intergenic
1064097835 10:12436948-12436970 GGGGAGAGGCACCAGGGGCAGGG + Intronic
1064246536 10:13672149-13672171 AGGGAGAAGCAGGCGAGTGACGG - Intronic
1064959731 10:20950459-20950481 AGGGAGAAGAGGCAGAAGGAAGG - Intronic
1065169261 10:23010696-23010718 AGGGAAAGGAAGGAGGGGGAAGG - Intronic
1065184260 10:23156894-23156916 AGGGAGAAGGAGCGGGAGGCAGG + Intergenic
1065188249 10:23189613-23189635 AGGGAGGAGGAGGAGGAGGAAGG + Intergenic
1065318506 10:24487115-24487137 AGGGAGAAGAAGAAGGAGAAGGG - Intronic
1065669685 10:28102839-28102861 AGGGAGAAACAGCAGAAGCAGGG - Intronic
1065701564 10:28430869-28430891 GGGGAGAACCAGGAGTGGGATGG - Intergenic
1065940503 10:30560098-30560120 AGTCAGAAGCAGCGGGGAGAGGG - Intergenic
1066055060 10:31673216-31673238 AGGGAGTAGCAGATGGGAGAAGG + Intergenic
1066557072 10:36626036-36626058 AGTGAGAAGGAGCTGGGGGTGGG + Intergenic
1067044869 10:42979899-42979921 TGTGAGAAGCAGCATGAGGAGGG + Intergenic
1067364004 10:45608124-45608146 AGGGGGAAGGGGGAGGGGGAAGG + Intergenic
1067394997 10:45907019-45907041 AGTGAGAAGGAGCATGGAGATGG - Intergenic
1067556612 10:47277601-47277623 AGGGAGAGGCAGGAGGTGGCAGG - Intergenic
1067696918 10:48542485-48542507 AGGCAGAGGCAGCAGGAGGCAGG - Intronic
1067843642 10:49701599-49701621 AGGAGGAAGCAGCACGAGGAAGG - Intronic
1067863317 10:49876150-49876172 AGTGAGAAGGAGCATGGAGATGG - Intronic
1068316545 10:55351051-55351073 AGGAGGCAGCAGCGGGGGGAGGG - Intronic
1068378283 10:56213197-56213219 AGGCAGCAGCAGCAGGGGCATGG + Intergenic
1068480607 10:57584752-57584774 AGGGAGGGACAGCAGTGGGAAGG + Intergenic
1068538262 10:58264953-58264975 TGGGAGAATGAGTAGGGGGAAGG + Intronic
1069611042 10:69772697-69772719 AGGGAGAAGGAGCAGGAAAAAGG - Intergenic
1069618542 10:69821908-69821930 GGGGTGCAGCAGTAGGGGGATGG - Intronic
1069664347 10:70145040-70145062 GAGGAGAAGCAGCAGGGTTAGGG + Intronic
1069755675 10:70773241-70773263 GGTGAGAAGAAGCAGGGGTAGGG - Intronic
1069879916 10:71585691-71585713 AGGGCGAAAGATCAGGGGGAAGG - Intronic
1069906316 10:71734629-71734651 AGGCAGAGGCAGCAGCAGGAGGG - Intronic
1070332596 10:75429110-75429132 AAGGAGAAGGAGGAGGGGAAAGG - Intergenic
1070384995 10:75916389-75916411 AGAGAGAGGCAGCAGGGGTGAGG + Intronic
1070768875 10:79070852-79070874 CGGGGGAAGGAGCAGCGGGAGGG - Intronic
1071117041 10:82233677-82233699 AGGGAGAAGCAAGAGTGGGGAGG - Intronic
1071683863 10:87734866-87734888 AGGGAGGAGCAGCTGAGGGTGGG - Intronic
1071899875 10:90108702-90108724 ATGGAGAAAGAGCAGAGGGATGG + Intergenic
1071971901 10:90916067-90916089 GGGGAGAAGGAGGAGGGGGAGGG + Intronic
1072759430 10:98043698-98043720 TGGGAGTAGAAGCAGGAGGAAGG + Intergenic
1072847543 10:98848858-98848880 AGGGGAAAGCAGCAAGGGTAAGG - Intronic
1072918144 10:99553062-99553084 AGGGAGAAATAGGAGTGGGAAGG - Intergenic
1073043680 10:100623832-100623854 AGAGAGAAGAGGCAGGAGGAAGG + Intergenic
1073091146 10:100940803-100940825 AAGGAGAAGGGGCAGGGGCAGGG - Intronic
1073139400 10:101237424-101237446 AGGAAGAAGAAGATGGGGGAGGG - Intergenic
1073152757 10:101323047-101323069 AGGGAGTAGCAGCCGGGGGCAGG + Intergenic
1073339643 10:102735225-102735247 AGGGAGGAGCAACATGGAGAGGG - Intronic
1073348510 10:102802089-102802111 AGGTGGAAGGAGGAGGGGGAAGG - Intronic
1073597710 10:104817381-104817403 AGGGGGAAGGAGGAGGAGGAGGG - Intronic
1074455256 10:113590526-113590548 AGGAAGAGGCACCAGGGGAAGGG + Intronic
1074560871 10:114534200-114534222 AGGGAACAGCAGGAAGGGGAAGG + Intronic
1074561885 10:114542526-114542548 AGGAAGAAGGAGGAGGGAGAAGG + Intronic
1074711039 10:116177762-116177784 AGGGAGAAATAGCAGGGAGTGGG - Intronic
1074714265 10:116203551-116203573 AGAGAGAGGCAGCTGGGGGAAGG + Intronic
1074773772 10:116751071-116751093 AGGAAGAAGGAGGAGGAGGAGGG + Intergenic
1075197978 10:120377779-120377801 AGAGAGGAGCAGAAGGGGAAGGG - Intergenic
1075284506 10:121171845-121171867 AGGGAGAAGGGGAAGGGGAAAGG + Intergenic
1075330899 10:121573417-121573439 AGGGAGAAACCTCAGTGGGATGG - Intronic
1075561621 10:123472664-123472686 AGGGAGAAGCAAGGAGGGGATGG + Intergenic
1076312500 10:129518487-129518509 GGGGAGGAGGGGCAGGGGGAAGG - Intronic
1076312513 10:129518512-129518534 GGGGAGGAGGGGCAGGGGGAAGG - Intronic
1076456774 10:130605337-130605359 AGAGAGAAGCAGCTTGGGGAGGG + Intergenic
1076457127 10:130608267-130608289 TGGGAGAAGCACCAGGGGGAGGG - Intergenic
1076512323 10:131021612-131021634 AGGCAGAAACATCAGGGGCATGG - Intergenic
1076598600 10:131642146-131642168 GGGGAGAAGCAGCAGGGTCTTGG - Intergenic
1076605559 10:131687094-131687116 ATGGAGCAGCAGCAGGGGCCTGG - Intergenic
1076609321 10:131711318-131711340 AGGGAGGAGGAGCGGGAGGAGGG - Intergenic
1076732461 10:132445543-132445565 GGGGAGTAGCAGCAGGGGATGGG + Intronic
1076732848 10:132446971-132446993 TGGGAGAAGCGGGAGGAGGAGGG + Intronic
1076760890 10:132605304-132605326 AGGGGGAAGCAGCTGGGGATGGG + Intronic
1076760914 10:132605362-132605384 AGGGGGAAGCGGCTGGGGGATGG + Intronic
1076778051 10:132709181-132709203 AGGGAGAGGCCCGAGGGGGAGGG - Intronic
1076821039 10:132939729-132939751 AGGGAGACGCAGCAGGCCGCTGG - Intronic
1076856324 10:133117073-133117095 AGGCACAGGCAGAAGGGGGAAGG + Intronic
1076890122 10:133279235-133279257 TTGGAGCAGCAGCAGGAGGAGGG + Exonic
1077015127 11:395958-395980 AGGGACAGGCAGGAGGAGGATGG - Intronic
1077073226 11:687333-687355 AGCGAGAAGAAGCAGGAGGGAGG - Intronic
1077249472 11:1554622-1554644 AGGGACAAGGGGAAGGGGGAAGG + Exonic
1077484811 11:2833791-2833813 TGGGACAGGCAGCTGGGGGAAGG + Intronic
1077538213 11:3134516-3134538 AGGGACCAGCAGCAGGAGGAGGG - Intronic
1077539222 11:3138788-3138810 AGGGAGAAGCAGCTGGGCTGTGG + Intronic
1077678212 11:4216036-4216058 AGAGAGAGGAAGCAGTGGGATGG - Intergenic
1077693432 11:4370466-4370488 AGAGAAAAGGAGCAGGAGGAAGG - Intergenic
1078127324 11:8580487-8580509 AGGGGGAAGGGGGAGGGGGATGG + Intronic
1078412903 11:11142366-11142388 AGGGACAAGGAGCAATGGGAAGG + Intergenic
1078612937 11:12837701-12837723 AAGGAGAAGGAGAAGGGAGAAGG - Intronic
1078659662 11:13277266-13277288 GGGGAGAAGAAGAAGGAGGAGGG + Intronic
1078676058 11:13415490-13415512 GGGGAGAAGGAGCAGGGAGGAGG - Intronic
1079089177 11:17468874-17468896 AGGCAGAAGCAACAGGATGATGG - Intronic
1079132501 11:17755667-17755689 ATGGAGAGGCTGCAGGGGGTGGG + Intronic
1079743058 11:24087697-24087719 AGTGAGAAGCAGCATATGGATGG + Intergenic
1080237883 11:30092836-30092858 AGGGAGGAGAGGGAGGGGGAGGG - Intergenic
1080257483 11:30307169-30307191 GGGGAGAAGGGGCAAGGGGAGGG - Intergenic
1080394208 11:31875063-31875085 CAGGAGCAGCAGGAGGGGGAAGG - Intronic
1080478368 11:32619863-32619885 AAGGAGAAGGAGGAGGGGGAGGG + Intronic
1080642285 11:34165000-34165022 AGGGAGGGGGAGCAGGGGCAGGG - Intronic
1081521915 11:43889996-43890018 CAGGAGAAACAGCAGGTGGAAGG + Intronic
1081762627 11:45587213-45587235 AGGCAGATGAAGTAGGGGGAGGG - Intergenic
1081850445 11:46271897-46271919 AGGGAGAAGCCACAGGAGCAGGG - Intergenic
1082099708 11:48162386-48162408 AGGGAGAGGGAGGAGGGAGAGGG - Intronic
1082892404 11:58154101-58154123 AGGAGGAAGGAGGAGGGGGAAGG + Intronic
1083431112 11:62613890-62613912 AGGGAGGAGGAGGAGGAGGAAGG - Intronic
1083658409 11:64241274-64241296 CCGGAGATGCCGCAGGGGGAGGG + Intronic
1083859389 11:65411867-65411889 ATGGAGCACCAGCAGGAGGAAGG - Exonic
1083871401 11:65490503-65490525 TGGGAGAGGCAGCAGAGGGGAGG - Intergenic
1084241737 11:67825951-67825973 AGAGTGAACCAGCAGAGGGATGG - Intergenic
1084537270 11:69764548-69764570 AGTGAGAGGCTGCTGGGGGAGGG + Intergenic
1084545242 11:69812120-69812142 AGGTGGAAGCAGCAGGTGCAAGG + Intronic
1084569514 11:69950943-69950965 AGGGAGAGGCACCGGGGGAAGGG + Intergenic
1084571659 11:69963411-69963433 AAGGAGAAGGAGGAGGAGGAGGG + Intergenic
1084571662 11:69963417-69963439 AAGGAGGAGGAGGAGGGGGAAGG + Intergenic
1084949621 11:72657474-72657496 AGGGAGATGGAGGAGTGGGAGGG - Intronic
1085300696 11:75456688-75456710 AGGCAGCAGCAGCAGAGGAAGGG - Intronic
1085456667 11:76669406-76669428 AGAGAGAAAGAGCAGGGGTACGG + Intronic
1085514316 11:77103473-77103495 AGGGAGAAGCAGAGGAGGAAAGG - Intronic
1085640194 11:78188579-78188601 AGGGAGAGGCTGCAGAGCGAGGG - Exonic
1085643918 11:78210338-78210360 CAGGCGGAGCAGCAGGGGGATGG - Exonic
1085754215 11:79190820-79190842 AGGGAGAGGGAGAAGGGAGAGGG - Intronic
1086457073 11:86969531-86969553 AGGAAGAAGGAGAAAGGGGATGG - Intergenic
1086490748 11:87355908-87355930 AGGGAGCAGAAACAGAGGGATGG - Intergenic
1086575759 11:88337622-88337644 GGAGAGAAGCAGCAGGAGGGCGG + Exonic
1087051982 11:93895654-93895676 AGCAAGAAGGAGAAGGGGGAGGG + Intergenic
1087202943 11:95364410-95364432 AGGGAGAACCTACTGGGGGAAGG + Intergenic
1087906508 11:103703823-103703845 AGTGAGAAGCAGCAGTGTGATGG + Intergenic
1088047613 11:105472788-105472810 AAGGAGAAGGAGAAGGGGAAGGG + Intergenic
1088275616 11:108082255-108082277 AGAGAGAAGAAGGAAGGGGAAGG - Intronic
1089064280 11:115650593-115650615 AGGGAGGAGTTGCAAGGGGAGGG - Intergenic
1089100090 11:115955714-115955736 AGGGAGAAGGAGGAGGGGAAGGG - Intergenic
1089400988 11:118164591-118164613 AGGGAGAAACAGCAGGGAAGAGG - Exonic
1089586795 11:119514738-119514760 AGTGAGCAGTAGGAGGGGGATGG - Intergenic
1090077140 11:123586697-123586719 AGGTCAAAGCAGCAGGGGCAGGG - Intronic
1090198680 11:124839092-124839114 AGGGAGAAGGAATAGGGGGCAGG - Intergenic
1090402847 11:126460103-126460125 CGGGAGCAGGAGGAGGGGGAAGG + Intronic
1090450953 11:126805912-126805934 AGGGAGAGGCCGCACGGAGAAGG - Intronic
1090502971 11:127279729-127279751 AAGGAGAAGAAGGAGGAGGAGGG - Intergenic
1090634507 11:128682344-128682366 AGAGAGAGGCAGCTGGGGGCAGG - Intergenic
1090833845 11:130439398-130439420 AGGGAGAAAAAGGAGAGGGAGGG + Intergenic
1091070612 11:132559149-132559171 AGAGAGAAGCAAGAAGGGGAGGG + Intronic
1091363974 11:135001661-135001683 ACGGAGAAGCAGGAAGGAGAGGG + Intergenic
1091395206 12:150138-150160 GTGGAGAAGCAGCAGGGCCATGG + Intronic
1091418315 12:310942-310964 AGGTAGCAGCAGCACGGGCATGG - Exonic
1091541683 12:1468256-1468278 ACAGAAAAGCTGCAGGGGGAAGG + Intronic
1091591408 12:1845070-1845092 AGGGAGAAGCAGGGTGGGGGTGG + Intronic
1091599958 12:1912146-1912168 AGGGCCAAGCAGCAGGGGAAGGG - Intronic
1091790925 12:3271752-3271774 AGGGAGAGGCAGGAGGGGCAGGG - Intronic
1091884179 12:4003906-4003928 AAGGAGAAGGAGGAGGAGGAGGG - Intergenic
1091930147 12:4389416-4389438 AAGGAGAAGAAACAGAGGGAGGG - Intergenic
1092001816 12:5038992-5039014 AGATGGAAGCAGGAGGGGGAGGG - Intergenic
1092119742 12:6035547-6035569 AGGGTGAATGAGCAGGGTGAGGG + Intronic
1092411989 12:8260622-8260644 AGAGTGAAACAGCAGAGGGATGG - Intergenic
1092774309 12:11929202-11929224 GGGATGAAGGAGCAGGGGGAGGG - Intergenic
1092793829 12:12091678-12091700 AGGGCGAAGCACCTGGGAGATGG + Intronic
1092910939 12:13144480-13144502 AGGGAGGAGGAGGAGGAGGAAGG + Intergenic
1093084575 12:14852460-14852482 AAGGAGGAGGAGGAGGGGGAGGG - Intronic
1094154149 12:27320135-27320157 GGGTAGAGGCAGCAGGGAGAGGG - Intronic
1094250529 12:28354985-28355007 AAGGAGAGGCAGGAGGGAGAAGG - Intronic
1094339390 12:29393646-29393668 AGGGAGAAGAGGAAGGGTGAAGG + Intergenic
1094355492 12:29573501-29573523 AGGGTGAAGAAGTAGGAGGAGGG + Intronic
1094628262 12:32146926-32146948 AGGAAGAAGAAGGAGGAGGAAGG - Intronic
1094680382 12:32662031-32662053 AGGGAGGAGGAGCAGGACGATGG - Intergenic
1094772749 12:33684479-33684501 AGGGAGAAGGGGAAGGGGGAGGG - Intergenic
1094816512 12:34191756-34191778 ATGGAGACTCAGCAGGGTGAGGG + Intergenic
1095154971 12:38841857-38841879 AGGGAGAAGCAGAAAGATGAAGG + Intronic
1095668928 12:44835467-44835489 AGAGAGAGGCAGCAGGGACATGG + Intronic
1095891103 12:47235727-47235749 AGGGAGAACCTGCACTGGGACGG + Exonic
1096112546 12:49038037-49038059 AGGCATCAGCAGCAGGGGGAGGG + Exonic
1096337071 12:50764438-50764460 GGGGCGCAGCGGCAGGGGGAGGG + Intronic
1096528419 12:52228133-52228155 AAGAAGAAGGAGGAGGGGGAGGG - Intergenic
1096528423 12:52228139-52228161 AAGGAGAAGAAGAAGGAGGAGGG - Intergenic
1096556830 12:52409017-52409039 AGGGAGAGGGAGGAGGGAGAGGG - Intergenic
1096638281 12:52975036-52975058 GAGGAGAAGGAGCAGGGAGAGGG + Intergenic
1096743290 12:53709996-53710018 AGGGAGAGGGAGAGGGGGGAAGG + Intronic
1096783005 12:54001566-54001588 AAGGAGAAACAGCAGGGGAGGGG + Intronic
1096964121 12:55611495-55611517 ATGGGGAAGCAGCAGGGAGGGGG + Intergenic
1097067739 12:56333329-56333351 AGGATGAAGCAGGCGGGGGAGGG + Intronic
1097105085 12:56617476-56617498 AGGCAGCAGGTGCAGGGGGAAGG + Exonic
1097144529 12:56930804-56930826 AGGGAGAAGTATGATGGGGAAGG - Intronic
1097174983 12:57137428-57137450 GGGGAGCAGAGGCAGGGGGATGG - Intronic
1097176642 12:57147224-57147246 AGGGACGTGGAGCAGGGGGAGGG - Intronic
1097188471 12:57208375-57208397 GGGCAGAGGCAGCATGGGGAGGG - Intronic
1097998676 12:65917657-65917679 AGGAAGAGACAGAAGGGGGAAGG + Intronic
1098106035 12:67069517-67069539 AGGAAGAAGGAGGAGGAGGAGGG - Intergenic
1098358611 12:69633909-69633931 CTGGAGAAGCAGCAGGATGAGGG - Intergenic
1098495882 12:71135285-71135307 AAGAAGAAGGAGGAGGGGGAGGG + Intronic
1099616432 12:84941522-84941544 AAGGAGAAGGAGAAGGGGAAAGG + Intergenic
1099758869 12:86892934-86892956 AACTAGAAGCAGCAGGGGCAGGG - Intergenic
1100206373 12:92354412-92354434 ATGGGGAGCCAGCAGGGGGATGG - Intergenic
1100449926 12:94696063-94696085 GAGGAGCAGCAGCAGGGGGAAGG + Intergenic
1100550731 12:95644353-95644375 AAGGAGAAGAAGAAGGGGCAAGG - Intergenic
