ID: 1062567382

View in Genome Browser
Species Human (GRCh38)
Location 9:137169265-137169287
Sequence GCTCACCTGACGCGGGCAGC GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 86
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 77}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1062567373_1062567382 -4 Left 1062567373 9:137169246-137169268 CCGACCCGCGTCCCCAGCAGCTC 0: 1
1: 0
2: 2
3: 23
4: 306
Right 1062567382 9:137169265-137169287 GCTCACCTGACGCGGGCAGCGGG 0: 1
1: 0
2: 0
3: 8
4: 77
1062567372_1062567382 -3 Left 1062567372 9:137169245-137169267 CCCGACCCGCGTCCCCAGCAGCT 0: 1
1: 0
2: 3
3: 16
4: 259
Right 1062567382 9:137169265-137169287 GCTCACCTGACGCGGGCAGCGGG 0: 1
1: 0
2: 0
3: 8
4: 77
1062567369_1062567382 7 Left 1062567369 9:137169235-137169257 CCCTGCAGACCCCGACCCGCGTC 0: 1
1: 0
2: 0
3: 7
4: 71
Right 1062567382 9:137169265-137169287 GCTCACCTGACGCGGGCAGCGGG 0: 1
1: 0
2: 0
3: 8
4: 77
1062567374_1062567382 -8 Left 1062567374 9:137169250-137169272 CCCGCGTCCCCAGCAGCTCACCT 0: 1
1: 0
2: 1
3: 32
4: 294
Right 1062567382 9:137169265-137169287 GCTCACCTGACGCGGGCAGCGGG 0: 1
1: 0
2: 0
3: 8
4: 77
1062567367_1062567382 15 Left 1062567367 9:137169227-137169249 CCGCACCGCCCTGCAGACCCCGA 0: 1
1: 0
2: 1
3: 31
4: 272
Right 1062567382 9:137169265-137169287 GCTCACCTGACGCGGGCAGCGGG 0: 1
1: 0
2: 0
3: 8
4: 77
1062567375_1062567382 -9 Left 1062567375 9:137169251-137169273 CCGCGTCCCCAGCAGCTCACCTG 0: 1
1: 0
2: 1
3: 40
4: 336
Right 1062567382 9:137169265-137169287 GCTCACCTGACGCGGGCAGCGGG 0: 1
1: 0
2: 0
3: 8
4: 77
1062567370_1062567382 6 Left 1062567370 9:137169236-137169258 CCTGCAGACCCCGACCCGCGTCC 0: 1
1: 0
2: 0
3: 10
4: 176
Right 1062567382 9:137169265-137169287 GCTCACCTGACGCGGGCAGCGGG 0: 1
1: 0
2: 0
3: 8
4: 77
1062567371_1062567382 -2 Left 1062567371 9:137169244-137169266 CCCCGACCCGCGTCCCCAGCAGC 0: 1
1: 0
2: 1
3: 34
4: 253
Right 1062567382 9:137169265-137169287 GCTCACCTGACGCGGGCAGCGGG 0: 1
1: 0
2: 0
3: 8
4: 77
1062567368_1062567382 10 Left 1062567368 9:137169232-137169254 CCGCCCTGCAGACCCCGACCCGC 0: 1
1: 0
2: 0
3: 37
4: 345
Right 1062567382 9:137169265-137169287 GCTCACCTGACGCGGGCAGCGGG 0: 1
1: 0
2: 0
3: 8
4: 77

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1062567382 Original CRISPR GCTCACCTGACGCGGGCAGC GGG Exonic