ID: 1062567382

View in Genome Browser
Species Human (GRCh38)
Location 9:137169265-137169287
Sequence GCTCACCTGACGCGGGCAGC GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 86
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 77}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1062567372_1062567382 -3 Left 1062567372 9:137169245-137169267 CCCGACCCGCGTCCCCAGCAGCT 0: 1
1: 0
2: 3
3: 16
4: 259
Right 1062567382 9:137169265-137169287 GCTCACCTGACGCGGGCAGCGGG 0: 1
1: 0
2: 0
3: 8
4: 77
1062567369_1062567382 7 Left 1062567369 9:137169235-137169257 CCCTGCAGACCCCGACCCGCGTC 0: 1
1: 0
2: 0
3: 7
4: 71
Right 1062567382 9:137169265-137169287 GCTCACCTGACGCGGGCAGCGGG 0: 1
1: 0
2: 0
3: 8
4: 77
1062567373_1062567382 -4 Left 1062567373 9:137169246-137169268 CCGACCCGCGTCCCCAGCAGCTC 0: 1
1: 0
2: 2
3: 23
4: 306
Right 1062567382 9:137169265-137169287 GCTCACCTGACGCGGGCAGCGGG 0: 1
1: 0
2: 0
3: 8
4: 77
1062567368_1062567382 10 Left 1062567368 9:137169232-137169254 CCGCCCTGCAGACCCCGACCCGC 0: 1
1: 0
2: 0
3: 37
4: 345
Right 1062567382 9:137169265-137169287 GCTCACCTGACGCGGGCAGCGGG 0: 1
1: 0
2: 0
3: 8
4: 77
1062567367_1062567382 15 Left 1062567367 9:137169227-137169249 CCGCACCGCCCTGCAGACCCCGA 0: 1
1: 0
2: 1
3: 31
4: 272
Right 1062567382 9:137169265-137169287 GCTCACCTGACGCGGGCAGCGGG 0: 1
1: 0
2: 0
3: 8
4: 77
1062567370_1062567382 6 Left 1062567370 9:137169236-137169258 CCTGCAGACCCCGACCCGCGTCC 0: 1
1: 0
2: 0
3: 10
4: 176
Right 1062567382 9:137169265-137169287 GCTCACCTGACGCGGGCAGCGGG 0: 1
1: 0
2: 0
3: 8
4: 77
1062567374_1062567382 -8 Left 1062567374 9:137169250-137169272 CCCGCGTCCCCAGCAGCTCACCT 0: 1
1: 0
2: 1
3: 32
4: 294
Right 1062567382 9:137169265-137169287 GCTCACCTGACGCGGGCAGCGGG 0: 1
1: 0
2: 0
3: 8
4: 77
1062567371_1062567382 -2 Left 1062567371 9:137169244-137169266 CCCCGACCCGCGTCCCCAGCAGC 0: 1
1: 0
2: 1
3: 34
4: 253
Right 1062567382 9:137169265-137169287 GCTCACCTGACGCGGGCAGCGGG 0: 1
1: 0
2: 0
3: 8
4: 77
1062567375_1062567382 -9 Left 1062567375 9:137169251-137169273 CCGCGTCCCCAGCAGCTCACCTG 0: 1
1: 0
2: 1
3: 40
4: 336
Right 1062567382 9:137169265-137169287 GCTCACCTGACGCGGGCAGCGGG 0: 1
1: 0
2: 0
3: 8
4: 77

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1062567382 Original CRISPR GCTCACCTGACGCGGGCAGC GGG Exonic
900174865 1:1287207-1287229 CCTCCCATGCCGCGGGCAGCAGG - Exonic
900427950 1:2589024-2589046 GCTCACCTGAGGCGGGTCGCTGG - Exonic
900666065 1:3816339-3816361 GCTCACCTGATGGGCCCAGCCGG - Exonic
906668577 1:47638739-47638761 GCTCACCTGCCTGGGGCAGAGGG + Intergenic
908767140 1:67564448-67564470 GCTGTCCTGACGTGAGCAGCTGG + Intergenic
912337636 1:108877212-108877234 GCTCACCTCCCGCGGGCGGGCGG - Exonic