1100550736 12:95644376-95644398 AAGGAGAAGAAGAAGGGGGAAGG - Intergenic
1100665723 12:96750395-96750417 AGGGAGGAACAGAAGGGAGATGG - Intronic
1100677657 12:96885852-96885874 GGGGAGAAGGAGGAGGAGGAAGG - Intergenic
1100779397 12:98008009-98008031 AAGGAGAAGGAGAAGGGGAAAGG + Intergenic
1101252802 12:102951788-102951810 AATGAGAAGAAGGAGGGGGAAGG - Intronic
1101654417 12:106707486-106707508 GGGGAGGAGCAGCAGAAGGAGGG + Intronic
1101723495 12:107371004-107371026 AGGGAGGAGGAGAAGGGGGGTGG - Intronic
1101734211 12:107450793-107450815 ACTGAGAGGCAGGAGGGGGAGGG + Intronic
1101746718 12:107547210-107547232 AAGGAGAAGGGGGAGGGGGAGGG + Intronic
1101925699 12:108969658-108969680 AGGGAGAAGGGACAGAGGGAGGG - Intronic
1102001563 12:109560980-109561002 AGGGAGAGGAACAAGGGGGAGGG - Intronic
1102014048 12:109636277-109636299 TGGGAGTAGCAGCAGAGAGAAGG + Intergenic
1102166747 12:110813000-110813022 AAGGAGAAGGAGAAGGGGAAGGG - Intergenic
1102598736 12:114012862-114012884 AGGGAGAGGGAGGAGGGAGAGGG + Intergenic
1102598742 12:114012881-114012903 AGGGAGAGGGAGGAGGGAGAAGG + Intergenic
1102598747 12:114012894-114012916 AGGGAGAAGGAGGAGGGAGAGGG + Intergenic
1102625633 12:114233259-114233281 AGGGAGAAGGGGAAGGGGAAGGG - Intergenic
1102887670 12:116534065-116534087 GGGGAGAAGGAGGAGGAGGAGGG - Intergenic
1103152480 12:118652870-118652892 AGGAAGGAACAGCGGGGGGAGGG + Intergenic
1103205778 12:119127764-119127786 AGGGAGAAGGAGAAGGTAGAAGG + Intronic
1103358785 12:120341838-120341860 AGGGACACACAGAAGGGGGATGG + Exonic
1103371575 12:120423329-120423351 AAGGAGAAGGAGAAGGGGAAGGG - Intergenic
1103562717 12:121800636-121800658 CGGGAGGAGCGGCAGGGGTAGGG - Intronic
1103612472 12:122132382-122132404 AGGTAGAGGAAGCTGGGGGATGG + Exonic
1103620602 12:122184907-122184929 AGGGAGATGAAGCAGATGGAGGG - Intronic
1103921585 12:124402210-124402232 AGGGAGGAGGAGTAGGGCGATGG + Intronic
1103946754 12:124531491-124531513 AGGGAGGAGAAGGAGGGGTAGGG + Intronic
1103946919 12:124532027-124532049 AGGGTGCAGCAGCAGAGGGAGGG - Intronic
1103991933 12:124805167-124805189 AGGGAGCAGCAGGTGGGAGAGGG + Intronic
1104661292 12:130613015-130613037 AGGGAGAAACAGCTGGTGAATGG - Intronic
1105881035 13:24606872-24606894 AGTGAGGAGCAGCAGGGCCAGGG + Intergenic
1106124019 13:26885384-26885406 AGGGGAAAGTAGCAGGAGGAAGG + Intergenic
1106130402 13:26934706-26934728 AGAGAGAGGCAGCAAGAGGAAGG - Intergenic
1106255613 13:28019772-28019794 AGGGAGGACCAGAAGCGGGAGGG - Intronic
1106545812 13:30730547-30730569 AGGGAGAAGGAGCAGGAGGTGGG - Intronic
1106621377 13:31374196-31374218 TGGGAAAAGAAGCAGGAGGAGGG - Intergenic
1106771514 13:32965284-32965306 AAGGAGAAGGAGAAGGGGAAGGG - Intergenic
1107328834 13:39274891-39274913 GGAGAGAAGCAGAATGGGGAAGG + Intergenic
1107562512 13:41571300-41571322 AGGGAGAGGGAGGAGGGAGAGGG - Intronic
1107604072 13:42040961-42040983 AAGGAGAAGCGGGAGGGGGTGGG - Intronic
1107708201 13:43127603-43127625 AGGGAGAGGGAGGAGGGCGAAGG - Intergenic
1107795463 13:44046927-44046949 AAGGAGAAGGAGAAGGGGAAGGG - Intergenic
1107999429 13:45892724-45892746 AGAAAGAAGCAACAGGAGGAAGG + Intergenic
1108192750 13:47959409-47959431 AGGGAGAGGGAGAAGGAGGAGGG + Intronic
1108192751 13:47959415-47959437 AGGGAGAAGGAGGAGGGAGAAGG + Intronic
1108596145 13:51951342-51951364 ATGGAGAAGCAGCTAAGGGAGGG + Intronic
1108698983 13:52927598-52927620 AGGGAGAAGAAGGAGAAGGAGGG + Intergenic
1109181577 13:59220072-59220094 AGGGAGGAGGAAAAGGGGGAAGG + Intergenic
1109749961 13:66677606-66677628 AGAGAGAAAGAGCATGGGGAAGG - Intronic
1110111368 13:71750136-71750158 GGGGAGGAGAAGCAGGGGAAAGG - Intronic
1110515840 13:76411449-76411471 GGGGAGAAGGAGGAGGGGGGAGG + Intergenic
1110515864 13:76411496-76411518 GGGGAGAAGGAGGAGGGGGGAGG + Intergenic
1112742643 13:102492616-102492638 AGGCAGCAGCAGCATTGGGAGGG + Intergenic
1112744402 13:102510317-102510339 AGGTAGCAGCATCAAGGGGAAGG - Intergenic
1112972123 13:105273579-105273601 AGTGAGAAGTAGCAGGGGAAAGG + Intergenic
1113142908 13:107174754-107174776 AGGGAGAAGCAGGATGTGGCTGG + Intronic
1113159617 13:107365027-107365049 AGAGAGAAGGAGGAGGAGGAGGG - Intronic
1113164986 13:107430432-107430454 AGGGAGCAGGGGGAGGGGGAAGG - Intronic
1113433123 13:110267266-110267288 AGGGAGGAGGGGCAGGGAGACGG + Intronic
1113492432 13:110703067-110703089 AGGGGGGAGGAGCAGGGGAAGGG - Intronic
1113613293 13:111663317-111663339 AGGAAGAAGGAGGAGGGGAAGGG - Intronic
1113660273 13:112103018-112103040 GGGGTGAAACAGCAGGAGGAAGG + Intergenic
1113788083 13:113013380-113013402 GGGGGGAAGCAGCAGGGCCACGG - Intronic
1113967829 13:114164392-114164414 AAGGAGAGGCAGATGGGGGAAGG + Intergenic
1114080262 14:19197725-19197747 AGGGAGAAACACCAGGGGCTGGG + Intergenic
1114155508 14:20099184-20099206 AGGGAGACGGGGCGGGGGGAGGG + Intergenic
1114217931 14:20671284-20671306 AGGAAAAATCAGGAGGGGGATGG - Intergenic
1114260113 14:21030517-21030539 GGGGTGAAGGAGAAGGGGGAGGG - Exonic
1114402914 14:22426426-22426448 GGGGAGAGGAGGCAGGGGGAAGG - Intergenic
1114566828 14:23639267-23639289 ATGGCCAAGCTGCAGGGGGAGGG + Exonic
1114680982 14:24483171-24483193 AGGGAAAAGCACCAGGGTGAAGG - Intergenic
1114954433 14:27799631-27799653 AGGTAGATGCATCAGGAGGAGGG + Intergenic
1115275589 14:31605751-31605773 AAGGAGAAGGAGAAGGAGGAAGG - Intronic
1115320642 14:32076749-32076771 AGGGAGAAGCAGAGGGGAGGAGG + Intronic
1115529362 14:34312802-34312824 AAGGAGAAGGAGAAGGGGAAGGG - Intronic
1115659130 14:35474595-35474617 AAGGAGGAGGAGGAGGGGGAAGG - Intergenic
1115724189 14:36194740-36194762 AGGGAGAGGAAGGAAGGGGAGGG + Intergenic
1115851241 14:37591960-37591982 TGCGAGAAGCAGCCGGGGGCCGG - Exonic
1117079602 14:52137589-52137611 AGGGAGAAGAGGAAGGGTGAAGG + Intergenic
1117372761 14:55093967-55093989 AGGAAGAAGGAGGAGGAGGAGGG + Intergenic
1117581482 14:57155909-57155931 ATGGAGGAGCAGGAGGGGAAAGG + Intergenic
1118171696 14:63395443-63395465 AGAGAGAAGGAGGAGGAGGAGGG + Intronic
1118459564 14:65976066-65976088 AGGGGGAAGGAGGAGGAGGAGGG + Intronic
1118797066 14:69153167-69153189 AGGGAGGAGCCTCGGGGGGAAGG - Intergenic
1119030248 14:71186771-71186793 AGAGAGATGCAGCATGGGGAAGG + Intergenic
1119067417 14:71542685-71542707 AGGGAGGAGGAGAAGGGAGAAGG - Intronic
1119149593 14:72346367-72346389 ATGGAGAAGGAGCAGTGTGAGGG + Intronic
1119181015 14:72605283-72605305 AGGGAGCAGGAGCAGGAGGAGGG + Intergenic
1119483955 14:74976297-74976319 AGAGAGGAGGAGCAAGGGGAAGG - Intergenic
1119485181 14:74982167-74982189 TGGGAGAAGCAGCAGGACGTGGG + Intergenic
1119485572 14:74984681-74984703 GGGGCGGAGCAGCAGCGGGAAGG - Intergenic
1119631668 14:76237482-76237504 AGGCAGGAGCAGAAAGGGGAAGG - Intronic
1119902826 14:78275907-78275929 AGGTAGACGAAGGAGGGGGATGG - Intronic
1119945983 14:78694882-78694904 AGGAATGAGCAGCAGTGGGAGGG + Intronic
1120193934 14:81463191-81463213 AGGGAGAGGGAGACGGGGGAGGG + Intergenic
1120193942 14:81463210-81463232 AGGGAGAGGGAGACGGGGGAGGG + Intergenic
1120193950 14:81463229-81463251 AGGGAGAGGGAGACGGGGGAGGG + Intergenic
1120193958 14:81463248-81463270 AGGGAGAGGGAGACGGGGGAGGG + Intergenic
1120193966 14:81463267-81463289 AGGGAGAGGGAGACGGGGGAGGG + Intergenic
1120281456 14:82443669-82443691 AAGGAGAAGGAGAAGGGGAAGGG - Intergenic
1120787167 14:88548488-88548510 AGGGAGGTGCAGCAAAGGGAAGG - Intronic
1121096871 14:91223480-91223502 AGGAAGAAGAAGAAGAGGGAAGG + Intronic
1121105070 14:91274186-91274208 AGAGAGAGGCAGAATGGGGATGG + Intronic
1121419076 14:93799586-93799608 AGGGAGAAGAAGCCAGGGCAGGG - Intergenic
1121447450 14:93987972-93987994 AGGGAGAAACAGTAGGGAGGTGG + Intergenic
1122292411 14:100686868-100686890 CTGGAGAGGCAGGAGGGGGAGGG + Intergenic
1122307743 14:100776433-100776455 AATGAGAAGCAGGAGGGAGAGGG + Intergenic
1122322264 14:100862170-100862192 AGGGAGAAAGAGGAGGAGGAGGG - Intergenic
1122363909 14:101183248-101183270 AGGGAGAGGGGCCAGGGGGAAGG - Intergenic
1122370747 14:101227714-101227736 AGGGAGAAGCAGGTCGGGGCAGG + Intergenic
1122381856 14:101313555-101313577 AGGGAGAAGCAGGTCGGGGCAGG - Intergenic
1122577275 14:102750313-102750335 AGCAAGAAGCAGCAGGGAGTGGG + Intergenic
1122662164 14:103303720-103303742 AAGAAGAAGCAGCTAGGGGAAGG + Intergenic
1122672866 14:103385501-103385523 AGGGAGAAGCAGTCGGGCGCAGG + Exonic
1122721984 14:103727388-103727410 AGGGCAAAGCGGCACGGGGACGG - Intronic
1122782640 14:104150140-104150162 GGGGAGGAGGAGGAGGGGGAGGG - Intronic
1122969728 14:105147658-105147680 GGGCAGGGGCAGCAGGGGGAGGG + Intronic
1122979764 14:105186167-105186189 CCGGAGGAGCAGCAGGGGGCTGG + Intergenic
1123773031 15:23548288-23548310 AGGGACAAGCAGGAGGCAGAGGG - Intergenic
1123972025 15:25516213-25516235 GGGGATAATCAGCAGAGGGAAGG - Intergenic
1124957740 15:34370796-34370818 AGGAAGAAGAGGGAGGGGGAAGG - Intergenic
1125158246 15:36614213-36614235 AGGGAGGAGCAGCAGCAGGGTGG - Intronic
1125385629 15:39133510-39133532 AGTGAGAAGCAAGAGGGGGTTGG + Intergenic
1125547265 15:40515243-40515265 GAGAAGTAGCAGCAGGGGGAGGG - Intergenic
1125874807 15:43134197-43134219 AGGAAGAGGCAGCATGGGGAGGG - Intronic
1125886781 15:43235312-43235334 AGGGGGAAGGAGAAGAGGGAAGG + Intronic
1126371925 15:47956423-47956445 AGGGAGGAAGAGCAGAGGGATGG - Intergenic
1126431314 15:48588004-48588026 CTGGAGAAGCAGCAGAAGGAAGG + Intronic
1127122105 15:55780596-55780618 AGGGAGAAGAAGAAGGAAGAAGG + Intergenic
1127212651 15:56789927-56789949 TGGGAGAAGGAGCAAGGGAAGGG + Intronic
1127415044 15:58749597-58749619 AGGGAGAAGCTGAAGGGGCTTGG + Exonic
1127757339 15:62105346-62105368 AGGGAGAAGGAGCAGGTGGCAGG + Intergenic
1128223233 15:65983074-65983096 AGGGAGATGGAGCCAGGGGAGGG - Intronic
1128304201 15:66587181-66587203 AAGGAGAAGCAGGAGGAGGAGGG - Intronic
1128447800 15:67780012-67780034 AGGGAAAAGCCGCAGGGAGGAGG - Intronic
1128528319 15:68427519-68427541 AGTGAGAGGCAGCAGGGAGGGGG + Intronic
1128557470 15:68641485-68641507 AGGGAAAAGGAGAAGGGGGAGGG + Intronic
1128734705 15:70046684-70046706 GGGGAGACGCAGCAGGAGGAAGG + Intergenic
1128818857 15:70634328-70634350 AAGGAGAAGCAGCTGGAGGGGGG + Intergenic
1129113109 15:73349742-73349764 AGGTAGCAGCAGTAGGGAGAGGG - Intronic
1129222578 15:74140191-74140213 AGAAAGAAGCAGCTGGGGTAGGG + Intergenic
1129302723 15:74635231-74635253 AGGGAGAAGCATAAGGGGATGGG + Intronic
1129657149 15:77531848-77531870 AGGGAGAAGAGGCAGGCAGAGGG - Intergenic
1129679006 15:77647388-77647410 AGGGAAAGGCAGCTGGGGGGTGG + Intronic
1129686665 15:77689869-77689891 AGGGGGAAGCAAGAAGGGGAAGG + Intronic
1129698479 15:77754178-77754200 AGGGAGCAGGAGCAAGAGGATGG + Intronic
1129849516 15:78784393-78784415 AGGGAGAGGAAGAGGGGGGAGGG + Intronic
1130036169 15:80363369-80363391 AGTGAGGAGCAGCAGGGCCATGG - Intronic
1130060016 15:80563007-80563029 AGGGAGAAGCTGCAGGCAGTGGG - Intronic
1130424965 15:83787820-83787842 AAGGAGAAAGAGGAGGGGGAGGG - Intronic
1130430439 15:83842031-83842053 ATGGGGAGGCAGAAGGGGGATGG - Intronic
1130681589 15:86001641-86001663 AAAGAGAAAGAGCAGGGGGAGGG - Intergenic
1130899070 15:88193328-88193350 AGGGCACAGCAGCAAGGGGAAGG + Intronic
1131014142 15:89043472-89043494 AAGGAGAGGAAGAAGGGGGAGGG + Intergenic
1131014192 15:89043665-89043687 AGGGAGGAGGAGAAGGAGGAGGG + Intergenic
1131017857 15:89072512-89072534 AAGGATGAGCAGGAGGGGGAGGG + Intergenic
1131059782 15:89397562-89397584 AGGGAGCAGGGGCAGGGGGCAGG + Intergenic
1131271933 15:90952894-90952916 AGGAGGAAGCAGCAGGGATACGG - Intronic
1131284738 15:91047920-91047942 GGGGAGAAGCGGAGGGGGGAAGG - Intergenic
1131284836 15:91048185-91048207 AAGAAGAAGAAGGAGGGGGAGGG - Intergenic
1131299666 15:91185994-91186016 AGAGAGAAGAAGCAGGGGTCTGG - Intronic
1131390450 15:92043881-92043903 AGGGAGAAACAGGAGGAGGGAGG - Intronic
1131646234 15:94348359-94348381 AGGGAGAGAGAGAAGGGGGATGG - Intronic
1131679377 15:94705626-94705648 AGGGAGAGAGAGAAGGGGGAGGG - Intergenic
1132305131 15:100806619-100806641 AGGGAGAGGAAGGAGAGGGACGG + Intergenic
1132547835 16:541346-541368 AGGGAGACGCGGCAGAGGCAGGG + Intronic
1132664633 16:1075973-1075995 AGGGAGGGGGAGGAGGGGGAGGG - Intergenic
1132686120 16:1162820-1162842 AGGGAGTATGAGCAGGGGGTGGG + Intronic
1132779041 16:1612905-1612927 AGGGCCAACAAGCAGGGGGATGG - Intronic
1132828526 16:1916730-1916752 GGGGAGAGGCGGGAGGGGGAAGG - Intronic
1132831886 16:1932468-1932490 AGGGAGAAGCAGAAAGGGACAGG + Intergenic
1132908226 16:2295137-2295159 CGGCAGAACCAGCAAGGGGAGGG - Intronic
1133169322 16:3971314-3971336 AGGCAGAATCAGCAAAGGGAAGG - Intronic
1133255777 16:4514763-4514785 AGGGAGAAGCCGGATGTGGAAGG - Exonic
1133353232 16:5116860-5116882 AGAGTGAAACAGCAGAGGGATGG - Intergenic
1133392601 16:5422234-5422256 AGGGAGGAGGAGCAGGGAGAGGG + Intergenic
1133392607 16:5422253-5422275 AGGGAGGAGGAGCAGGGAGAGGG + Intergenic
1133392741 16:5422721-5422743 AGGGAGAGGGAGCAGGGAAAGGG + Intergenic
1133392859 16:5423102-5423124 AGGGAGAGGGAGGAAGGGGAGGG + Intergenic
1133417296 16:5616569-5616591 AGGGAGAGGGAGAAGGGAGAGGG - Intergenic
1133460735 16:5984148-5984170 GGGGAGGAGGAGGAGGGGGAGGG - Intergenic
1133848940 16:9483656-9483678 GGGGAGAAGCAGCATGGGAAGGG + Intergenic
1134043824 16:11087213-11087235 AGGGGGCAGCAGGTGGGGGATGG - Intronic
1134066599 16:11232468-11232490 AGGGGGGAGGAGGAGGGGGAGGG + Intergenic
1134401529 16:13914501-13914523 GGGGAGAGGCTGAAGGGGGAGGG - Intergenic
1134649599 16:15898200-15898222 AGGGAGAAGAAAGAGGAGGAGGG - Intergenic
