ID: 1062567235

View in Genome Browser
Species Human (GRCh38)
Location 9:137168675-137168697
Sequence GCGCGCCTGCACCCTGGGGA CGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 181
Summary {0: 1, 1: 0, 2: 0, 3: 16, 4: 164}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1062567235_1062567239 0 Left 1062567235 9:137168675-137168697 CCGTCCCCAGGGTGCAGGCGCGC 0: 1
1: 0
2: 0
3: 16
4: 164
Right 1062567239 9:137168698-137168720 ACCGCCCAACCCCCACCTCCCGG 0: 1
1: 0
2: 3
3: 75
4: 703
1062567235_1062567251 25 Left 1062567235 9:137168675-137168697 CCGTCCCCAGGGTGCAGGCGCGC 0: 1
1: 0
2: 0
3: 16
4: 164
Right 1062567251 9:137168723-137168745 TATGCAGTGGTGATGCCTAAAGG 0: 1
1: 0
2: 2
3: 10
4: 87
1062567235_1062567247 12 Left 1062567235 9:137168675-137168697 CCGTCCCCAGGGTGCAGGCGCGC 0: 1
1: 0
2: 0
3: 16
4: 164
Right 1062567247 9:137168710-137168732 CCACCTCCCGGTGTATGCAGTGG 0: 1
1: 0
2: 0
3: 10
4: 75

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1062567235 Original CRISPR GCGCGCCTGCACCCTGGGGA CGG (reversed) Exonic