913600184 1:120415019-120415041 GCTCTCCTGACGCGCCGAGCGGG + Intergenic
914311735 1:146472568-146472590 GCTCTCCTGACGCGCCGAGCGGG + Intergenic
914590680 1:149103537-149103559 GCTCTCCTGACGCGCCGAGCGGG - Exonic
922768928 1:228171510-228171532 GCTCAGCAGATGGGGGCAGCAGG + Intronic
1067155962 10:43781671-43781693 GCTCACCTTCCCCAGGCAGCAGG - Intergenic
1068947517 10:62744387-62744409 GCTCATCTGACCTGGACAGCAGG + Intergenic
1072825016 10:98598311-98598333 GCTAACCTGACCCAGGCACCAGG - Intronic
1074470374 10:113721441-113721463 GCTCACCTGTTGCGGGCAGGTGG + Intronic
1079081203 11:17414795-17414817 TCTCAACTGACTGGGGCAGCAGG + Intronic
1080640388 11:34155119-34155141 GCTCCCCTGATGCCTGCAGCAGG + Intronic
1081542952 11:44049331-44049353 GATCACTTGACCCCGGCAGCTGG + Intronic
1083222883 11:61264950-61264972 GCTCACCTGGCACGTGCACCGGG + Exonic
1084175295 11:67419645-67419667 TCTCACCTGAGCAGGGCAGCTGG - Exonic
1089069310 11:115687150-115687172 GCTCACCCAACGTGGGCAGCAGG - Intergenic
1090380796 11:126326319-126326341 GCTGACCTGCCGTGGGCAGATGG + Intronic
1104695745 12:130862397-130862419 GCTCACCTGCCTCAGCCAGCTGG + Intergenic
1113640597 13:111954224-111954246 GCTCATCTGAAGCTGGTAGCAGG - Intergenic
1122153711 14:99738102-99738124 GCTCTCCTGGGGCTGGCAGCCGG + Intronic
1122375929 14:101257427-101257449 GCTCACCTGATGCAGGCTCCAGG - Intergenic
1129748390 15:78041347-78041369 GCTCAGCTGGTGGGGGCAGCAGG + Intronic
1131466046 15:92655574-92655596 GCTCTGCTGGCGCGGGCGGCGGG + Exonic
1132501812 16:287835-287857 GGTCACCTGAAGCTGGCAGCAGG + Exonic
1133113908 16:3565105-3565127 GCTCACCTGTCCCAGGCTGCTGG - Exonic
1139584520 16:67893355-67893377 CCTCACCTCGCGCGGGCGGCGGG - Exonic
1139656297 16:68389112-68389134 GCTCTCCTGGCTCTGGCAGCTGG + Intronic
1142132751 16:88438349-88438371 GCACACCTGCCACGGGCACCCGG - Exonic
1142851744 17:2707824-2707846 GGTCACCTGCAGGGGGCAGCAGG - Intronic
1143599757 17:7936793-7936815 GCTCACCAGAAGCAAGCAGCAGG + Exonic
1143635726 17:8162872-8162894 ACTCACATGGCGGGGGCAGCGGG + Exonic
1152296783 17:79472069-79472091 GCACACCTGCAGAGGGCAGCTGG - Intronic
1152635509 17:81429107-81429129 CCCCACCTGACACGGACAGCGGG - Intronic
1152903303 17:82957353-82957375 GCTCACCTTGCGCTGGCTGCCGG + Exonic
1155268653 18:24118280-24118302 GCTCGCCTGACGTGGGCAGATGG + Intronic
1157324318 18:46657787-46657809 GCTCACCTGGCAGGGGGAGCGGG - Intergenic
1161382892 19:3975850-3975872 GCTCAGCAGACCCGCGCAGCTGG + Intergenic
925060778 2:888517-888539 GCGCACGAGACGCGGGCAGGCGG + Intergenic
925410286 2:3635790-3635812 GCTCTCCTGATGCTGGCAGCTGG - Intronic
926045240 2:9705026-9705048 GCTCTTCTGATGGGGGCAGCAGG + Intergenic
933705116 2:85283880-85283902 GCCCACGTGAAGTGGGCAGCGGG - Intronic
1173684056 20:44910320-44910342 GCTCACCGTCCGCGGGCTGCTGG - Exonic