1134770605 16:16806050-16806072 AAGGGGAAGGAGAAGGGGGAAGG - Intergenic
1135140899 16:19921187-19921209 TGGAAGGAGCAGCAGGGTGAGGG + Intergenic
1135667348 16:24347015-24347037 AGAAAGAAGAAGCAGGGGGTAGG + Intronic
1135671852 16:24382261-24382283 GTGGAGAAGGAGGAGGGGGAGGG - Intergenic
1135694710 16:24575799-24575821 AGGGAGAGGGAGGAGGGGGAGGG + Intergenic
1136005052 16:27323758-27323780 AGGGAGATGAGGCAGGAGGATGG - Intronic
1136079523 16:27842587-27842609 AAGGAACAGCTGCAGGGGGAAGG + Intronic
1136223544 16:28844113-28844135 AGGGAAAAGGAGCAGGGAGAAGG + Intronic
1136397430 16:30000957-30000979 AGGGAGAGGCTGGAGGGAGAGGG - Exonic
1136416432 16:30107055-30107077 AGGGAGAGGGAGGAGAGGGAGGG - Intronic
1136458488 16:30395600-30395622 TGGGAGGAGCAGCAGGTGCAGGG + Intronic
1136506892 16:30710133-30710155 AGGCAGAAGGAGCAGAGGGAGGG + Intronic
1137333765 16:47527858-47527880 AGGACAAAGCAGCAGGAGGATGG + Intronic
1137343831 16:47636646-47636668 GGGCTGAGGCAGCAGGGGGATGG - Intronic
1137386497 16:48047474-48047496 AAGGAGGAGAAGCAGGAGGAGGG + Intergenic
1137605220 16:49782673-49782695 AGGGAGAGGCAGTAGGAGAAGGG - Intronic
1137840629 16:51637480-51637502 AGGGAGAAGAAGGAGGGGGGAGG + Intergenic
1137938221 16:52656063-52656085 AGGGAGGAGCAGCAGCAGGGTGG - Intergenic
1138089076 16:54159364-54159386 AGGGACCAGGAGCACGGGGAGGG - Intergenic
1138229005 16:55324291-55324313 AGGGAGAAGGAGGAGGGGAGAGG - Exonic
1138651320 16:58463241-58463263 AGCGCGAAGCAGCAGGCGCAGGG + Intronic
1138763117 16:59567725-59567747 AGGGAGTCCCGGCAGGGGGATGG - Intergenic
1139055099 16:63173843-63173865 AGTGAGAAGCAGGAGGAGGGAGG - Intergenic
1139268241 16:65659430-65659452 ATGGAGAAGGTGCAGAGGGATGG + Intergenic
1139946330 16:70644909-70644931 AGGGAGGAGAAGGAGGAGGAAGG + Intronic
1140131586 16:72166593-72166615 AGGGGGAAGCAGGACAGGGAAGG + Intronic
1140145172 16:72300067-72300089 AGGTAGAAAGAGAAGGGGGATGG - Intergenic
1140209888 16:72961497-72961519 CAGGAGGAGCAGCAGGGGAATGG - Intronic
1140640582 16:76967282-76967304 AGGGTGAAGCAGCAAGGCTAGGG - Intergenic
1140732456 16:77869126-77869148 AATGAGTAGCAGAAGGGGGAAGG + Intronic
1140965727 16:79964259-79964281 AAGGAGAAGGAGGAGGAGGAGGG - Intergenic
1141163987 16:81648037-81648059 CGGTGGAAGCAGCAGGGGGAGGG - Intronic
1141263070 16:82471327-82471349 AAGGAGAAACAGAAGGGGAAGGG - Intergenic
1141382557 16:83589231-83589253 AGAGAGAAGAGGGAGGGGGATGG - Intronic
1141518135 16:84559883-84559905 GGGGAGAAGCAACTGGAGGAGGG + Intergenic
1141662302 16:85448007-85448029 AGGGAGAAGCAGAGCTGGGAAGG + Intergenic
1141775724 16:86121618-86121640 AGGAAGAAGAAGGAGGAGGAGGG - Intergenic
1141775773 16:86121797-86121819 AGGGACAAGCAGGAGGAGGAAGG - Intergenic
1141775829 16:86121976-86121998 AGGGACAAGGAGAAGGAGGAGGG - Intergenic
1141810372 16:86371824-86371846 AGAGAGGAGCAGTAGGGGGCAGG - Intergenic
1141845112 16:86603358-86603380 AGGGGGAAGGAGGAGGAGGAAGG - Intergenic
1141845116 16:86603371-86603393 AGGAAGAAGGAGGAGGGGGAAGG - Intergenic
1141845228 16:86603923-86603945 AGGGAGAAGGAGAAGGAGGGAGG - Intergenic
1142041234 16:87895705-87895727 AGACAGAAGCAGCAGGGCGGGGG - Intronic
1142305430 16:89281815-89281837 AGGGAGAAGCTCCTGGGGGACGG - Exonic
1142432483 16:90037456-90037478 AGGGAGGAGCATCACAGGGAGGG + Intronic
1142492203 17:286404-286426 ACACTGAAGCAGCAGGGGGATGG - Intronic
1142741533 17:1934543-1934565 CGGGAGGAGCCGCAGGGGGCAGG - Intergenic
1142879248 17:2871533-2871555 AGGGAGAGGCAACAGCGGTAGGG + Intronic
1142940739 17:3378295-3378317 GGGCAGAGGCAGCAGGGGGCTGG + Intergenic
1142944512 17:3413189-3413211 GGAGAGAAGCAGCAGGAGGGAGG + Intergenic
1142958160 17:3535190-3535212 AGGGAGAAGGAGGAGGGAGAGGG - Intronic
1142968089 17:3593443-3593465 AGGGAGGGGAAGCATGGGGATGG - Intronic
1143111272 17:4554354-4554376 TGGGAGAAGTTGAAGGGGGAAGG - Intronic
1143149957 17:4801581-4801603 TGGTGGCAGCAGCAGGGGGAGGG + Intergenic
1143150157 17:4802555-4802577 ATGGAGAAGCAGGAGGTGGTTGG + Intergenic
1143165303 17:4894452-4894474 GGGGAACAGCAGCAGGGGCAGGG + Intronic
1143373819 17:6455790-6455812 AGGGACAGGCATCAGGCGGAGGG + Intronic
1143391506 17:6561578-6561600 AGGGAGAAGGAGGAAGAGGAGGG - Intergenic
1143403561 17:6661075-6661097 AGGGAGAGGCAGGAGTGGGATGG + Intergenic
1143478912 17:7217626-7217648 GGAGAGAGGAAGCAGGGGGAGGG + Intronic
1143597276 17:7922873-7922895 AGAAAGACGCAGCAGGGGGCGGG + Exonic
1143613837 17:8037957-8037979 AGTGAGAAGCAGAGGTGGGAAGG - Intergenic
1143677392 17:8444786-8444808 GGGGAGAAGCTTCAGGGGCATGG + Intronic
1143679495 17:8465859-8465881 AGGAAGCAGCAAGAGGGGGAGGG - Intronic
1143794718 17:9327364-9327386 AGGGAGAAGGAGGAGAAGGAGGG + Intronic
1143796829 17:9343741-9343763 AGGGAGCAGGAGGAGGGGGTGGG - Intronic
1143887530 17:10076192-10076214 AGGGAGAGGGAGAAGTGGGAGGG + Intronic
1143887534 17:10076198-10076220 AGGGAGAAGTGGGAGGGGGAGGG + Intronic
1143947430 17:10605472-10605494 AAAGAGAAGGAGGAGGGGGAGGG + Intergenic
1144048110 17:11471353-11471375 AGGGAGGACCAGCAGGAGGCTGG - Intronic
1144300508 17:13919329-13919351 AGTGAGAAGGGGAAGGGGGAAGG - Intergenic
1144573909 17:16417122-16417144 AGGGATGAGCAGCAGGGGTGAGG - Intronic
1144764109 17:17723690-17723712 AGGGAGGAGGAGGAGGGGGCAGG - Intronic
1145110625 17:20158234-20158256 AGGGGGAAGCAGAAGGAGAAGGG + Intronic
1145244291 17:21258158-21258180 TGGGAGATTCAGCAGGGGGCAGG + Intergenic
1145282174 17:21476299-21476321 AGGTAGTGGCAGCAGGGTGATGG + Intergenic
1145774261 17:27516512-27516534 GGGGAGGAGGAGGAGGGGGAGGG - Intronic
1146354864 17:32125464-32125486 CTGGAGAAGCAGCAGGGGCCTGG - Intergenic
1146373739 17:32280985-32281007 AGGGAGAGGCAGCAATGGGCCGG - Intronic
1146376079 17:32295460-32295482 AGGGCTAAGGAGCAGCGGGATGG + Intronic
1146453704 17:32993815-32993837 AAGGAGGAGCAGGAGGGGAACGG + Intronic
1146708965 17:35024210-35024232 AGGGAGTAGGAGCAAGGGAAGGG - Intronic
1146946226 17:36875581-36875603 AGAGAGAAGCAGAAGTGGAAAGG + Intergenic
1147034553 17:37670579-37670601 CGGGAGAAGCAGGAGGAGGGAGG + Intergenic
1147260749 17:39208708-39208730 AGGGAGATGCAGAAAGAGGAGGG - Intergenic
1147325913 17:39669543-39669565 AGGGAGATGCAGGGGAGGGAAGG + Intronic
1147403452 17:40194492-40194514 AGGGAGTAGCAGCAGGTGGGAGG + Exonic
1147420390 17:40319532-40319554 TGGGGTAAGCAGCAGGGGGTGGG - Intronic
1147427345 17:40352196-40352218 GGGAAGAGGCAGCAGGAGGAGGG - Intronic
1147498849 17:40942749-40942771 AGGAAGAAGAAGGAGGAGGAGGG - Intergenic
1147583594 17:41639826-41639848 AGGGAGGACCAGCAGAGGAAGGG + Intergenic
1147631488 17:41935151-41935173 AGGTAGAAGCTGGAGTGGGAAGG - Intronic
1147669120 17:42166574-42166596 AAGTAGTAGCTGCAGGGGGATGG - Intronic
1147902729 17:43799950-43799972 AAGGTGAAGCACCAGGGAGAAGG - Intergenic
1147927379 17:43954004-43954026 AGGGGGAGCCAGCAGGGGGTGGG + Intronic
1147971199 17:44219792-44219814 AGGGAGGAGGAGGAGCGGGAGGG + Intronic
1148020186 17:44548216-44548238 TGGGAGAAGCAAGAGGGAGAAGG + Intergenic
1148824709 17:50384044-50384066 AGGGAGAGGCAGGTGAGGGAAGG - Intronic
1148854393 17:50570797-50570819 ACAGAGAAGCTGAAGGGGGATGG + Intronic
1148966165 17:51437862-51437884 AGGGAGATGGAGAAGGGGAAAGG + Intergenic
1149367507 17:55960587-55960609 AGACAGAAGCAGGAGGGGGCAGG + Intergenic
1149497133 17:57126135-57126157 AGGGAGAAGCTGCATGGCCAGGG + Intergenic
1149516160 17:57282588-57282610 AGGGAGAGGAAGCAGGGAAATGG - Intronic
1149657729 17:58319122-58319144 ATGGAGCAGCAGCAGGGGGGTGG + Exonic
1150139581 17:62716889-62716911 AAGGACAAGCAGCAGGAGGGTGG + Intronic
1150221984 17:63500943-63500965 AGGGAGAGGCAACATGGGGAGGG - Intronic
1150222014 17:63501066-63501088 AGGGAGAAGTGACATGGGGAGGG - Intronic
1150431459 17:65121747-65121769 AGAGAGAAAGAGCGGGGGGAGGG - Intergenic
1150455466 17:65303682-65303704 AGAGAGAAGGAGTAGGGGGTGGG + Intergenic
1150565181 17:66332571-66332593 GTGGAGAAGCTGCAGAGGGAGGG + Intronic
1150689591 17:67353305-67353327 AGAGAGAGGGAGCGGGGGGAAGG - Intronic
1150724731 17:67642433-67642455 AGGGGGTAGCAGAAGAGGGAAGG - Intronic
1150808943 17:68341387-68341409 AGGGAGAAACAGTATGTGGAGGG - Intronic
1151145229 17:72034388-72034410 AGGGGGAAGCAGGAGGGACATGG - Intergenic
1151381655 17:73729961-73729983 AGGGGTGGGCAGCAGGGGGAAGG + Intergenic
1151411069 17:73930071-73930093 AGAGAAAAGGAACAGGGGGAAGG + Intergenic
1151780532 17:76242044-76242066 TGGGAGAAGCTGCCGGGGCAGGG - Intergenic
1152113407 17:78369920-78369942 AGGGAGAAGCTGCGGGGCGGGGG + Intergenic
1152266282 17:79296846-79296868 AGGGAGGAGAAGCAGGAGGAGGG - Intronic
1152302032 17:79500640-79500662 CGGGAAAAGGAGAAGGGGGATGG - Intronic
1152397067 17:80039933-80039955 AAGGGGAAGCAGCAGTGGAAGGG + Exonic
1152400763 17:80065046-80065068 GGGGAGAGGGAGGAGGGGGAGGG - Intronic
1152400796 17:80065129-80065151 AGGGAGAAGGGGGAGAGGGAGGG - Intronic
1152462436 17:80448650-80448672 AGGGAGGAGGAGAAGAGGGAAGG - Intergenic
1152474771 17:80510791-80510813 AGTGAGGAGCAGCATGGGGTTGG + Intergenic
1152601514 17:81264572-81264594 AGAGAGAAGCACCAGGGGCAGGG + Intronic
1152863420 17:82709116-82709138 TGGGGGATGGAGCAGGGGGAGGG - Intergenic
1153185255 18:2478918-2478940 AGGAAGAAGGAGGAGGAGGAGGG + Intergenic
1153284811 18:3448244-3448266 AGGGAGGAGGAGCCGGGGGCTGG - Intronic
1153333770 18:3901082-3901104 AGGGAGCAGCAGAAGGGAGTAGG - Intronic
1153463276 18:5361180-5361202 AGGGAGAAGAAGCAGGAGTATGG + Intergenic
1153509453 18:5835926-5835948 AGGGAGTAGAAGAAGAGGGAAGG + Intergenic
1153762448 18:8344913-8344935 AGGGAGAGGGAGGAGGGAGAAGG + Intronic
1153951493 18:10061383-10061405 AGGGGGAGGGAGCAGGGAGAGGG - Intergenic
1154339909 18:13494099-13494121 GGGGAGAAGGAGCAGGGCGGTGG + Intronic
1154980368 18:21498560-21498582 AGGGAGAGGAAGGAGTGGGACGG - Intronic
1155016800 18:21850495-21850517 AAGTAGAAGAAGCAGGGGCAAGG - Intronic
1155172179 18:23275167-23275189 AGGGAGGGGCAGCAGAGGGTGGG + Intronic
1155286483 18:24293864-24293886 GGGCAGAAGCTGTAGGGGGAAGG + Intronic
1155315134 18:24563740-24563762 ATGGAGACTCAGAAGGGGGACGG - Intergenic
1155377555 18:25176968-25176990 AGGCAGAAGGAGAAGGGGGCTGG - Intronic
1155546775 18:26923985-26924007 AGGGAGAGGCAGGAGGGGTTGGG + Intronic
1155853938 18:30808613-30808635 AGGGAGAAGAAGCAAAGGGTGGG + Intergenic
1155908223 18:31478005-31478027 AGGGAGGAGCACCAGGGTGGGGG - Exonic
1156160292 18:34350938-34350960 GGGCAGAGGCAGCAGGGGGCTGG - Intergenic
1156338386 18:36188803-36188825 AGGGAGAGTCAGGAGGGAGACGG + Intronic
1156361420 18:36387726-36387748 GTGGAGGAGCAGCAGGGAGATGG - Intronic
1156585644 18:38428073-38428095 AGGGAAAAGGAGAAGGAGGAAGG + Intergenic
1156609843 18:38713097-38713119 TGGGAGAGGCAACAGAGGGACGG + Intergenic
1157441777 18:47717158-47717180 ATGGATCAGCTGCAGGGGGAAGG + Intergenic
1157499021 18:48177224-48177246 AGGGTGAAGCAGGAGGGCGAGGG - Intronic
1157584642 18:48793247-48793269 AGGGAGAAGCAGGGAGGGGCAGG + Intronic
1158186713 18:54779913-54779935 AGGGAGAAGCAGTCAGGAGACGG - Intronic
1158428417 18:57360773-57360795 AGGGAGTAGTTGCAGAGGGAAGG - Exonic
1158610156 18:58932462-58932484 AAAGAGAAGCAGCAGGGGAGGGG + Intronic
1159402455 18:67955630-67955652 GGGGAGAAGGAGCAGGAGGGAGG + Intergenic
1159482224 18:69004293-69004315 AGGGAGAAGTAGGACTGGGAGGG + Intronic
1159916993 18:74196954-74196976 AGGGACAGGCAGCATGGGTAAGG + Intergenic
1160236954 18:77093288-77093310 TGGGAGCTGCAGCAGAGGGAAGG + Intronic
1160243236 18:77137532-77137554 AGGCACAGGCAGCAGGGGGTGGG - Intergenic
1160367306 18:78337436-78337458 AGGTAGGAGCAGCAGGAGGCCGG - Intergenic
1160511744 18:79456773-79456795 AGGGAGATGGACCCGGGGGATGG + Intronic
1160555739 18:79723801-79723823 AGGGAGGGACAGCAGGTGGAGGG - Intronic
1160583600 18:79901033-79901055 TGGGACAAGCAGCAGAGGGTGGG - Intergenic
1160611204 18:80086793-80086815 TAGGAGAAGCAGGATGGGGAGGG - Intronic
1160625541 18:80201840-80201862 AGGAAGCAGCAGCAGGGTGCTGG - Intronic
1160682428 19:417958-417980 AGGGAGGGCCGGCAGGGGGAGGG - Intronic
1160726725 19:620829-620851 AGGGAGAAGCAGGACGGGCAGGG + Intronic
1160925137 19:1540701-1540723 GGGGGGAGGAAGCAGGGGGACGG + Intergenic
1161031781 19:2061103-2061125 AGGGAGATGCGGCTGGGGGCGGG + Intergenic
1161254463 19:3299672-3299694 AAGGAGAAGGAGAAGGGGAAGGG - Intergenic
1161296504 19:3523094-3523116 GGGCAGAGGCAGCTGGGGGAGGG - Intronic
1161303015 19:3552027-3552049 AGGTAGAGGCAGCAGGGGCCAGG - Intronic
1161335001 19:3708346-3708368 AGGGAGACGGACCAGGGTGAGGG - Intronic
1161404011 19:4081829-4081851 AGGAAGGAGGAGCAGGGGGGAGG - Intergenic
1161513769 19:4685370-4685392 AGGGAGAGTCAGCAGGCGGAGGG + Intronic
1161650244 19:5479950-5479972 AGGGAAGGGCAGCAGGGAGATGG + Intergenic
1161684939 19:5697992-5698014 AGGAAGGAGCAGCTGGGTGAAGG - Intronic
1161810089 19:6466559-6466581 CGGGAGAAGCGGCAGACGGAGGG + Exonic
1161957941 19:7506664-7506686 AGGGAGGAGCTGGAGGAGGACGG - Intronic
1161994230 19:7702646-7702668 AGGGAGAAGGAGGAGTAGGAGGG + Intergenic
1162199090 19:9008380-9008402 AGGGAGAGGCAACTGGGAGATGG + Intergenic
1162237763 19:9321834-9321856 AGGGGGAAGGAGCGGGGGGTAGG - Intergenic
1162363591 19:10234164-10234186 AGGGAGAGGAACCAGGGGGCAGG + Intergenic
1162798465 19:13098497-13098519 AAGGAGGAGGAGCAGAGGGAGGG - Intronic
1162984119 19:14258384-14258406 CAGGAGGAGGAGCAGGGGGAAGG - Intergenic
1163105781 19:15122435-15122457 AGGGAAAAGGAGGAGGAGGAGGG + Intronic
