ID: 1062567335

View in Genome Browser
Species Human (GRCh38)
Location 9:137169054-137169076
Sequence CGAGCGTGTAAACCACGGCC AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 25
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 21}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1062567329_1062567335 4 Left 1062567329 9:137169027-137169049 CCAGGCTGACGAGGAAGGAGGCC 0: 1
1: 0
2: 3
3: 18
4: 242
Right 1062567335 9:137169054-137169076 CGAGCGTGTAAACCACGGCCAGG 0: 1
1: 0
2: 0
3: 3
4: 21
1062567323_1062567335 22 Left 1062567323 9:137169009-137169031 CCAGCGCCAGGCAGGAAGCCAGG 0: 1
1: 0
2: 7
3: 97
4: 466
Right 1062567335 9:137169054-137169076 CGAGCGTGTAAACCACGGCCAGG 0: 1
1: 0
2: 0
3: 3
4: 21
1062567319_1062567335 30 Left 1062567319 9:137169001-137169023 CCCAGAGCCCAGCGCCAGGCAGG 0: 1
1: 2
2: 8
3: 62
4: 440
Right 1062567335 9:137169054-137169076 CGAGCGTGTAAACCACGGCCAGG 0: 1
1: 0
2: 0
3: 3
4: 21
1062567325_1062567335 16 Left 1062567325 9:137169015-137169037 CCAGGCAGGAAGCCAGGCTGACG 0: 1
1: 1
2: 3
3: 32
4: 270
Right 1062567335 9:137169054-137169076 CGAGCGTGTAAACCACGGCCAGG 0: 1
1: 0
2: 0
3: 3
4: 21
1062567322_1062567335 23 Left 1062567322 9:137169008-137169030 CCCAGCGCCAGGCAGGAAGCCAG 0: 1
1: 0
2: 2
3: 45
4: 376
Right 1062567335 9:137169054-137169076 CGAGCGTGTAAACCACGGCCAGG 0: 1
1: 0
2: 0
3: 3
4: 21
1062567321_1062567335 29 Left 1062567321 9:137169002-137169024 CCAGAGCCCAGCGCCAGGCAGGA 0: 1
1: 1
2: 6
3: 49
4: 553
Right 1062567335 9:137169054-137169076 CGAGCGTGTAAACCACGGCCAGG 0: 1
1: 0
2: 0
3: 3
4: 21

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1062567335 Original CRISPR CGAGCGTGTAAACCACGGCC AGG Exonic
1070427488 10:76303842-76303864 CGAGCGTGTTAGCCGCTGCCTGG - Intronic
1076716373 10:132366264-132366286 CGAGCGTGTCAGCCATGGTCCGG - Intronic
1094604475 12:31938700-31938722 AGAGCCTGTTAACCATGGCCAGG + Intergenic
1103912978 12:124362375-124362397 CCAGCCTGGAAACCAAGGCCCGG + Intronic
1122711641 14:103662910-103662932 CTAGCCTGTACACCAAGGCCAGG - Exonic
1124126991 15:26945272-26945294 CGAGCGTGAATACCACAGCCTGG + Intronic
1125834246 15:42736462-42736484 CGAGCGTGGAGGCCGCGGCCTGG - Exonic
1131071313 15:89467934-89467956 AGAGCCTGTTAACCATGGCCAGG - Intergenic
1135050877 16:19192122-19192144 TGAGAGTGTAAGCCATGGCCAGG + Intronic
1143437296 17:6938829-6938851 AGAGCCTGTTAACCACGGCCAGG + Intronic
1151919397 17:77141680-77141702 CGAGCTTGTGAACCACAGCCAGG - Intronic
1161170058 19:2808066-2808088 GCAGCATGAAAACCACGGCCAGG - Intronic
940376674 2:152965909-152965931 AGAGCCTGTTAACCAAGGCCAGG + Intergenic
1176013397 20:62913152-62913174 AGAGCGTGGAGGCCACGGCCAGG - Intronic
1176036839 20:63043781-63043803 CGAGTGTGTGCACCACGACCTGG - Intergenic
981054869 4:140350289-140350311 CGAGCTTCTAAAACACAGCCTGG + Intronic
985696555 5:1344428-1344450 TGAGCGTGTACACCACGACGAGG - Exonic
1004398434 6:15266912-15266934 TGAGAATTTAAACCACGGCCTGG - Intronic
1019712633 7:2524544-2524566 CGAGTGGGGAAACCAAGGCCCGG + Intronic
1035412027 7:158652194-158652216 CGAGCGTGAACAGCACAGCCAGG + Intronic
1043592645 8:81848085-81848107 AGAGCCTGTTAACCATGGCCAGG - Intergenic
1045496303 8:102712307-102712329 CCAGCATGTAAAACAGGGCCTGG + Intergenic
1062048157 9:134433901-134433923 CGACTGTGGAACCCACGGCCAGG - Intronic
1062567335 9:137169054-137169076 CGAGCGTGTAAACCACGGCCAGG + Exonic
1185623312 X:1466462-1466484 CCAGCGAGTACACCACGGGCAGG + Exonic