1175073203 20:56351943-56351965 GCTCACCTGAAGCGGCTAGCAGG + Intergenic
1175737048 20:61394346-61394368 GCTCACCTGCCGCTGGTCGCTGG - Intronic
1175771368 20:61626636-61626658 GCTTAGCTAACGTGGGCAGCAGG + Intronic
1176377289 21:6092890-6092912 GCCCACCAGCAGCGGGCAGCAGG - Intergenic
1179746185 21:43445354-43445376 GCCCACCAGCAGCGGGCAGCAGG + Intergenic
1183499049 22:38167502-38167524 GCACAGCTGACCAGGGCAGCGGG - Intronic
1184493724 22:44825436-44825458 TCTCACCTGGCAGGGGCAGCTGG - Intronic
1184662346 22:45971193-45971215 GGTCGCCTGACGCGGCCAGAGGG - Intronic
1185026610 22:48417729-48417751 GCTCAGCTCACCCCGGCAGCTGG + Intergenic
950161241 3:10762871-10762893 GCTCCCCTGAGCCGTGCAGCTGG - Intergenic
950289341 3:11770991-11771013 GCAGCCCTGAGGCGGGCAGCTGG + Intergenic
955257046 3:57342983-57343005 GATCACCTGAGCCGGGCAGGTGG + Intronic
956640542 3:71411647-71411669 GATCACCTGATGCTGGCAGGTGG + Intronic
962218181 3:133540931-133540953 GCTCAGCTGAGGCTGTCAGCAGG - Intergenic
962588098 3:136862303-136862325 GCTCACCTGAGGAGGGCTCCAGG - Exonic
965390136 3:168095071-168095093 GCTAACGGGACGCGCGCAGCCGG - Intronic
968830493 4:2931055-2931077 CCTCACCTGAAGCGGCCACCAGG + Exonic
973773515 4:54226754-54226776 GCCCTCCTGAGGCGGGCTGCGGG - Intronic
986315456 5:6583568-6583590 GAGCACCTGACGCGCGCATCGGG - Intergenic
987050424 5:14143607-14143629 GCGCGCCGGGCGCGGGCAGCTGG + Intergenic
993654267 5:90558663-90558685 GCTCACCTGACCAGCGGAGCGGG - Intronic
997624928 5:135325089-135325111 GCTGACCTGACCCGTGCAGGGGG + Intronic
999115849 5:149162799-149162821 GCTAACCTGACCAGGGCAGTGGG + Intronic
1003964682 6:11241781-11241803 CCTCAGCTGATGAGGGCAGCGGG - Intronic
1009437798 6:63636849-63636871 GATCACCTGACACGGGGGGCGGG + Intronic
1018082125 6:160268097-160268119 CCTCCCCTGATGTGGGCAGCTGG + Intronic
1022675413 7:32495265-32495287 GCTTACGTGACCCGGGCGGCTGG - Intronic
1029591081 7:101507506-101507528 GATCACCTGAGGCGGGGAGGTGG - Intronic
1031986173 7:128166181-128166203 TCCTACCTGAGGCGGGCAGCTGG + Intergenic
1049562504 8:143318715-143318737 CCTCACCAGACACGGGCAGGAGG + Intronic
1049612324 8:143561407-143561429 TCTCACCTGTCGCGGGTGGCTGG - Exonic
1055980428 9:81995056-81995078 GCTGACCTGACGCCGGCAAGTGG - Exonic
1056622750 9:88227731-88227753 GCTCACATGATTGGGGCAGCTGG - Intergenic
1057645997 9:96875785-96875807 GCTCACCTGAAGTGGGACGCGGG - Intergenic
1060230440 9:121821663-121821685 GCTCCCCTGACCCTGGCACCAGG + Intergenic
1062527740 9:136985121-136985143 GCTCACCCGACTTCGGCAGCAGG - Exonic
1062567382 9:137169265-137169287 GCTCACCTGACGCGGGCAGCGGG + Exonic
1187400017 X:18951098-18951120 GCTCACCTGAGGCGGTCATCTGG + Exonic
1188694963 X:33178888-33178910 GGTCACATGATGCAGGCAGCTGG + Intronic
1192663520 X:73067552-73067574 GATCACCTGAGGCGAGGAGCTGG - Intergenic