1163198231 19:15741448-15741470 AGGCAGGAGCTGCTGGGGGAAGG - Exonic
1163260805 19:16188759-16188781 AGGGAGAATCAGCCAGGTGAGGG + Intronic
1163365502 19:16873768-16873790 AGGGAGATGCAGCTGGGGTGTGG - Intronic
1163411775 19:17159353-17159375 AGGGAGAAGGAAAAGGGAGATGG - Intronic
1163455446 19:17403577-17403599 AGAGAGAGGCTGCAGGGGAAGGG - Intronic
1163534332 19:17868605-17868627 TGGGAGATGCAGCAGGGGTTGGG - Intergenic
1163630953 19:18417691-18417713 CGGGAGAGGAAGCTGGGGGAAGG + Intergenic
1163712048 19:18852713-18852735 AGGGAGCAGCTGCTGTGGGAGGG - Intronic
1163764204 19:19153360-19153382 AGGGACAAGAAACAGCGGGAGGG + Intronic
1163833180 19:19557524-19557546 AGGAGGAAGCAGCAGGGCGGGGG - Intergenic
1164464009 19:28472216-28472238 AGGGAGAAGCCACAGGGGAGGGG - Intergenic
1164471785 19:28542228-28542250 TGGGAGACTCAGAAGGGGGAGGG + Intergenic
1164615298 19:29664006-29664028 AGAGGGGAGCAGCGGGGGGAGGG - Intergenic
1164680415 19:30130788-30130810 AGGGAGAAGGAGAGGGAGGAAGG - Intergenic
1164696578 19:30249343-30249365 GAGGAGAAGGAGGAGGGGGAGGG + Intronic
1164788018 19:30952207-30952229 AGGAAGAAGCAAAAGAGGGAGGG - Intergenic
1164934677 19:32201565-32201587 AAGGAGAATCAGCAGGGTGGAGG + Intergenic
1165069898 19:33249106-33249128 TGGGAGAAGCAGCAGGCGGGGGG + Intergenic
1165112559 19:33510902-33510924 AGGGAAGAGCTGCAGGAGGAAGG - Intronic
1165416021 19:35694056-35694078 AGGGAGGAGGAGGAGGGAGAAGG - Intergenic
1165416029 19:35694079-35694101 AGGGAGAAGGAGGAGGGAGGAGG - Intergenic
1165434183 19:35787647-35787669 GGGGAGAAGAAGCCGGGGGTAGG - Exonic
1165773201 19:38389971-38389993 AGGGATAAGCAGGAGGGGGAGGG + Intronic
1166108860 19:40610869-40610891 ATGGAGAAGCAGAATGAGGAGGG + Intronic
1166140367 19:40802158-40802180 CAGGAGAAGCAGAAGGGGGAGGG + Intronic
1166156961 19:40920986-40921008 AGGGTGAAGCACCAGTGGGGAGG - Intergenic
1166156997 19:40921225-40921247 AGGGTGAAGCACCAGTGGGGAGG - Intergenic
1166502450 19:43352344-43352366 GAGGAGAAGCAGAAGAGGGAAGG - Intergenic
1166591153 19:44000483-44000505 AGGCAAAAGCAGTAGGAGGAGGG + Intergenic
1166652133 19:44582654-44582676 AAGGAGAAGGAGAAGGGGAAAGG + Intergenic
1166674947 19:44734657-44734679 AAGGAGAAGGAGAAGGGGAAGGG - Intergenic
1166772803 19:45294459-45294481 AGGGGGCAGCAACAGGGTGAGGG + Intronic
1166864970 19:45830310-45830332 CTGGAGAGGCAGCAGGGGGATGG - Intronic
1166888478 19:45975372-45975394 AGGGAGGAGCAGGGGGGGGTTGG - Intergenic
1167019176 19:46861312-46861334 ATGGAGGAGCTGGAGGGGGAGGG + Intergenic
1167129252 19:47573402-47573424 GGGGAGGAGCGGCGGGGGGAGGG + Intergenic
1167419686 19:49395585-49395607 ATGGAAAAGCAGGAGGGGCAAGG - Intronic
1167462958 19:49635996-49636018 AGGGAGATGCCGCAGGGGCTTGG + Intronic
1167579069 19:50331484-50331506 AAGGGGAAGAAGAAGGGGGAGGG - Intronic
1167608262 19:50493215-50493237 AGGTAGAAGGAGAATGGGGAGGG + Intergenic
1167622036 19:50566072-50566094 AGGGAGGAGGAGGAGGAGGAAGG + Intronic
1167671719 19:50857348-50857370 AGGAGGAAGGAGAAGGGGGAAGG + Intronic
1167698281 19:51027398-51027420 AGGGAGAAGCGGGCAGGGGAAGG - Intronic
1167702107 19:51054956-51054978 AAGGAGAAGGAGAAGGGGAAGGG - Intergenic
1167775643 19:51553004-51553026 AAGGAGGAGGAGGAGGGGGAGGG + Intergenic
1168102400 19:54148231-54148253 AGGCAGAGGCAGCAGGCGGGGGG - Exonic
1168251574 19:55145314-55145336 AAGGAGAAGGAGAAGGGGAAGGG + Intronic
1168290102 19:55353399-55353421 ATGGAGAGGGAGAAGGGGGACGG + Intronic
1168299020 19:55392879-55392901 AGGGAAAAGGAGCAAGGGGGAGG - Intronic
1168338342 19:55609633-55609655 ACTGAGGAGCAGCATGGGGAAGG - Intronic
1168338376 19:55609808-55609830 AGAGAGAAGCATGATGGGGAGGG - Intronic
1168471225 19:56642805-56642827 AGGGAGAAGGAGCTGGGGCAGGG - Intergenic
1168657670 19:58142826-58142848 AGGGAGAAGGAGAAAGGGGTTGG - Intronic
925034238 2:673732-673754 AGGGAGGAGGAGGAGGAGGAGGG + Intronic
925078154 2:1037161-1037183 AGAGAGAAGCAGAAGGCAGATGG - Intronic
925148612 2:1599801-1599823 AGGGAGCAGCAGGAAGAGGAGGG - Intergenic
925156426 2:1651768-1651790 AGAGAGAAACAGCAGGCGGGAGG - Intronic
925402566 2:3586028-3586050 AGGAAAAAGGAGGAGGGGGAAGG + Intergenic
925434772 2:3827294-3827316 AAGGGGAGGCAGCAGGGGCAGGG + Intronic
925609924 2:5693850-5693872 AGCGAGCAGCAGCTGGGGGGCGG + Exonic
925704826 2:6674381-6674403 AGGGAGATGCAGCATTGGGAGGG + Intergenic
925755513 2:7128306-7128328 AGGGAGAAAGGGGAGGGGGAAGG - Intergenic
925920331 2:8633639-8633661 AGGGGGACGAAGGAGGGGGAAGG - Intergenic
925957051 2:8977040-8977062 AGGGAGAGGCAGGAGGGAGACGG + Intronic
926173695 2:10570205-10570227 AGAGAGCAGAGGCAGGGGGACGG + Intergenic
926174707 2:10580378-10580400 AGGGAAAAGAAGCAGGGGCGGGG - Intronic
926400975 2:12496337-12496359 AGGGAGAATAAGCATGGGAAAGG - Intergenic
926558306 2:14386564-14386586 GAGGAGAAGCAGGAGGGGGAGGG + Intergenic
926916460 2:17896697-17896719 AGGGAGAAGAAGCTGGCAGAAGG - Intronic
927212619 2:20647981-20648003 AGGGAGCAGCTGCAGGCTGATGG - Intronic
927659514 2:24981045-24981067 AGAGAGAAGAAGGAGGGGGAGGG + Intergenic
927684666 2:25161977-25161999 AGGCAGAAGCATGAAGGGGATGG - Intronic
927705634 2:25294873-25294895 AGGGAGGAGGAGGAGGGGGCTGG - Intronic
927729930 2:25462276-25462298 AGGGACAGGGAGCAAGGGGACGG + Intronic
927866177 2:26589153-26589175 AAGGAGAAGGAGAAGGGGAAGGG - Intronic
928078149 2:28284236-28284258 TGGGACAGGCAGCAGGGGAATGG - Intronic
928108444 2:28488178-28488200 AAGGAGGAGAAGGAGGGGGAGGG + Intronic
928713982 2:34039109-34039131 AGAGGGAAGAAGGAGGGGGAAGG - Intergenic
928823592 2:35392018-35392040 AGGCCGAGGCAGCAGGGGGCTGG + Intergenic
928924968 2:36568163-36568185 AGGGAGAGACAGAAGGGGTAGGG + Intronic
928950176 2:36807137-36807159 AGGGAGAAGGACCAGATGGAGGG - Intronic
929347230 2:40899666-40899688 AAGGAGAAGCATCAGGGGTAAGG - Intergenic
929590563 2:43143064-43143086 AGGCAGCAGCAGCAGCAGGAGGG - Intergenic
929600512 2:43201568-43201590 AGGGGGCAGCAGCTGGGGGTTGG - Intergenic
929756946 2:44774924-44774946 AGGGAAAATCAGCAAGGGGCGGG - Intergenic
929778265 2:44941960-44941982 AGGGGGGAGCAGGAGGAGGAGGG - Exonic
929794171 2:45046330-45046352 AGGGAGAAGTTTCAGGAGGAGGG + Intergenic
929956179 2:46460361-46460383 AGGTGGCAGCAGCAGGGGGAGGG + Intronic
930070504 2:47362311-47362333 GGGGAGAAGGAGCAGGGTGCAGG - Intronic
930087780 2:47510135-47510157 AGCAAGAAGTAGCAGGGAGAAGG - Intronic
930725334 2:54676146-54676168 ATGGAGATGAGGCAGGGGGAAGG - Intergenic
930741254 2:54835035-54835057 AGGGAGAAGCAGCGAGGGGAAGG - Intronic
930838999 2:55825434-55825456 AGTGAGGAGTAGCAGGGGCAGGG - Intergenic
931183475 2:59927054-59927076 AGTGAGAAGCAGGAGGGGGTAGG + Intergenic
931427296 2:62182869-62182891 AGGGAAAAGGAGCAGGGTGGTGG - Intergenic
931771365 2:65500829-65500851 ACGGAGAAGCAGCAGATGAAAGG - Intergenic
931826301 2:66004196-66004218 AAGGAGAAGGAGAAGGGGAAGGG - Intergenic
931967677 2:67551338-67551360 AAGGAGAAGCAACAAGGAGAAGG + Intergenic
932084555 2:68746663-68746685 AGGGAGAAGGGGCATGGGCATGG + Intronic
932091961 2:68813830-68813852 AGGGAGAAGAAGGACAGGGAGGG + Intronic
932741307 2:74293060-74293082 AGGGTGAAGCAGAGGGGGCAGGG + Intronic
933158849 2:79002416-79002438 AGAGAGAGCCAGTAGGGGGAAGG + Intergenic
933190393 2:79327795-79327817 ATGCAGAAGGGGCAGGGGGATGG + Intronic
933354825 2:81197534-81197556 AGGGAAAAGCTCCGGGGGGATGG - Intergenic
933574785 2:84055142-84055164 AGTGAGGAGCAGCAGGGTCAGGG - Intergenic
933761494 2:85675338-85675360 AGGGAGAAAGAACAGAGGGAGGG + Intergenic
933787419 2:85854485-85854507 AGGGAGAAGGGGCAGGGAGCGGG + Intronic
933938754 2:87228102-87228124 AGAGAGAAGCAGGAGGCGGCTGG - Intergenic
934482877 2:94669661-94669683 AGGTAGATGCATCAGGAGGAGGG - Intergenic
934579906 2:95429701-95429723 AGGGAGAAGTAGATGGGAGAAGG - Intergenic
934599541 2:95647024-95647046 AGGGAGAAGTAGATGGGAGAAGG + Intergenic
934653267 2:96104233-96104255 AGGGAGAGGAAGGAGGAGGAGGG - Intergenic
934654446 2:96109962-96109984 AGGGAGTGGCAGTGGGGGGAAGG + Intergenic
934779648 2:96961448-96961470 AGGGAGCAGAATCAGAGGGAGGG + Intronic
934942649 2:98513764-98513786 AGGGAGGGGCAGCAGGGACAAGG - Intronic
936154106 2:110037169-110037191 AAGGGGAAGAAGCAGAGGGAGGG - Intergenic
936190578 2:110334246-110334268 AAGGGGAAGAAGCAGAGGGAGGG + Intergenic
936354382 2:111737673-111737695 AGAGAGAAGCAGGAGGCGGCTGG + Intergenic
936447462 2:112607243-112607265 AGGGAGAAGGAGGAAAGGGAAGG - Intergenic
936532880 2:113289032-113289054 AGGGAGAAGTAGATGGGAGAAGG + Intergenic
936580027 2:113691493-113691515 ATGGAGACTCAGAAGGGGGAGGG - Intergenic
936659240 2:114523805-114523827 TGGGATGAGCAGCAGGTGGAGGG - Intronic
936768091 2:115877985-115878007 AGGGAGAAGGAGAAGGAGAAAGG - Intergenic
936832835 2:116669860-116669882 AAGGAGAAGGAGAAGAGGGAAGG - Intergenic
937130905 2:119512334-119512356 AAGGAGAAGGAGAAGGGGAAGGG - Intronic
937148906 2:119672395-119672417 AGGCAGAAGGAGCCAGGGGAAGG + Intergenic
937217302 2:120321079-120321101 AGGGAGAAGGAGGAGGGAGAAGG - Intergenic
937217306 2:120321092-120321114 AGGGAGAAGGAGGAGGGAGAAGG - Intergenic
937217315 2:120321121-120321143 AGGGAGAAGGAGGAGGGAGAAGG - Intergenic
937217377 2:120321294-120321316 AGGGAGAAGGAGGAGGAGGGAGG - Intergenic
937217392 2:120321339-120321361 AGGGAGAAGAAGGAGGGAGAAGG - Intergenic
937339362 2:121081359-121081381 AGGGAGAGGAAGTAGGGGGTAGG - Intergenic
937483099 2:122283199-122283221 AGGAAGAAGAAAAAGGGGGAGGG - Intergenic
937688524 2:124725465-124725487 AGGGGGAAGGAGGAAGGGGAAGG - Intronic
937743712 2:125386501-125386523 ATGGGGAACCAGAAGGGGGAAGG + Intergenic
938165115 2:129019352-129019374 AGGGAGAGTCAGCAGAGAGAAGG + Intergenic
938258331 2:129877711-129877733 AGGGCGAAGCAGGGAGGGGAGGG + Intergenic
938291854 2:130154809-130154831 AGGGAGAAACAGCGGGGTCACGG + Intronic
938371508 2:130771523-130771545 AGGCTGAAGAAGCTGGGGGATGG + Intergenic
938407290 2:131039674-131039696 AGCGGGCAGAAGCAGGGGGATGG - Intronic
938804802 2:134796313-134796335 GGGGAGAAGGAGCAGGGAGCGGG - Intergenic
938813937 2:134880403-134880425 AGAGAGAAAAAGCAGAGGGAAGG - Intronic
938836046 2:135105219-135105241 AGGGGGGAGCGGGAGGGGGAAGG - Intronic
940011534 2:149060019-149060041 AGGGAGAAGGAGGAGGAGGAGGG + Intronic
940412114 2:153377167-153377189 GGGGAGAGGCAGCAAGAGGATGG + Intergenic
940581335 2:155584452-155584474 AGTGAGGAGTAGCAGGGGCAGGG - Intergenic
940795899 2:158078627-158078649 TGGGAAGAGTAGCAGGGGGATGG + Intronic
940900694 2:159123930-159123952 TGGGAAAAACAGCAGCGGGAGGG - Intronic
941038211 2:160590557-160590579 AGGGGGAAGAGGAAGGGGGAGGG - Intergenic
941038253 2:160590654-160590676 AGGGAGGAGGGGAAGGGGGAGGG - Intergenic
941110539 2:161415606-161415628 AGCGACAAGCAGAAGGGGGGAGG - Intergenic
941712752 2:168731615-168731637 AAGGAGAAGTAGCAGGGGGTGGG + Intronic
941819296 2:169828166-169828188 AGGGTGCAGCCACAGGGGGATGG + Intronic
942276274 2:174326303-174326325 AGGGATTCGCAGCAGGGGGTGGG - Intergenic
942632941 2:177971636-177971658 AGAGAGAAGGAGATGGGGGAAGG + Intronic
942686955 2:178542836-178542858 AGGAAGCAGCAGGAGGTGGACGG + Exonic
943354811 2:186839878-186839900 AGGGGGAAGCAGCAAAGGGATGG - Intronic
943635412 2:190301475-190301497 AGGGAGAGGGAGTTGGGGGAAGG + Intronic
944221801 2:197310727-197310749 GCGGAGGAGGAGCAGGGGGAGGG - Exonic
944260927 2:197676062-197676084 AGAGAGAGGCAGTAGGGGGGTGG + Intergenic
944269487 2:197765176-197765198 AGGGAGAAGGAGTAGGAAGAGGG + Intronic
944395750 2:199264071-199264093 AGGAAGAAGGAACAGGAGGAAGG + Intergenic
944450704 2:199839176-199839198 AGGCAAAAGCAACAGGGTGAAGG + Intronic
945431462 2:209770975-209770997 AGGAAGAAGGAGAAGGAGGAGGG + Intergenic
945831778 2:214795912-214795934 AGGGATATCCAGCAGGAGGATGG - Intronic
945987532 2:216367315-216367337 AGAGAGAAGGAGGAGGAGGAGGG - Intronic
946053205 2:216880819-216880841 GTGGGGAAGCAGAAGGGGGAGGG - Intergenic
946054511 2:216889114-216889136 AGGGAGAGACAGCAGGGGAGGGG + Intergenic
946160461 2:217832609-217832631 TGGGGAAAGCAGCAGGGGCAGGG - Intronic
946192578 2:218015340-218015362 AGGGAGAGGAGGGAGGGGGAGGG + Intergenic
946313614 2:218896261-218896283 AGGGAAAAGTAGGAGGAGGAAGG + Intronic
946650443 2:221887483-221887505 AGGGAGAAGAAGAATGGGTAGGG + Intergenic
946993640 2:225365159-225365181 GAGGAGAAGCAGCAGGGGTGAGG - Intergenic
947029942 2:225782598-225782620 AGGGAGAAACAGAGGGAGGAAGG - Intergenic
947165216 2:227254940-227254962 AGAGAGAAGCAGAAGTGAGATGG - Intronic
947445095 2:230157167-230157189 AAGAGAAAGCAGCAGGGGGAAGG - Intergenic
947488399 2:230573130-230573152 AGGGAGGAGCAGCAGCAGGGTGG + Intergenic
947610944 2:231524876-231524898 AGAGGGAAACAGCAGGAGGAGGG - Exonic
947632581 2:231663571-231663593 GGGGAGAAGCAGCTGGGGCCTGG + Intergenic
947811160 2:233004719-233004741 GGGGAGAGGGAGCAGGGGGAAGG - Intronic
947837735 2:233187812-233187834 AGGGAGGAGGAGCAGGAGGACGG - Intronic
947984415 2:234436672-234436694 AGGGAGAAGGAGCAGGGACTCGG - Intergenic
948021902 2:234740368-234740390 AGGGAGTGGCGGCAAGGGGAGGG + Intergenic
948254305 2:236554778-236554800 AGAGAGATACAGCAGGAGGAAGG - Intergenic
948344339 2:237282679-237282701 AAGGAGAAGGGGAAGGGGGAGGG + Intergenic
948364765 2:237447726-237447748 AGGGAGAAACAGCAGCGGCCTGG + Intergenic
948539004 2:238672376-238672398 AAGGAGAAGGAGAAGGGGAAGGG - Intergenic
948558568 2:238835269-238835291 AGGGAGAAGGAGAAGGGGAAGGG - Intergenic
948558594 2:238835350-238835372 AAGGAGAAGGAGAAGGGGAAGGG - Intergenic
948577651 2:238965004-238965026 AGGGGGAAGCAGGAGGGAGGAGG - Intergenic
948577664 2:238965038-238965060 GGGGAGAAAAAGCAGGGGGGAGG - Intergenic
948586107 2:239020764-239020786 AGAGGGAGGCAGGAGGGGGACGG - Intergenic
948735729 2:240003769-240003791 GATGAGAAGCAGCAGGGGGTGGG + Intronic
948912684 2:241012218-241012240 GGGGAGAAGCATCTGGGGGCAGG - Intronic
948958965 2:241316558-241316580 ACGGACAGGCAGCAGGGGGTAGG + Intronic
1168904345 20:1391813-1391835 AAGGGGAAGGAGGAGGGGGAGGG + Intronic
1169541089 20:6600496-6600518 AGAGAAAAGCAGAAGGGGGTAGG + Intergenic
1169765574 20:9144661-9144683 AAGGAGGAGGAGGAGGGGGAAGG + Intronic
1169808234 20:9581237-9581259 AGGTAGAAGAAGTAGGGGGAAGG - Intronic
1169945010 20:10978959-10978981 AGGGAGACGGGGCAGGGGGAGGG - Intergenic
1170007761 20:11687229-11687251 AGGGGAAAGCAGCATGGGGTGGG - Intergenic
1170532637 20:17309847-17309869 AGGAAGAAGAAGAAGGGGAAGGG + Intronic
1170579238 20:17685244-17685266 AAGGAGAAGGAGAAGGGGAAGGG + Intergenic
1170830314 20:19833924-19833946 GGGGACAAGCAGGAGGGGGCAGG - Intergenic
1171145733 20:22780529-22780551 AGAGAGAAGCAGCATGGTCAAGG - Intergenic
1171523213 20:25791472-25791494 AGGAAGAAACTGCAGGTGGAGGG - Intronic
1171530956 20:25853452-25853474 AGGAAGAAACTGCAGGTGGAGGG - Intronic
1171553613 20:26064411-26064433 AGGAAGAAACTGCAGGTGGAGGG + Intergenic
1171768390 20:29302153-29302175 AGGGATAAGCTGGGGGGGGAAGG + Intergenic
1171778495 20:29394603-29394625 ATGGAGACTCAGCAGGGTGAGGG + Intergenic
1171820265 20:29829893-29829915 AAGGAGACTCAGCAGGGTGAGGG + Intergenic
1171822552 20:29867053-29867075 ATGGAGACTCAGCAGGGTGAGGG + Intergenic
1172008284 20:31831978-31832000 GGGGAGAGGCAGCATGGTGACGG - Intronic
1172038694 20:32028779-32028801 AGGAAGAAGGAGAAGGGGGGTGG + Intronic
1172292169 20:33784222-33784244 AGGGAGATGGGGGAGGGGGAAGG - Intronic
1172460504 20:35114767-35114789 AGTAAGAAGCAGCCGGGGCATGG + Intergenic
1172580828 20:36046549-36046571 AGGGAGAAGAGGAAGGGTGAAGG - Intergenic
1172621694 20:36321694-36321716 TGGGAGAACGAGCATGGGGAGGG + Intronic
1172719513 20:36988862-36988884 AGGAAGAGAGAGCAGGGGGAGGG - Intergenic
1172808301 20:37629215-37629237 AGAGGGAAGCAGGAGAGGGAAGG + Intergenic
1172836043 20:37873856-37873878 AGGGAGCAGCAAGAGGGGCAGGG - Intergenic
1172939322 20:38643836-38643858 AAGGAGAAGCAGCTGGCAGAAGG + Exonic
1172949824 20:38715779-38715801 GGTGAGATGCAGGAGGGGGAGGG - Intergenic
1173010341 20:39176355-39176377 AGGGGGAACCAGCAGGTGCAAGG - Intergenic
1173335977 20:42112698-42112720 AGGGAGAGTTTGCAGGGGGAAGG - Intronic
1173336135 20:42113685-42113707 AGTGGGAAGCAGGAGAGGGAAGG - Intronic
1173443141 20:43095684-43095706 AGAGAGAGGAAGCAGGGAGAGGG - Intronic
1173556984 20:43973288-43973310 CAGGAGAAGCAGCCGGAGGAGGG - Intronic
1173670993 20:44798815-44798837 AGGGAGACGCAGCATGGGGCAGG - Intronic
1173775128 20:45698985-45699007 AAGGAGGAGAAGGAGGGGGAGGG + Intronic
1173821227 20:46021885-46021907 AGGTAGAGGCCGCAGGGGGCGGG + Exonic
1173876630 20:46376415-46376437 AGGGAGAGTCAGGAGGGAGAGGG - Intronic
1173896471 20:46554868-46554890 AGGGAGGAGGAGCATGGGGAGGG - Intergenic
1173906270 20:46631989-46632011 AGGGAGCTGGGGCAGGGGGAAGG - Intronic
1173969643 20:47142267-47142289 AGGGAGAAGCACCTCAGGGAGGG + Intronic
1174150375 20:48482158-48482180 GAGGAGGAGGAGCAGGGGGAAGG + Intergenic
1174417376 20:50376551-50376573 AAGGCGAAGCAGCTGGGAGAGGG + Intergenic
1174515338 20:51087804-51087826 AGGGACCAGCAGCATGGGGATGG - Intergenic
1174580523 20:51568311-51568333 AGGGAGAATTGGCAGGGGGTGGG - Intergenic
1174617085 20:51843874-51843896 AGGGATAAGGAGCAGAGTGAGGG + Intergenic
1174707243 20:52669418-52669440 TGGGAGAAGCAGCCCAGGGAAGG + Intergenic
1174970642 20:55271436-55271458 TGGGAGAAGCAGACCGGGGAAGG - Intergenic
1175055170 20:56191305-56191327 AGGCAGAGCCAGCAGGAGGACGG + Intergenic
1175134798 20:56815151-56815173 AGAGAGGAGGAGGAGGGGGAGGG + Intergenic
1175477366 20:59286325-59286347 AGGGCCCAGCAGCTGGGGGAAGG + Intergenic
1175600296 20:60267348-60267370 AGTGAGATGGAGCAGGGGAAAGG + Intergenic
1175644421 20:60658825-60658847 TCGGGGGAGCAGCAGGGGGAGGG + Intergenic
1175774147 20:61642307-61642329 ATGGGGAACCAGCAGGTGGATGG + Intronic
1175813334 20:61870512-61870534 AGGGACATGCAGAAGGTGGAGGG - Intronic
1175873168 20:62217817-62217839 AGGGAGAGACCACAGGGGGATGG + Intronic
1175931864 20:62497321-62497343 GGAGAAAAGCACCAGGGGGAGGG + Intergenic
1176098916 20:63356231-63356253 AGGGTGGGGCAGCAGGGTGAGGG + Intronic
1176146715 20:63568718-63568740 AGGGCCAAGCAGCAGCGGGCCGG + Exonic
1177507230 21:22034750-22034772 AAGGAGGAGGAGGAGGGGGAAGG - Intergenic
1177610518 21:23441857-23441879 AGTGGGAAGTAGCAGAGGGAAGG - Intergenic
1177905492 21:26967267-26967289 AGGGAGACGAAGTAGGAGGAAGG + Intergenic
1178467143 21:32858944-32858966 AGGCTGAGGCAGCAGGGGGCTGG + Intergenic
1178584721 21:33862480-33862502 TGGGAGAAGGAGAAGAGGGAAGG + Intronic
1178600686 21:33991987-33992009 AGGGAGAAGCAGAAAGGTGCAGG + Intergenic
1178632367 21:34273723-34273745 AGGGAGATGCACCAGGGGAAAGG - Intergenic
1179197849 21:39182996-39183018 AGGGTGAAGCCGCTGTGGGAGGG - Intronic
1179562967 21:42228422-42228444 GGGGAGGAGGAGCAGGGAGAGGG - Intronic
1179801909 21:43815200-43815222 AGGGCGTGGCAGCAGGGGAAAGG + Intergenic
1179812987 21:43884264-43884286 AGGGGGAAGGAGGAGGGGGAAGG - Intronic
1179812993 21:43884277-43884299 GGAGAGAAGGAGGAGGGGGAAGG - Intronic
1180190467 21:46160445-46160467 AGGGAGATGACCCAGGGGGAGGG + Intergenic
1180500514 22:15924959-15924981 AGGGAGAAACACCAGGGGCTGGG - Intergenic
1180957947 22:19749627-19749649 AGAGAGAATCAGCAGGGTGCAGG + Intergenic
1181522654 22:23458554-23458576 AGGCAGCAGAAACAGGGGGAGGG + Intergenic
1181622454 22:24100421-24100443 AGGGAGAAGCAGCAGATTGCTGG + Intronic
1181860334 22:25813133-25813155 AGGAAGAAGGAGGAGGAGGAGGG - Intronic
1181905977 22:26196748-26196770 AGGGAGAAGCAACAGGTTCAAGG + Intronic
1181937304 22:26448169-26448191 AGGGAGAAGGACCTGGGGGCCGG - Intronic
1181977188 22:26738401-26738423 AGGGAGAGGGAGAAGGGGAAGGG - Intergenic
1182550033 22:31095943-31095965 AGAGAGGAGCAGCAGGGAGAAGG - Intronic
1182694349 22:32186533-32186555 AGGGAGGGGCTGCAGGGAGAGGG - Intergenic
1182886410 22:33777672-33777694 AAGGAGAAGGAGAAGGGGAAGGG + Intronic
1182931479 22:34178311-34178333 AAGGAGAAGGAGGAGGAGGAGGG - Intergenic
1183097545 22:35562212-35562234 AGGGAAAGGCAGAGGGGGGAGGG + Intergenic
1183153088 22:36053514-36053536 AGGGAGAAGCAGGGAAGGGAAGG - Intergenic
1183299545 22:37052076-37052098 GGGAAGAAGCGGCAGGAGGAGGG + Intronic
1183315612 22:37135454-37135476 TGGGAGAAACAGCAAGGAGAGGG + Intronic
1183339871 22:37274199-37274221 AAGGGGGAGCAGCAGAGGGATGG - Intergenic
1183671587 22:39276053-39276075 AGGTAGAAGCAGCAGGTGGCCGG + Intergenic
1183784907 22:40023666-40023688 AGAGAGCGGCAGCAGGGGCAGGG - Intronic
1184285227 22:43466862-43466884 AGGGACAATCAGGAGGTGGAGGG - Intronic
1184449734 22:44575843-44575865 AGGGAGAAAGAGGAGGAGGAGGG + Intergenic
1184591017 22:45483367-45483389 ATGTAGCAGCAGCAGTGGGAAGG - Intergenic
1184757687 22:46526161-46526183 ATGGAGGAGCAGGAGGCGGACGG - Intronic
1184986294 22:48137869-48137891 AGGGAGGAGCTGCAGGGGTGTGG - Intergenic
1185006286 22:48278732-48278754 AGGGTGAGGCAGCAGGGCAAAGG + Intergenic
1185009433 22:48304996-48305018 ACGGAGATGCAGCAGGGGGTGGG + Intergenic
1185229812 22:49673560-49673582 AGGGGGAAGGGGAAGGGGGAGGG + Intergenic
1185229842 22:49673620-49673642 AGGGAGAGGGGGAAGGGGGAGGG + Intergenic
1185292290 22:50033107-50033129 AGTGAGAAGCAGCACGGGCAGGG - Intronic
1185325107 22:50221702-50221724 AGGGGGCTGCAGCAGGCGGAGGG - Exonic
1185330489 22:50250028-50250050 ACGGAGGAGCAGCCAGGGGAAGG + Intronic
949122397 3:402417-402439 AGAGAGTAGCAGAAAGGGGAAGG - Intronic
949366267 3:3284995-3285017 AAGGAGAAGGAGAAGGGGAAGGG - Intergenic
949597726 3:5565510-5565532 AGGAAGAGGAATCAGGGGGAGGG - Intergenic
949758327 3:7439483-7439505 AGACAGAAGCAGCATGGGCAGGG - Intronic
949931638 3:9083142-9083164 ATGGGGAAACATCAGGGGGAGGG - Intronic
950439449 3:13000645-13000667 AGGTATATGCAGCAGAGGGAAGG + Intronic
951217821 3:20040840-20040862 AGGTGGAAGCGGGAGGGGGAGGG - Intronic
951684142 3:25325705-25325727 AGGGAGAAGAACCAGTGGCATGG - Intronic
952107540 3:30087596-30087618 GGGGAGGAGGAGGAGGGGGAGGG - Intergenic
952339086 3:32430342-32430364 AGGCATAAGCAGAATGGGGATGG - Intronic
952428068 3:33195398-33195420 GGGGAGAAACTGCTGGGGGATGG + Intronic
952597466 3:35035458-35035480 AGGGGAAAACAGCAAGGGGAAGG + Intergenic
953037252 3:39223736-39223758 GGGGATAAGGAGCAAGGGGAGGG + Intergenic
953261079 3:41339498-41339520 TGGGAGAAGCAGGAGAGGGGAGG - Intronic
953365442 3:42340504-42340526 GGGGAGGAGGAGCAGGGAGAGGG + Intergenic
953592211 3:44269348-44269370 AGGGAGGAGAAGGAGGAGGAGGG - Intronic
953916138 3:46922328-46922350 AGGGAGAAGCAGGAAGGTGAAGG + Intronic
954212066 3:49103545-49103567 AGTGAGAAGGAGGTGGGGGAAGG - Intronic
954322297 3:49840424-49840446 GGGGAGCAGCAGGAGGGGGCAGG - Intronic
954411579 3:50373518-50373540 AGGGGGAGGGAGGAGGGGGATGG + Intronic
954413693 3:50382498-50382520 AGGGAGTGGGAGCAGGGGGCAGG - Intronic
954501957 3:51025785-51025807 AAGTAGAAGCAACAGTGGGAAGG - Intronic
954649660 3:52153485-52153507 AGGGAGGAGCAGCTGGGGGAGGG + Intronic
954699781 3:52445199-52445221 AAGGAGAAGCGGCAGGTGGACGG - Intergenic
954876509 3:53806143-53806165 AGGGAAAAGAAGGAGGAGGAGGG - Intronic
955411634 3:58659216-58659238 AGCGAGAGGCAGCAGAGTGAAGG - Intronic
955602700 3:60664433-60664455 AGGAAGAGGAAGAAGGGGGAGGG - Intronic
955768361 3:62367936-62367958 AGGAAGACGCAGCCAGGGGAGGG - Intergenic
956182707 3:66532452-66532474 AGGGACAATCAGGAGGGAGAAGG - Intergenic
956324172 3:68032648-68032670 AGAGAGAAGGAGGAGTGGGAAGG - Intronic
956728013 3:72172414-72172436 AGGGAGAAGGAGGAGAGGGGAGG + Intergenic
956737619 3:72250195-72250217 GGGGAGAAGCAGGAGGAGGCTGG + Intergenic
956784427 3:72630576-72630598 GGGGAGAAGCAGAAGGAAGAAGG + Intergenic
957057200 3:75452867-75452889 AGAGTGAAACAGCAGAGGGATGG - Intergenic
957086661 3:75685952-75685974 ATGGAGACACAGCAGGGTGAGGG - Intergenic
957593119 3:82225707-82225729 AGTGAGGAGTAGCAGGGGCAGGG + Intergenic
957822853 3:85400769-85400791 AGGGACAAGACGCAGGCGGAGGG + Intronic
958114342 3:89196020-89196042 TGGGAGAAGGAGGAAGGGGAAGG - Intronic
959243426 3:103830064-103830086 AAGGAGAAGAAGAAGGAGGAAGG - Intergenic
959435850 3:106314379-106314401 AGGGAGCAGGAGAAGGGTGAAGG - Intergenic
959963814 3:112332219-112332241 AAGGAGGAGGAGGAGGGGGAGGG + Intergenic
959989647 3:112616761-112616783 ATGGAGAAGCAGAAGAAGGAGGG - Exonic
960062824 3:113340902-113340924 TGGGAGAACCAGAAGGGAGATGG + Intronic
960420315 3:117437273-117437295 AAGAAAAAGCAGCAGGGGAAGGG + Intergenic
960447210 3:117763190-117763212 AGAGAGAAGCAGAGAGGGGAAGG + Intergenic
960510272 3:118541223-118541245 AGAAAGAAGCAGGAGGGGCAGGG + Intergenic
960758766 3:121049390-121049412 AGTGAGAAGTAGCAGGGGTGGGG + Intronic
960987021 3:123287371-123287393 AGGGAGAAGCAGCTCAGCGAAGG - Intronic
960996899 3:123346185-123346207 TGGGAGAAGCAGCAGGGAAATGG + Intronic
961006690 3:123410309-123410331 GGGGAGGAGGAGGAGGGGGATGG - Intronic
961296253 3:125886868-125886890 AGAGTGAAACAGCAGAGGGATGG + Intergenic
961345354 3:126260357-126260379 GGGGAGAAGGAAGAGGGGGAGGG - Intergenic
961355750 3:126339045-126339067 AGGGTGGAGCAGCAGGGCCAAGG + Intergenic
961660270 3:128464936-128464958 AGGGAGAAGGGGGAAGGGGAGGG - Intronic
961688131 3:128649772-128649794 AATGAGAAGCAGCAGGGGGAAGG + Intronic
961889539 3:130119232-130119254 AGAGTGAAACAGCAGAGGGATGG - Intergenic
962246398 3:133797929-133797951 AGGGAGAAGGGGAAGGGTGAAGG + Intronic
962256900 3:133877230-133877252 AGGGAGATGCAGAAAGGGAATGG + Intronic
962285724 3:134084358-134084380 AGGGAGAGGCAGCCTGGGAAGGG + Intronic
962315170 3:134354749-134354771 AGGGAGGAGCAGCTGTGGGAGGG + Intergenic
962845967 3:139274164-139274186 AGGGAGGAGCTGCATGGGGCTGG - Intronic
963204456 3:142618264-142618286 TGGGAGATGCAGCAGGGTGGGGG - Intronic
963537353 3:146544729-146544751 AGGGTGAAGGAGCTGGAGGAGGG + Exonic
963561889 3:146876094-146876116 GGGAAGAAGCAGCAGGGGCAGGG + Intergenic
963742977 3:149097961-149097983 AGGGAGGGGGAGGAGGGGGAGGG + Intergenic
963923687 3:150929325-150929347 AGGGAGCAGAAGCAGGTGGCAGG + Intronic
964089863 3:152862744-152862766 AGAAAGAAGAAGCAGGGGAAGGG - Intergenic
964159594 3:153630908-153630930 GGGTAGAAGCAGCAGGGAGAGGG + Intergenic
964374432 3:156035591-156035613 AGGAGGAAGCAGGAGGGGGGAGG - Intergenic
964397737 3:156265329-156265351 AGGGAGAAGAAGTAGCTGGATGG - Intronic
964548930 3:157865479-157865501 CTGGAGAAGCAGCAGGGCCAGGG - Intergenic
964801861 3:160565821-160565843 AGGGGAAACCAGCAAGGGGAAGG + Intergenic
965090442 3:164155599-164155621 AAGCAGAAGCAGCAGGGTAAGGG + Intergenic
965517843 3:169641026-169641048 AGGAAGAGGCAGCACTGGGAGGG + Intronic
965848345 3:172990963-172990985 AGTGAGCAGCAGCAGGAGAAGGG + Intronic
966306117 3:178536806-178536828 AGTGAGAAGCAGCAAGAGGAGGG + Intronic
966559164 3:181299961-181299983 AAGGAGAAGGAGGAGGAGGAGGG + Intergenic
966908496 3:184544545-184544567 GGGGAGAAGGAGGAGGAGGAGGG - Intronic
967204856 3:187110211-187110233 TGGGAGAAGCAGCAGAGGAGAGG + Intergenic
967808188 3:193733349-193733371 AGGGAGCAGGTGCAGGGGGTGGG + Intergenic
967980306 3:195061469-195061491 AGGGAGAGGCAGCAGTGGTGTGG + Intergenic
968471739 4:785762-785784 AGGGAGAAGCAGCAGCCGCGTGG + Exonic
968534173 4:1113196-1113218 AGGGGGAGGGGGCAGGGGGAGGG - Intronic
968753312 4:2401546-2401568 AGCCAGAAGGAGGAGGGGGAGGG - Intronic
968775312 4:2536606-2536628 AGGGGGAAGGAGCAGCGGGGAGG - Intronic
968807800 4:2786838-2786860 ATGGAGAAGTGGAAGGGGGAGGG + Intergenic
969000026 4:3973145-3973167 AGAGTGAAACAGCAGAGGGATGG - Intergenic
969233889 4:5851694-5851716 AGGGAGGAGAAGGAGGAGGAAGG + Intronic
969312522 4:6362214-6362236 AGGGAGAGGCTCCAGGGTGATGG + Intronic
969455481 4:7297523-7297545 AGGGAGACTCAGCAGGGGGCAGG - Intronic
969462822 4:7337806-7337828 AGGGGGAAGGTGCAGGTGGAAGG - Intronic
969506462 4:7591232-7591254 AGGAGGCAGCAGCAGGTGGAGGG - Intronic
969618248 4:8265979-8266001 AGGGGGAAGGAGCGGGGAGATGG - Intergenic
969670262 4:8586236-8586258 GGGGGAAAGCAGCAGGGGGATGG - Intronic
969686835 4:8680282-8680304 AGAGAGAGACAGCAGAGGGAGGG + Intergenic
969723094 4:8904143-8904165 GAGGAGAAGCAGCAGGTCGAGGG - Intergenic
969753985 4:9135470-9135492 AGAGTGAAACAGCAGAGGGATGG + Intergenic
969813880 4:9671609-9671631 AGAGTGAAACAGCAGAGGGATGG + Intergenic
969838137 4:9860165-9860187 AGGGAGGAGAAGGAGGAGGAAGG - Intronic
969951486 4:10841162-10841184 TGGGAGAAGCAGGATAGGGAAGG + Intergenic
970273164 4:14368493-14368515 ATGGAGAGCCAGAAGGGGGATGG + Intergenic
971105215 4:23517342-23517364 AAGGAGAAGGAGGAGTGGGAAGG - Intergenic
971305117 4:25473295-25473317 AAGGAGAAGGAGAAGGGGAAGGG + Intergenic
971380787 4:26095654-26095676 AGGAAGAAGAAGGAGGAGGAAGG + Intergenic
971556302 4:28016396-28016418 AGTGAAAAGCAGCAGGTGAAAGG + Intergenic
971574540 4:28256593-28256615 AGGGAGGAGGAGGAGGAGGAGGG - Intergenic
971633851 4:29031456-29031478 AGGGAAAAGGAGGAGGAGGAGGG - Intergenic
971636645 4:29068717-29068739 AGGGAGAAGGGGAAAGGGGAGGG - Intergenic
971819282 4:31530623-31530645 AGTGAGAAGTAGCAGGGGCAGGG + Intergenic
972565523 4:40265682-40265704 AGGGAGAGGGAGGAGGGAGATGG + Intergenic
972710742 4:41592062-41592084 AGGGAGAAGGGGCAGGAGGAGGG - Intronic
973554473 4:52068538-52068560 AGGAGGAAGCAGGTGGGGGATGG + Intronic
973980412 4:56304080-56304102 AGGGAGAAGAGGCAGAGGGAGGG - Intronic
974023124 4:56709141-56709163 AGGGAGGAGGAGTTGGGGGAGGG + Intergenic
974074169 4:57153900-57153922 AGAGAGAAGGAGGAGGAGGAGGG + Intergenic
974556843 4:63461651-63461673 AGAGAGAAGGAGAAGGGGGAAGG + Intergenic
975460863 4:74651285-74651307 AGGGGGAGGGAGGAGGGGGAGGG + Intergenic
975460870 4:74651298-74651320 AGGGGGAGGGAGGAGGGGGAGGG + Intergenic
975460877 4:74651311-74651333 AGGGGGAGGGAGGAGGGGGAGGG + Intergenic
975814705 4:78205722-78205744 TGGGAGCAGCAGCAGGAAGAGGG + Intronic
975888241 4:78991811-78991833 AGAGAGCAGCAGCAGGAGGCTGG + Intergenic
976231209 4:82845212-82845234 AGGGAGAGGCTGCAGGTGGATGG + Intronic
976512757 4:85930157-85930179 GGGGAGACGGAGCAGGAGGAGGG + Intronic
976709367 4:88052787-88052809 AGAGGGAAGGAGCAGGTGGAGGG + Intronic
977610222 4:99022847-99022869 AGGCAGCAGCAGCCGTGGGAGGG - Intronic
977984292 4:103363571-103363593 GGTAAGAAGTAGCAGGGGGAAGG - Intergenic
978645334 4:110924063-110924085 TGGGGGAAGCGGCTGGGGGAGGG + Intergenic
979491071 4:121328458-121328480 AGGGAGAAGCAGCCAAGTGACGG - Intergenic
979798491 4:124876713-124876735 ACGGAGAAGGGGCAGGGGGGCGG + Intergenic
980113636 4:128658694-128658716 AGGGAGAAGGAAAAGGGGAAGGG + Intergenic
980471860 4:133263231-133263253 AGGGAGAGGGGGCGGGGGGAGGG - Intergenic
981032095 4:140135906-140135928 AGGTTGAAGGAGAAGGGGGAGGG - Intronic
981528839 4:145733306-145733328 GGGGGGAATCAGCAGGAGGAGGG - Intronic
981637963 4:146902152-146902174 AGGGAAAAGAGGAAGGGGGATGG - Intronic
981651914 4:147069897-147069919 AGGAAGAAGGAGCAGGGAGGTGG - Intergenic
981954597 4:150454724-150454746 AGGGAGAAGGCTGAGGGGGAAGG - Intronic
982255452 4:153447057-153447079 AAGGAGAAGCAGGAGGTTGATGG - Intergenic
982613006 4:157601113-157601135 AGGGGGAAGTAACAGGGTGAAGG + Intergenic
983192757 4:164772221-164772243 AGGAAGAGGGAGAAGGGGGAGGG + Intergenic
983345137 4:166519898-166519920 AGTGAAAAGCATCAGTGGGAAGG + Intergenic
983576489 4:169266634-169266656 GGGGAGGGGTAGCAGGGGGAGGG + Intronic
983739762 4:171114886-171114908 AGGGAGAAGCAGAGTGGGAATGG - Intergenic
984070387 4:175103526-175103548 AGGGAGGAGTGGGAGGGGGAGGG + Intergenic
984087183 4:175327371-175327393 AGGGTGAACCAGCAGGGCTAAGG - Intergenic
984191353 4:176609727-176609749 AGCTAGAAGTAGGAGGGGGAAGG - Intergenic
984703986 4:182834586-182834608 GGGGAGAAGAAGGAGGGGAAAGG - Intergenic
984714865 4:182916759-182916781 AGGGAAGAGCAGGAGAGGGAAGG + Intronic
984732385 4:183079832-183079854 ATGGAGAAGCAGCAGGAGCCAGG + Intergenic
984850115 4:184145273-184145295 AGGGGGAAGCAGCAAGGCAAAGG - Intronic
984911437 4:184676929-184676951 AGGGAGAAGGGGAAGGGGGAAGG - Intronic
984975782 4:185229006-185229028 AGGGAGAAGCAGCATCGCAAAGG + Intronic
985140940 4:186840379-186840401 AAGGAGGAGAAGGAGGGGGAGGG - Intergenic
985140990 4:186840558-186840580 AGGGAGGAGAAGGAGGGGAAGGG - Intergenic
985487036 5:157832-157854 ATGGAGAGGCAGCAGTGGGGTGG + Intronic
985493057 5:190312-190334 AAAGAGAAACAGCAGTGGGAGGG - Intergenic
985588418 5:752638-752660 AGGGAGGAGGAGCGCGGGGAAGG - Intronic
985603092 5:845093-845115 AGGGAGGAGGAGCGCGGGGAAGG - Intronic
985652305 5:1112624-1112646 AGGGGGAAGAAGGAGGGGTAGGG - Intergenic
985667077 5:1186882-1186904 AGAGAAAAGCAGGAGGGGGTGGG - Intergenic
985690136 5:1304316-1304338 AAGGAGAAGGAGAAGGGAGAAGG - Intergenic
985797655 5:1975178-1975200 AGAGAGAATCAGGAAGGGGAAGG + Intergenic
985962952 5:3316760-3316782 AGAGAGCAGCTGCAGAGGGATGG - Intergenic
985992344 5:3573913-3573935 AGGGACAGGCAGCAGGGGAGCGG + Intergenic
986156049 5:5177019-5177041 AAGGAGAAGCAGGACTGGGAAGG - Intronic
986198187 5:5557299-5557321 TGGGAGAAGTGGTAGGGGGACGG - Intergenic
986221730 5:5774769-5774791 GAGGAGAAGGAGGAGGGGGAGGG - Intergenic
986247449 5:6023242-6023264 ATGGAGAAGCAGCAGGGAAAAGG + Intergenic
986271272 5:6233004-6233026 AGGGAGAAATAGCTGGAGGAGGG + Intergenic
986687498 5:10287474-10287496 ATGGAGACTCAGAAGGGGGAGGG + Intronic
986946660 5:13029276-13029298 AGGGGGAAGAAGAAGGGGAAGGG + Intergenic
987092927 5:14523441-14523463 TGGGAGCACCAGCAGGAGGAAGG - Intronic
987190883 5:15477198-15477220 AGGGAGAAGGAAAATGGGGAGGG - Intergenic
987566371 5:19593530-19593552 AGGGAGAAGGAGAAGAAGGAAGG - Intronic
988089602 5:26519532-26519554 AGGGAGAAGAAGGAGGAGGAGGG + Intergenic
988205339 5:28126516-28126538 ATGGAGAGCCAGAAGGGGGATGG - Intergenic
988813367 5:34806713-34806735 AGGGAGGAGCAGGTGGGGCACGG + Intronic
988985122 5:36610858-36610880 AGGCAGAAGCAGCAAGAAGAAGG + Intronic
990224518 5:53634599-53634621 AGGGAGAGGAAGGAGGGGGAAGG - Intronic
990258556 5:53996869-53996891 AGGGAGCAGGAGCACTGGGATGG + Intronic
990327722 5:54694615-54694637 AGGCAGAAGGAGGAGGGGTAAGG + Intergenic
990352597 5:54933813-54933835 AGGGAGAAGGAGAAGGGGAGAGG - Intergenic
990352642 5:54934275-54934297 ATGGGGTGGCAGCAGGGGGAAGG + Intergenic
990510441 5:56484586-56484608 ATGGGGAAGCAGGAGGGGGATGG - Intergenic
990616713 5:57516203-57516225 AGGAGGAAGCAGGAGGCGGAAGG + Intergenic
990719617 5:58679174-58679196 AAGGAGAAGCAGCAGGGTGGGGG + Intronic
991036402 5:62131940-62131962 AGGGAGCAGGAGAAGGGGGATGG - Intergenic
991192465 5:63890595-63890617 AGGGAGAATCGGCAGTGGAAAGG - Intergenic
991614591 5:68482797-68482819 AGGGAGAAGCTCCTGAGGGAAGG + Intergenic
991942136 5:71863233-71863255 AGGAAGAAACAACAGAGGGAAGG - Intergenic
992093648 5:73340611-73340633 TGGGGGAGGCAGAAGGGGGATGG - Intergenic
992334867 5:75756212-75756234 AGGGAGGAGCAGCAGAGGTTGGG + Intergenic
992453208 5:76891820-76891842 TGGGAGAGGGAGGAGGGGGAGGG + Intronic
993503275 5:88684912-88684934 AGAGAGAAGTAAAAGGGGGATGG + Intergenic
993511880 5:88780832-88780854 AGGGAGAAAGAGAAGGGGGTAGG - Intronic
993522031 5:88914918-88914940 AGGCAGAAGCAGAGGAGGGAAGG - Intergenic
993867183 5:93209590-93209612 AGGGACTAGGAGCAGTGGGAAGG + Intergenic
993899742 5:93577146-93577168 CAGGAGAAGCAGCAGGAGGAAGG - Intergenic
994302719 5:98165073-98165095 AAGCAGAAGCAGAAGGGGAAGGG - Intergenic
994517913 5:100794038-100794060 AGGCTGAAGCAGCAGGGCCATGG - Intergenic
994832182 5:104798784-104798806 CGGGAGAAGTAGCACGGAGACGG - Intergenic
995060524 5:107807848-107807870 AGGAAGAACCAGCGAGGGGAAGG + Intergenic
995069668 5:107904925-107904947 GGGGTGAAGCAGGAGGAGGAGGG + Intronic
995173036 5:109139453-109139475 AAGGAGAAGTAGCAGGAGAATGG - Intronic
995198549 5:109400467-109400489 AGAGCAAACCAGCAGGGGGAGGG + Intronic
995483251 5:112613977-112613999 AGTGAAAAGCAGAAGGGGAATGG + Intergenic
995752613 5:115470121-115470143 AGTAAGAAGAGGCAGGGGGAGGG - Intergenic
995854236 5:116575792-116575814 GGGGCGCAGCGGCAGGGGGAGGG - Intergenic
995907438 5:117142498-117142520 AGGAAGAAGAAGGAGGGGGAGGG - Intergenic
996781616 5:127192810-127192832 AGGGAGAAACAGCTGAGAGATGG + Intergenic
996947793 5:129091617-129091639 AGGGAATACCAGCAGGGAGATGG - Intergenic
996967590 5:129323111-129323133 AGGTAGCAGCAGCAGTGGGCAGG + Intergenic
997225740 5:132208372-132208394 AGAGAGGAGGAGAAGGGGGAGGG + Intronic
997702089 5:135909650-135909672 AGGGAGAGGCAGCAGGGTGCAGG + Intergenic
997734589 5:136203957-136203979 ACGGAGATGCAGCACGGGAAAGG + Intergenic
998028011 5:138837495-138837517 AGGGAGGAGGGGGAGGGGGAAGG - Intronic
998060404 5:139114499-139114521 AGGGAGAACCACTTGGGGGATGG - Intronic
998384448 5:141748434-141748456 AGGGAGGAGCAGGGGAGGGAAGG - Intergenic
998400294 5:141845322-141845344 GTGGAGGAGGAGCAGGGGGAGGG - Intergenic
998495818 5:142588463-142588485 AGAGAGAAGAGGGAGGGGGAGGG - Intergenic
998549864 5:143067035-143067057 AAGCAGAAGCGGGAGGGGGAGGG - Intronic
998602869 5:143602970-143602992 AGGGAGTGGCAGTAGAGGGAAGG + Intergenic
998783491 5:145684104-145684126 GGGGAAGAGCAGGAGGGGGAAGG + Intronic
998848687 5:146334627-146334649 AGGCAGTAGTAGCATGGGGAAGG - Intronic
999272477 5:150304657-150304679 AAAGAGAAGCAGCAAGGGGATGG + Intronic
999440278 5:151595472-151595494 AAGGAGGAGCAGAAGGTGGAAGG + Intergenic
999747127 5:154600889-154600911 AGGGAGAAGGGGCAGGAGCAGGG - Intergenic
1000383678 5:160652142-160652164 AAGGAGACACAGCAGGAGGAAGG - Intronic
1000618940 5:163460746-163460768 AGGGGGAAAGAGCTGGGGGACGG + Intronic
1000625762 5:163536449-163536471 GGGGAGGTGCGGCAGGGGGAGGG - Intergenic
1000632831 5:163610425-163610447 ACGGAAAACCAGCAGGGGGTGGG + Intergenic
1000963660 5:167629877-167629899 AAGGAGAAGGAGGAGGAGGAGGG + Intronic
1001132907 5:169079549-169079571 AGGAAGAAGGAGGAGGAGGAAGG + Intronic
1001290532 5:170455302-170455324 AGGAAGAAGAAGAAGGGGAAGGG - Intronic
1001310033 5:170603932-170603954 AGGGAGAAACAGGAGGTGGAGGG + Intronic
1001397021 5:171424845-171424867 AGGGGGAAGGGGGAGGGGGAGGG + Intronic
1001526131 5:172430229-172430251 AGGGAGAAGGAGCAGGGACAAGG - Intronic
1001543711 5:172557113-172557135 AGGGAGCAGAAGCAGGAGGAGGG - Intergenic
1001630283 5:173169972-173169994 AGGGAGAAGGAGCAGGCAGGGGG - Intergenic
1001737797 5:174021047-174021069 AAGGGGAAGCAGAAGGGGAAAGG + Intergenic
1001743314 5:174071096-174071118 GGGGAGAAGCTGCAGTGGGAGGG + Intronic
1001893206 5:175356547-175356569 AGGGAGAAGACGCAGGGGCTAGG - Intergenic
1002031349 5:176433022-176433044 AGGGAGAGGAGGGAGGGGGAGGG - Intergenic
1002288981 5:178187076-178187098 AGGGAGGAGCATGAGGAGGAGGG - Intergenic
1002414131 5:179109955-179109977 AGGGAGAAGCAGGGGTAGGAAGG - Intergenic
1002473243 5:179450086-179450108 AGGCAGAAGGAGCAAGGGGAGGG + Intergenic
1002480978 5:179500567-179500589 AGGCAGAAGGAGCAAGGGGAGGG - Intergenic
1002637005 5:180613502-180613524 TGGGAGGAGCAGCAGGGGTTGGG - Intronic
1002919719 6:1558664-1558686 TGGGAGCAGGAGCAGGGGGCGGG - Intergenic
1002971101 6:2021035-2021057 CAGGAGAAGCAGCTGGGAGAAGG - Intronic
1003105395 6:3211326-3211348 AGGGAGCAGGAGGAGGAGGATGG - Intergenic
1003272915 6:4623230-4623252 AAGGGGAAGCGGCAGGGGGGCGG + Intergenic
1003439811 6:6129692-6129714 AGGGAGAAGGGGCAGGAGAAAGG - Intergenic
1003812993 6:9805229-9805251 AGGGAGATGGAGAAGGGGGAGGG - Intronic
1003990708 6:11483587-11483609 AGGGAGCAGAAACAGGAGGAGGG - Intergenic
1003994333 6:11523579-11523601 AAGGAGGAGCAGCAAGGCGATGG + Intergenic
1004000482 6:11592717-11592739 AGGGAGCAGCTGCAGGGGTCTGG + Intergenic
1004002057 6:11604834-11604856 AGGGGGAAGGAGGAGGGGGGAGG + Intergenic
1004462714 6:15853428-15853450 AAGGAGAAGCAGAAGGGGAAGGG - Intergenic
1004573825 6:16873544-16873566 AGTGAGAAACAGGAGGAGGATGG + Intergenic
1004603518 6:17173429-17173451 AGGGAGAAGGGGAAGGGGCAGGG + Intergenic
1005046771 6:21650684-21650706 ATGGAGACACAGCAGGGGGTGGG + Intergenic
1005309794 6:24548477-24548499 AGGGAGAATCAGCTGGGAAAGGG + Intronic
1005512754 6:26526098-26526120 AGGGAGAAGAGGAAGGGCGAAGG + Intergenic
1005857029 6:29870435-29870457 ATTGAGAAGCAGGAGGGTGAAGG + Intergenic
1005862848 6:29914586-29914608 ATTGAGAAGCAGGAGGGTGAAGG + Intergenic
1006067830 6:31475078-31475100 AGGGACTACCACCAGGGGGAGGG - Intergenic
1006334392 6:33412937-33412959 AGGGAGAAGCAGCCATGGAAAGG + Intronic
1006509781 6:34515626-34515648 AGGGAGAACGAGGAAGGGGAAGG - Intronic
1006511957 6:34526285-34526307 ATGGTGTAGCCGCAGGGGGATGG - Exonic
1006743333 6:36324439-36324461 AGGGAGAAGGTGCAGGATGAGGG - Intronic
1007167828 6:39841161-39841183 GGGGAGAGGCTCCAGGGGGAGGG + Intronic
1007167903 6:39841341-39841363 GGGGAGAGGCTCCAGGGGGAGGG + Intronic
1007234416 6:40379977-40379999 AGGGAGATGGACCATGGGGAGGG + Intergenic
1007410514 6:41658684-41658706 AAGGTGAAGCAGCAGGCTGAAGG + Intergenic
1007619254 6:43201981-43202003 AGGTAGAAGAAGGAGGTGGAAGG + Intronic
1007630227 6:43269421-43269443 AGAGAGAAGGAGGAGGGGGAAGG + Intronic
1007694910 6:43725769-43725791 TGGGAGAAGCAGAACGGGGAAGG + Intergenic
1008420551 6:51294224-51294246 AGTGAAAATCAGCAGGTGGATGG - Intergenic
1010073603 6:71773390-71773412 TTGGAGAAGCAGAAGGGGAAAGG - Intergenic
1010386369 6:75284872-75284894 AGGGAGAAGAAGGAGGGACATGG + Exonic
1010514236 6:76753596-76753618 AGGGAGAAGGAAGAGTGGGAAGG + Intergenic
1010628467 6:78168273-78168295 ATGGGGAACCAGAAGGGGGATGG + Intergenic
1010985136 6:82414855-82414877 CTGGAGGAGCAGCAGTGGGAGGG + Intergenic
1011059062 6:83242450-83242472 AACTAGAAGTAGCAGGGGGATGG + Intronic
1011187007 6:84688757-84688779 AGGGATAAGCAGAACGGAGAAGG + Intronic
1011632357 6:89339586-89339608 AGGGGGAAGGAGAGGGGGGAAGG + Intronic
1012494379 6:99818516-99818538 AAGAAGAAGAAGAAGGGGGAGGG - Intergenic
1013290867 6:108717629-108717651 ACGGAGAAGGAGCGGGGAGAAGG - Intergenic
1013523333 6:110952646-110952668 AGGGAGGAGAAGGAGAGGGAGGG - Intergenic
1013627359 6:111951158-111951180 AGGGAGAATGAGCAGAGGGAAGG + Intergenic
1013841400 6:114399117-114399139 AGGGAGAAGAAGGAGGAAGAAGG - Intergenic
1013862457 6:114652218-114652240 AGGGAGAAGCAGAATTGGGCAGG - Intergenic
1014294200 6:119598407-119598429 AAGGAGAAGGAGAAGGGGAATGG + Intergenic
1015210663 6:130694865-130694887 ATGGAGAAGCAGCAGCAGGAAGG + Intergenic
1015261370 6:131241280-131241302 ATGGAGAAGGAGAAGGAGGAGGG + Intronic
1015522476 6:134145638-134145660 AGGGACAAGAAGCAGAGGGGAGG - Intergenic
1015666524 6:135636118-135636140 AGGGAGAAGAAGAAGGAAGAAGG - Intergenic
1015866032 6:137727672-137727694 AGGGAGAAGTAGAAGGGGTTTGG + Intergenic
1016163381 6:140908476-140908498 GGGGAGAAGTGGCAGGGGGCTGG + Intergenic
1016277009 6:142365685-142365707 AGGGAGGAAGAGCAGGAGGAGGG + Intronic
1016400733 6:143677845-143677867 AGGGCGCAGGAGCAGGGGGTGGG - Intronic
1016402365 6:143694206-143694228 AGGAAGAAGTAGAAGGAGGAAGG + Intronic
1016417763 6:143851013-143851035 AGGTGGAAGAAGGAGGGGGAGGG + Intronic
1016557129 6:145351445-145351467 AGAGTGAAGAAGCAGGGGCACGG - Intergenic
1016861383 6:148721958-148721980 AGGGAGAGAGAGCAGAGGGAGGG - Intergenic
1017014660 6:150090329-150090351 AGGGAGAGGGAGCAGTGAGATGG + Intergenic
1017229154 6:152053401-152053423 AGGGAGAGACAGAAGGAGGAAGG - Intronic
1017339568 6:153305201-153305223 AAGGAGAAGGAGAAGGGGAAGGG - Intergenic
1017339582 6:153305249-153305271 AAGGAGAAGGAGAAGGGGAAGGG - Intergenic
1018618554 6:165709513-165709535 AGAGCGAAGCAGCATGGGGGTGG - Intronic
1018740152 6:166722380-166722402 ATGGAGGAGCCGCAGGGGGTGGG + Intronic
1018914064 6:168121922-168121944 AGGGAGAAGGAGTGGGGAGACGG + Intergenic
1018919504 6:168161515-168161537 GGGGAGGAGCAGCATGGGGAGGG - Intergenic
1018928795 6:168225922-168225944 GGGGAGAAGGAGAAGGAGGAGGG - Intergenic
1019019405 6:168905064-168905086 GGGGAGAAGCAGCAGAGTCAAGG - Intergenic
1019178610 6:170173796-170173818 AGGGAGAGGAAGAAGGGGCAGGG + Intergenic
1019192591 6:170261851-170261873 ATGGAGAATCAGCAGGTGCACGG + Intergenic
1019289059 7:241126-241148 AGGGAGCAGCCCCAGGGGCAAGG - Intronic
1019332314 7:466527-466549 AGGGTGAAGGAGGAGGGTGAGGG - Intergenic
1019332376 7:466773-466795 AGGGTGAAGGAGGAGGGTGAAGG - Intergenic
1019477895 7:1252756-1252778 AGGGACAAGAAGCAGGTGGCCGG + Intergenic
1019483570 7:1277265-1277287 AGGGAGAGGGAGGAGGGAGAAGG - Intergenic
1019588672 7:1817990-1818012 AGGCAGCAGAAACAGGGGGAGGG - Intronic
1019638301 7:2088626-2088648 AGCGAGAGGCAGCAAGGGGACGG + Intronic
1019750968 7:2729565-2729587 ATGCAGAAGCAGAAGAGGGAGGG - Exonic
1019883054 7:3880388-3880410 AGCGAGAACCAGCACGGGGCGGG + Intronic
1019959826 7:4449804-4449826 AGGGGGCAGCAGCAGGAGCAGGG - Intergenic
1020011383 7:4807632-4807654 AGAGAGAAGGAGCGGGAGGAGGG - Intronic
1020577357 7:9949908-9949930 GGGGAGGAGGAGGAGGGGGAGGG + Intergenic
1022027313 7:26460581-26460603 AAGGAGAAGCAAGAGAGGGAAGG + Intergenic
1022133460 7:27425329-27425351 AGGGAGTATCAGCAGGGGAGAGG + Intergenic
1022230396 7:28408397-28408419 AAGGAAATTCAGCAGGGGGATGG + Intronic
1022274416 7:28841799-28841821 AAGGAGAAGGAGAAGGGGAAGGG + Intergenic
1022485797 7:30776725-30776747 AGGGAGACAAAGCAGGGAGAGGG - Intronic
1022521327 7:31009029-31009051 GGAGAGAAGCAGGAGGGAGATGG - Intergenic
1022528095 7:31051329-31051351 AGGCAGGAGCAGCTGTGGGATGG + Intergenic
1022534320 7:31086357-31086379 AGGGAGAAGCGCCAGGGTGAGGG - Intronic
1022621391 7:31988135-31988157 AGGGTGAAGCCACAGTGGGACGG - Intronic
1022636599 7:32142178-32142200 AGGCAGAAGGAGAAGGGGGAAGG + Intronic
1022670301 7:32449363-32449385 AGGAAGAAGGAGAAGGGGAACGG + Intergenic
1022877794 7:34552885-34552907 GTGGTGATGCAGCAGGGGGAGGG - Intergenic
1023119051 7:36890961-36890983 AGGGAGAACCACCAGGGCAAAGG - Intronic
1023221218 7:37921299-37921321 AGGGAGGAGCTGCAAGGGGCCGG - Intronic
1023302195 7:38784655-38784677 AGGGGGAAGGAGGAGGGGAAGGG + Intronic
1023347596 7:39287349-39287371 AGGGAGAAGAATCCAGGGGAGGG - Intronic
1023711953 7:43004302-43004324 GGGGAGGAGAAGCTGGGGGAGGG - Intergenic
1023931223 7:44707802-44707824 AGGCACATGCAGCAGAGGGATGG + Intronic
1024051178 7:45624335-45624357 AGGTAGGAGGGGCAGGGGGAAGG + Intronic
1024171405 7:46791300-46791322 ATGGAGGGGCAGCAAGGGGAAGG + Intergenic
1024524395 7:50336260-50336282 AGGGGGAGGGTGCAGGGGGAGGG + Intronic
1025253262 7:57365983-57366005 AAGGCGAAGCAGCTGGGAGAGGG - Intergenic
1025283654 7:57646381-57646403 AGGAAGAAGCTGCGGGCGGAGGG - Intergenic
1025996640 7:66531518-66531540 AGGGAGGAGCTGCAGGGAGCTGG - Intergenic
1026093802 7:67324396-67324418 AGGCAGAAGCAGAGGAGGGAAGG + Intergenic
1026129922 7:67611932-67611954 AGGAAGAGGCAGAAGGGAGATGG - Intergenic
1026285045 7:68955407-68955429 AAGGGGAAGAGGCAGGGGGATGG + Intergenic
1026311777 7:69192060-69192082 AGGGAGGAGCTGCAGGGGTGAGG + Intergenic
1026638649 7:72105800-72105822 AGGGAGGAGGAGGAGGGGGAGGG + Intronic
1026678351 7:72446940-72446962 GAGGAAAAGCAGAAGGGGGAAGG + Intronic
1026740545 7:72975995-72976017 ACGGAGCAGGAGCAGAGGGAGGG + Intergenic
1026797844 7:73377480-73377502 ACGGAGCAGGAGCAGAGGGAGGG + Intergenic
1026800635 7:73397837-73397859 AGGGAGGAGGAGTAGGGGAAAGG + Intergenic
1026917452 7:74129504-74129526 AGGAAGAAGGAGGAGGAGGAGGG + Intergenic
1026929954 7:74218247-74218269 TGGGAGAAGCAACAGAGGAACGG - Intronic
1026967700 7:74450862-74450884 AATGAGAAGCTGCAGGAGGAGGG + Intergenic
1027103187 7:75389076-75389098 ACGGAGCAGGAGCAGAGGGAGGG - Intergenic
1027397147 7:77767780-77767802 AGGGGGAGGGAGAAGGGGGAGGG - Intronic
1027532344 7:79352527-79352549 AAGCAGAAGCATGAGGGGGAAGG + Intronic
1027623307 7:80519338-80519360 AGAGGTAAGGAGCAGGGGGATGG + Intronic
1027748310 7:82107427-82107449 AGGGAGAAGCAGAGAGAGGAAGG - Intronic
1027813045 7:82930298-82930320 AGGGAGAAACAGCATTAGGAGGG + Intronic
1028070828 7:86448038-86448060 AAGGAGGAGGAGGAGGGGGAGGG + Intergenic
1028169002 7:87573298-87573320 AGGGAGAAGCATCAGAGTGGTGG - Intronic
1028223132 7:88219841-88219863 AGGGAGAAGCCGAGGGCGGAAGG + Intronic
1028437969 7:90827067-90827089 AGGGACAGGCAGCAGGGGTGGGG - Intronic
1028527471 7:91801577-91801599 GGGGTGAAGCAGCAGGGGGCTGG + Intronic
1029152609 7:98491649-98491671 AGACAGATGGAGCAGGGGGATGG - Intergenic
1029410096 7:100403967-100403989 TGGGAGAAACAGAATGGGGAGGG - Intronic
1029422756 7:100479467-100479489 AGGGAGGGGCTGCAGGGGGCGGG + Intergenic
1029524351 7:101085969-101085991 AGGGTGAGCCAGCAGCGGGAAGG + Intronic
1029977510 7:104848642-104848664 AGGGAAAAGGAGAAGGGGAAAGG + Intronic
1030007776 7:105135434-105135456 AGAGAGCAGCAGCAGAGGGAAGG + Intronic
1030182307 7:106722696-106722718 AGGGAAAAGAAGCAGGATGAGGG - Intergenic
1030583098 7:111384308-111384330 AGGGAAAAGGAGAAGGAGGAGGG + Intronic
1030767742 7:113432467-113432489 AGAGAGATGCAGAAGGTGGAGGG - Intergenic
1031053790 7:116972131-116972153 AGGGAGGAGCAGCAGCAGGGTGG + Intronic
1031219441 7:118945920-118945942 TGGGAGAGGCAGAAGGGAGATGG - Intergenic
1031232308 7:119123647-119123669 ATGGGGAGCCAGCAGGGGGATGG - Intergenic
1031286108 7:119869901-119869923 AGGGAGAATTAGCAAGGGCAGGG - Intergenic
1031838614 7:126709476-126709498 AGGAAGAAGAAGAAGGAGGAGGG + Intronic
1031865595 7:127035810-127035832 AGAGGGAAGCAGTATGGGGATGG - Intronic
1032473074 7:132192394-132192416 AGGAAGAAGGAGGAGGAGGAAGG + Intronic
1032697867 7:134353356-134353378 AGGGAGAAGGCGCTGGGGGCAGG - Intergenic
1032767836 7:135016581-135016603 AAGGAGAAGTGGCAGGGGTAGGG + Intronic
1032839767 7:135704479-135704501 AGTCAGAAGCAGCAGAGTGAGGG + Intronic
1032908121 7:136396137-136396159 AGGGAGGAGGAGGAGAGGGAAGG + Intergenic
1033056594 7:138060554-138060576 AGGAAGAAGCAGCTGCAGGATGG - Intronic
1033077055 7:138259386-138259408 AGGGAGTAGATGAAGGGGGAGGG + Intergenic
1033443697 7:141402408-141402430 AGGAATGAGCAGCAGGGGGAGGG - Intronic
1033622069 7:143070389-143070411 AGGGAGAAGAAACAGGGAGTTGG + Intergenic
1033804365 7:144937531-144937553 AGGGGGAAGGGGAAGGGGGAAGG - Intergenic
1033804392 7:144937599-144937621 AAGGGGAAGCAGAAAGGGGAAGG - Intergenic
1034099055 7:148436105-148436127 AGGAAGAGCCAGCATGGGGAGGG + Intergenic
1034128960 7:148698724-148698746 GGGGAGAAGCTGTTGGGGGAGGG - Intronic
1034354418 7:150441860-150441882 AAGGAGAAGGAGAAGGGGAAGGG - Intergenic
1034469275 7:151246968-151246990 AGGGAGAGGTAGCAGTTGGAAGG - Intronic
1035020803 7:155799010-155799032 AGGGAGAAGCAGGAGTGAGTGGG + Intergenic
1035111228 7:156483713-156483735 AGGGGGAGACAGGAGGGGGAGGG + Intergenic
1035245903 7:157561817-157561839 AGGAAGATGCAGCAGGAGGATGG + Intronic
1035722041 8:1799282-1799304 GGGGAGGAGGAGGAGGGGGACGG - Intergenic
1035731899 8:1859624-1859646 AGGGAGAAGCTGCCGGAGGAGGG - Intronic
1035760446 8:2064777-2064799 GAGGAGAAGGAGGAGGGGGATGG - Intronic
1036295213 8:7529236-7529258 AAGGAGGAGGAGAAGGGGGAGGG - Intergenic
1036327357 8:7791782-7791804 AAGGAGGAGGAGAAGGGGGAGGG + Intergenic
1036377201 8:8210807-8210829 AGAGTGAAACAGCAGAGGGATGG + Intergenic
1036678191 8:10852009-10852031 AGGGAAAGGAAGCACGGGGAAGG + Intergenic
1036767679 8:11559043-11559065 AGGAAGCAGCAGCAGTGGGCAGG - Intronic
1036768007 8:11561052-11561074 AGCGAGAACGAGGAGGGGGAGGG + Intronic
1036852345 8:12212344-12212366 AGAGTGAAACAGCAGAGGGATGG - Intergenic
1036873713 8:12454865-12454887 AGAGTGAAACAGCAGAGGGATGG - Intergenic
1036916640 8:12810716-12810738 AGGGAGAAGAAGGAAGGGGAGGG - Intergenic
1037787279 8:21910591-21910613 GGTGAGAAGCAGCGAGGGGATGG - Intronic
1037806403 8:22060017-22060039 AGGGACACACAGCTGGGGGAGGG + Intronic
1037809037 8:22075310-22075332 AAGAAGAAGAAGAAGGGGGAGGG - Intronic
1037962115 8:23105449-23105471 AGGGTGGAGCACCACGGGGAGGG + Intronic
1038042643 8:23738003-23738025 AGGAAGAAGAAGAAGGGGAAGGG - Intergenic
1038284965 8:26198493-26198515 AGGAAGAAGAAGGAGGAGGAGGG - Intergenic
1038565833 8:28619486-28619508 AGGGAGGAGCAGCAGGGGTGGGG - Intronic
1038691248 8:29765429-29765451 AGGGAACAGGTGCAGGGGGAGGG - Intergenic
1038898324 8:31812667-31812689 AGAGAGGAGCAGCGAGGGGAGGG - Intronic
1039048092 8:33468293-33468315 AGGGAGAGGGAGGAGGAGGAGGG - Intronic
1039048499 8:33472269-33472291 AGGGAGCTGCAGCAGGGAGCAGG + Intronic
1039454681 8:37698700-37698722 AGGGAGAGGGAGGAGGGTGAGGG - Exonic
1039912305 8:41834943-41834965 CGGGAGAAGCTGGAGGGGCAGGG + Intronic
1040306403 8:46214129-46214151 AGAGGGTAGAAGCAGGGGGACGG + Intergenic
1040393889 8:46976123-46976145 ATGGAGACGCAGCGGGTGGAAGG + Intergenic
1040565716 8:48564909-48564931 GGGGAGCAGGAGCAGGGGGAAGG + Intergenic
1040579082 8:48681245-48681267 AGGGAGAATCTGAAGAGGGAAGG - Intergenic
1040848356 8:51870861-51870883 AGAATGAAGCAGCAGGGGGCGGG + Intronic
1041003973 8:53481508-53481530 AAGGATGAGCAGCATGGGGATGG - Intergenic
1041067045 8:54092093-54092115 AAGGAGAAGGAAGAGGGGGAGGG + Intronic
1041267607 8:56080332-56080354 AAGAAGAAGGAGGAGGGGGAGGG + Intergenic
1041291170 8:56310133-56310155 AGGGAGGAGGAGGAGGAGGAAGG + Intronic
1041291181 8:56310165-56310187 AGGGAGGAGGAGGAGGAGGAAGG + Intronic
1042568216 8:70134114-70134136 GTGGAGAAGAAGCAGGAGGAAGG - Intronic
1042942189 8:74118755-74118777 AAGGAGAAGGAGAAGGAGGAGGG - Intergenic
1043305175 8:78784865-78784887 AAGGAGAAGATGGAGGGGGAGGG - Intronic
1043735073 8:83731156-83731178 GGGGCGAGGCAGCAGGGGGCTGG + Intergenic
1044096668 8:88074704-88074726 AGTGAGAAACAACAGGGTGATGG - Exonic
1044422933 8:92019406-92019428 AAGGAAGAGCAGGAGGGGGAGGG + Intronic
1044916035 8:97113305-97113327 AGAGAGCAGCAGCAGGAGAAGGG + Intronic
1044932020 8:97260133-97260155 CAGGAGAAGGAGGAGGGGGAGGG + Intergenic
1044983244 8:97736375-97736397 AGGGAGGGGGAGGAGGGGGAGGG + Intergenic
1045009916 8:97950006-97950028 AGTGGGGAGCAGCAGGGAGAGGG + Intronic
1045324348 8:101106602-101106624 AGAGTGAAGCAGCAGGATGAAGG + Intergenic
1045333640 8:101179280-101179302 GGAGAGAAGAAGCAGGGGAAGGG - Intronic
1045464865 8:102460548-102460570 AGGGAGAAAGAGCAATGGGAAGG - Intergenic
1046015602 8:108601132-108601154 AAGGAGAAGGAGGAGGGAGAGGG + Intergenic
1046285894 8:112092485-112092507 AGTGAGGAGCAGCAGGGGCAGGG + Intergenic
1046710250 8:117503293-117503315 AGGAAGAAGAAGGAGGAGGAGGG + Intergenic
1047066070 8:121284488-121284510 GGGGAGAGGAAGCAGGGGCAAGG + Intergenic
1047191598 8:122683426-122683448 AGGGAGAAGCAGTGGAGGAACGG + Intergenic
1047418934 8:124690141-124690163 CGGGAGCAGCAGCAGTGGGGAGG - Intronic
1047680267 8:127247571-127247593 AGGGAGAAGCATCTGGAGGCTGG + Intergenic
1047800209 8:128301286-128301308 AGGGAAAAGGAGGAGGTGGAGGG + Intergenic
1048276118 8:133067299-133067321 AAGGAGAAGCAGATGGGGGTGGG - Intronic
1048327506 8:133450701-133450723 AGGAAGATGCAGCAGAGAGAAGG - Intergenic
1048767402 8:137859932-137859954 AAGGAGGAGGAGCAGGAGGAGGG + Intergenic
1048972124 8:139651034-139651056 GGGAAGAAGCAGAAGGGGGTGGG - Intronic
1049040044 8:140105683-140105705 AGGGAGAAGGAGCTGAGGAAAGG - Intronic
1049054755 8:140227144-140227166 AGGGGGCAGCTGCAGAGGGATGG + Intronic
1049062570 8:140287311-140287333 AGCAAGAAGGAGCAGGAGGAAGG + Intronic
1049092940 8:140530397-140530419 AGGGAACAGCAGCAGGAAGAGGG + Intergenic
1049237442 8:141519160-141519182 AGGGGGCAGCAGGATGGGGAGGG + Intergenic
1049614240 8:143569236-143569258 AGGGAGAAACAGGAGGGGCGGGG + Intronic
1049696674 8:143987342-143987364 AGGGAGGAACAGCAGGGGTGGGG - Intronic
1049761882 8:144335500-144335522 AGGGAGAGGAAGCAGGGAGGAGG - Intronic
1050490862 9:6186557-6186579 AGGGAGAAGGTGAAGGGGAAGGG + Intergenic
1050536448 9:6634816-6634838 GGGGAGAAGCGGGAGAGGGAAGG - Intronic
1050575831 9:6994311-6994333 GAAGAAAAGCAGCAGGGGGAGGG - Intronic
1050608731 9:7328945-7328967 AGGAAAAAGCAACAGAGGGAAGG + Intergenic
1050633375 9:7583585-7583607 AGGGGTAAACAGCAGGGGAAGGG + Intergenic
1050831361 9:10018198-10018220 AGAGAGAAGGAGTAGGAGGAAGG + Intronic
1051011007 9:12414427-12414449 AGGGAGAAAGAGTTGGGGGAGGG - Intergenic
1051106509 9:13587024-13587046 AGAGAGAAGGAGAATGGGGAGGG - Intergenic
1051189121 9:14492565-14492587 AGGAAGAAGAGGGAGGGGGAAGG + Intergenic
1051247521 9:15126702-15126724 AGGAAGGAGAAGGAGGGGGAAGG + Intergenic
1051287268 9:15510371-15510393 AGGGAGGGGCCGCAAGGGGAGGG + Intronic
1051388930 9:16542382-16542404 AGAGAGAAGAAGATGGGGGAGGG + Intronic
1051560624 9:18436897-18436919 AGGCAGGAGCAGTAGGTGGAGGG + Intergenic
1051641716 9:19230379-19230401 AGGGAGAAGACGCAGGGAGGAGG - Intergenic
1052258902 9:26491812-26491834 AGAGAGCTGCAGCTGGGGGAGGG - Intergenic
1052343581 9:27386054-27386076 AAGGAAAAGCAGCAGCAGGATGG - Intronic
1052721658 9:32178643-32178665 AGGGAGAAGCAGATGTGGAATGG + Intergenic
1052968769 9:34363625-34363647 AGAGAGCAGCAGCAGGGGGAAGG - Intergenic
1052983465 9:34466913-34466935 AGGGAGAACCAGCAGTTGGATGG - Intronic
1053233805 9:36434297-36434319 GGAGAGGAGCAGGAGGGGGAGGG + Intronic
1053233819 9:36434323-36434345 TGGGGGAAGGAGGAGGGGGAGGG + Intronic
1053330892 9:37206287-37206309 AGGGAGAGGGGGAAGGGGGAAGG - Intronic
1053415533 9:37944834-37944856 CAGGAGAAGCTGCAGGGAGAAGG - Intronic
1053416406 9:37949590-37949612 GGACAGAAGCAGCAAGGGGAAGG + Intronic
1053674953 9:40415060-40415082 AGGTAGATGCATCAGGAGGAGGG + Intergenic
1053750139 9:41245072-41245094 ATGGAGACTCAGCAGGGTGAGGG - Intergenic
1053924745 9:43041419-43041441 AGGTAGATGCATCAGGAGGAGGG + Intergenic
1054255638 9:62809411-62809433 ATGGAGACTCAGCAGGGTGAGGG - Intergenic
1054288229 9:63253592-63253614 AGGTAGATGCATCAGGAGGAGGG + Intergenic
1054335673 9:63806196-63806218 ATGGAGACTCAGCAGGGTGAGGG + Intergenic
1054386055 9:64555127-64555149 AGGTAGATGCATCAGGAGGAGGG + Intergenic
1054452952 9:65413095-65413117 AGGGAGAAGCAGCCTGGGAGGGG - Intergenic
1054509666 9:65961233-65961255 AGGTAGATGCATCAGGAGGAGGG - Intergenic
1054740184 9:68798542-68798564 AGGGAGAATCATCATGGGCAAGG + Intronic
1054928618 9:70613664-70613686 AGGCAGAAACAGCAGGGAGAAGG - Intronic
1055074237 9:72197286-72197308 ATAGAGAGGCAGCAGGGAGAGGG - Intronic
1055688898 9:78808774-78808796 AAGGAAAAGCAGCAGAGAGAGGG - Intergenic
1055716407 9:79122756-79122778 AAGGAGAAGAAGGAGGAGGAGGG + Intergenic
1055758793 9:79584017-79584039 AGGGAGGATCAGCACGGGGGTGG + Intronic
1056266485 9:84901760-84901782 ATGGAGAAGAAGCCAGGGGAGGG - Intronic
1056662107 9:88551649-88551671 AGAGAGAAGCAACAGGGGAAGGG - Intronic
1057130598 9:92651662-92651684 AGGGAGGAGCTGGAGGTGGAGGG - Intronic
1057301403 9:93887140-93887162 AGGGAGAGACAGCTGTGGGAGGG + Intergenic
1057302499 9:93894948-93894970 AGGGAGATGCAGGAAGGGGGCGG - Intergenic
1057325858 9:94062606-94062628 TGGGAGCAGGAGCAGGAGGAAGG + Intronic
1057388210 9:94622669-94622691 AAAGAGAAGCAGCAGGAGGAGGG - Intronic
1058349401 9:104003428-104003450 AGGGAGAAGAGGAAGGGTGAAGG + Intergenic
1058553226 9:106138134-106138156 AGGCAGAAGGAGGAGGTGGAAGG - Intergenic
1058593636 9:106591570-106591592 GGGGAGGAGCAGCAGGAGGTGGG + Intergenic
1059008948 9:110435550-110435572 TGGGAGAAGTAGCTGGGAGAGGG - Intronic
1059259398 9:112961500-112961522 TGGGAGAAGCAGGAGGTAGAGGG - Intergenic
1059366363 9:113789539-113789561 AGAGAGAAGAAGAAGGAGGAGGG - Intergenic
1059431205 9:114251406-114251428 AGGGAGGAGGAGGAGGAGGAAGG - Intronic
1059499310 9:114737507-114737529 AGGGAGAGGCAGAAGGGGAGGGG - Intergenic
1059632734 9:116141987-116142009 AGGAAGAAGAAGCAGGGGAAGGG + Intergenic
1059691240 9:116687591-116687613 GAGGAGATGCAGCTGGGGGAGGG + Intronic
1059851400 9:118345203-118345225 AGGGTGAAGCAGGAGAGAGAAGG + Intergenic
1060222493 9:121772102-121772124 AGGGAGCGGCAGCAGGAGGCTGG + Intronic
1060478110 9:124000140-124000162 AGGGGGGAGCGGCAGGGTGAGGG - Intergenic
1060734837 9:126060190-126060212 AGGGAGAAGCTGCAGGGTTAGGG + Intergenic
1060781840 9:126418758-126418780 AGAGAGATGCAGCAGGGAGGAGG - Intronic
1060818082 9:126645877-126645899 GGGGAGAAGCCGCTGAGGGAGGG + Intronic
1061026850 9:128055349-128055371 AGGGAGAAGAAGGGAGGGGAAGG + Intergenic
1061334624 9:129923969-129923991 AGGCAGAGGCAGGAGGGGGAGGG + Exonic
1061379100 9:130243651-130243673 AGGGAGAAGCAGCTCGGAGGTGG + Intergenic
1061472230 9:130835566-130835588 AGGGCCCAGCAGCAGCGGGAGGG - Intronic
1061743299 9:132722752-132722774 AGTCCGAAGCAGCAGGGGGTTGG + Intergenic
1061899691 9:133666542-133666564 AAGGAGGAGAAGGAGGGGGAAGG - Intronic
1061913651 9:133738068-133738090 GGGGAGGAGCGGCAGGGGGCGGG + Intronic
1062061956 9:134501724-134501746 AGGGAGACTCAGCAGGGGTGAGG - Intergenic
1062092580 9:134686221-134686243 AAGGAGAAGGAGAAGGAGGAAGG - Intronic
1062469704 9:136697007-136697029 AAGGAGGAGGAGGAGGGGGAAGG - Intergenic
1062469707 9:136697013-136697035 AGGGGGAAGGAGGAGGAGGAGGG - Intergenic
1062469712 9:136697026-136697048 AGGGGGGAGGAGGAGGGGGAAGG - Intergenic
1062469722 9:136697045-136697067 AGGGGGGAGGAGGAGGGGGAGGG - Intergenic
1062469743 9:136697082-136697104 AGGGGGAAGGAGGAGGGGGAGGG - Intergenic
1062469753 9:136697101-136697123 AGGGGGAAGGAGGAGGGGGAGGG - Intergenic
1062564522 9:137158256-137158278 CAGGAGAAGGAGCAGGGAGAAGG + Intronic
1062564527 9:137158269-137158291 AGGGAGAAGGAGCAGGGGGAAGG + Intronic
1062564534 9:137158295-137158317 AGGGAGAAGCAGCAGGGGGAAGG + Intronic
1062638360 9:137503426-137503448 AAGGAGAATGAGGAGGGGGAAGG + Intronic
1062638364 9:137503439-137503461 AGGGGGAAGGAGAAGGAGGAGGG + Intronic
1062638367 9:137503445-137503467 AAGGAGAAGGAGGAGGGGGAAGG + Intronic
1062638371 9:137503458-137503480 AGGGGGAAGGAGAAGGAGGAGGG + Intronic
1062638374 9:137503464-137503486 AAGGAGAAGGAGGAGGGGGAAGG + Intronic
1062638378 9:137503477-137503499 AGGGGGAAGGAGAAGGAGGAGGG + Intronic
1062638381 9:137503483-137503505 AAGGAGAAGGAGGAGGGGGAAGG + Intronic
1062638386 9:137503502-137503524 AAGGAGAAGGAGGAGGAGGAAGG + Intronic
1062638393 9:137503521-137503543 AAGGAGAAGGAGGAGGGGGAAGG + Intronic
1062638397 9:137503534-137503556 AGGGGGAAGGAGAAGGAGGAGGG + Intronic
1062638398 9:137503540-137503562 AAGGAGAAGGAGGAGGGAGAAGG + Intronic
1062638406 9:137503569-137503591 AAGGAGAAGGAGAAGGAGGAGGG + Intronic
1062638407 9:137503575-137503597 AAGGAGAAGGAGGAGGGAGAAGG + Intronic
1062638414 9:137503604-137503626 AGGAAGAAGGAGGAGGGAGAAGG + Intronic
1062638418 9:137503617-137503639 AGGGAGAAGGAGGAGGGAGAAGG + Intronic
1203371924 Un_KI270442v1:315169-315191 ATGGAGACTCAGCAGGGTGAGGG + Intergenic
1185449568 X:275241-275263 GGGGAGGAGGAGCAGGGGGGAGG + Intergenic
1185459858 X:328923-328945 AGAGAGGAGGAGGAGGGGGAGGG - Intergenic
1185575522 X:1169134-1169156 AGGGAGGAGGAGGAGGGGAAGGG + Intergenic
1185661948 X:1735264-1735286 GGGGAGGAGGAGGAGGGGGAGGG - Intergenic
1185803289 X:3032598-3032620 AGGGAGAGACAGAAGAGGGAGGG + Intronic
1186069961 X:5808805-5808827 AGGAAGCAGCAGGAGAGGGAGGG - Intergenic
1186410597 X:9342275-9342297 GGTGGGAAGGAGCAGGGGGAGGG - Intergenic
1186435400 X:9538807-9538829 AGGGAAAGGCAGCTGGGGAAAGG + Intronic
1186471161 X:9823081-9823103 AGGGAGAAGGAGGAGGAGAAGGG - Intronic
1186471165 X:9823094-9823116 AAGGAGAAGGAGAAGGGAGAAGG - Intronic
1186471166 X:9823100-9823122 AGGGAGAAGGAGAAGGAGAAGGG - Intronic
1186471169 X:9823113-9823135 AGGGAGAAGGAGAAGGGAGAAGG - Intronic
1186471172 X:9823126-9823148 AAGGAGAAGGAGAAGGGAGAAGG - Intronic
1186585310 X:10867124-10867146 AGGGAGAAGGAACAGGGTTAGGG + Intergenic
1187025747 X:15433932-15433954 AGGAAGAAGGAGGAGGAGGAAGG + Intronic
1187276087 X:17817643-17817665 AGGGAGAAGCAGCAGGTCCCTGG + Intronic
1187467905 X:19542744-19542766 AGAAAGAAGCTGCAGCGGGAGGG + Intronic
1187783871 X:22862157-22862179 AGGGAAAAGAGGAAGGGGGAAGG + Intergenic
1187843793 X:23515444-23515466 AAGGAGAAGGAGAAGGGGAAGGG - Intergenic
1187882873 X:23862844-23862866 AGGGAGAAGGAGGGAGGGGAGGG + Intronic
1187969676 X:24647206-24647228 GGGGAGAAGAAGCGGGGGGATGG - Exonic
1188495750 X:30781431-30781453 GGGGAGAGGCATCATGGGGAAGG - Intergenic
1189066245 X:37812362-37812384 AAGGAGAAAGAGCTGGGGGAAGG + Exonic
1189175533 X:38953616-38953638 AGGGGGAAGCAGCAGCAGGAAGG - Intergenic
1189211425 X:39287260-39287282 AGGGAGAGGCAGCACGAAGAAGG + Intergenic
1189267440 X:39727918-39727940 AAGGAGAAGGTGCTGGGGGATGG - Intergenic
1189684398 X:43548814-43548836 AAGGAGAAGGAGAAGGGGAAGGG + Intergenic
1190171006 X:48111633-48111655 ATGGAGAAGGAGCAGGGGCAGGG + Intergenic
1190369438 X:49727093-49727115 GGGCAGAGGCAGCAGGGGGCTGG - Intergenic
1190427250 X:50345255-50345277 AGGGAGGAAAAGCAGGAGGAAGG - Intronic
1190461553 X:50681589-50681611 TGGTAGGAGCAGCAGGGGCAGGG - Intronic
1190626511 X:52343068-52343090 AGAGAGAGGCAGAAAGGGGAAGG + Intergenic
1190726195 X:53192508-53192530 AGGGAGAGGGAGAAGGGGGTAGG + Exonic
1190909247 X:54757065-54757087 AGGGAGAAGGAGCAGACTGATGG + Exonic
1191055138 X:56232996-56233018 AAGGAAAAGCTGCAGGGGGGAGG + Intronic
1192157398 X:68756880-68756902 AGAGAGAAGCAGCAGGGAGATGG + Intergenic
1192199877 X:69060138-69060160 AGGCTGAAGCAGTTGGGGGAAGG + Intergenic
1192207799 X:69107599-69107621 AGGCAGCAGCAGGAGGGAGAGGG + Intergenic
1192243046 X:69349858-69349880 AGGGTGCAGGAGAAGGGGGAAGG - Intergenic
1192424230 X:71061160-71061182 AGAGAGAATTAGCAGAGGGATGG + Intronic
1193363954 X:80608368-80608390 AGTGAGAAGTAGAAGGGGCAGGG - Intergenic
1193696525 X:84713378-84713400 AGGGAGATACAGGAGAGGGAAGG - Intergenic
1195107656 X:101616499-101616521 AGTGAGAAGCTGGAGGAGGAGGG - Exonic
1195294591 X:103463498-103463520 AGGAAGAAGGAGGAGGGAGAGGG + Intergenic
1195668247 X:107449572-107449594 GGGGAGAAGGGGCGGGGGGAGGG - Intergenic
1195696231 X:107669609-107669631 AAGGAGGAGGAGGAGGGGGAAGG - Intergenic
1196144792 X:112304843-112304865 AGAGAGATGCAGGAGTGGGATGG - Intergenic
1196613341 X:117738873-117738895 AAAGAAAAGGAGCAGGGGGATGG + Intergenic
1196669189 X:118347082-118347104 AGCGAAAAGGAGCGGGGGGAAGG + Intronic
1196684045 X:118495778-118495800 AGGGAGGAGCAGCGGGTGGGAGG + Intergenic
1197160121 X:123313547-123313569 AGTGAGAAGGAAAAGGGGGAAGG - Intronic
1197289066 X:124632556-124632578 AGAGAGAAGGAGAAGAGGGATGG - Intronic
1197821169 X:130542333-130542355 AGGGAGACACAGAAGGGAGATGG - Intergenic
1198130803 X:133693072-133693094 AGGGAGAGGGAGCAGGGTGGGGG + Intronic
1198761238 X:140034719-140034741 AGGGAAAAACAGAAGAGGGAAGG + Intergenic
1198767210 X:140091743-140091765 ATGGAGGAGCAGCAGAAGGAGGG + Intergenic
1199399167 X:147376729-147376751 AGTGAGGAACAGCAGGGGCAAGG + Intergenic
1199586257 X:149420108-149420130 AGGGAGAGGCAGAGGGGAGAGGG - Intergenic
1199718463 X:150524760-150524782 AGGGAGAAGCAACAAGGAGGAGG - Intergenic
1199780346 X:151052427-151052449 AGAGAGAGGAAGCAGGTGGAAGG - Intergenic
1199792948 X:151171931-151171953 TGGGAGGAGCAGGAGGGGCAGGG + Intergenic
1200154966 X:153970443-153970465 GGGGAGAAGGGGGAGGGGGACGG + Intronic
1200175930 X:154116339-154116361 ATGGGGAAGCACCAGGGGGTCGG - Intergenic
1200379711 X:155822203-155822225 AAGGAGAAGGAGAAGGGGAAGGG + Intergenic
1200379719 X:155822227-155822249 AAGGAGAAGGAGAAGGGGAAGGG + Intergenic
1201438758 Y:13986105-13986127 AGGGAGAAGCAGTTCGTGGAGGG - Exonic
1201445815 Y:14056603-14056625 AGGGAGAAGCAGTTCGTGGAGGG + Exonic
1201761461 Y:17543930-17543952 ATGGAGACTCAGCAGGGTGAGGG + Intergenic
1201840091 Y:18362060-18362082 ATGGAGACTCAGCAGGGTGAGGG - Intergenic
1202021599 Y:20470254-20470276 AGCTAGAAGCAGAAAGGGGAAGG - Intergenic
1202200004 Y:22336227-22336249 AGGGAGATGGAGCAGGGAGGTGG - Intronic