ID: 1062567786

View in Genome Browser
Species Human (GRCh38)
Location 9:137170964-137170986
Sequence CCACCTGAGTAGAGGGCTGA GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 190
Summary {0: 1, 1: 0, 2: 1, 3: 16, 4: 172}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1062567786_1062567804 23 Left 1062567786 9:137170964-137170986 CCCTCAGCCCTCTACTCAGGTGG 0: 1
1: 0
2: 1
3: 16
4: 172
Right 1062567804 9:137171010-137171032 CCTCTGAAGAAGCCTCCATGGGG 0: 1
1: 0
2: 4
3: 8
4: 181
1062567786_1062567801 21 Left 1062567786 9:137170964-137170986 CCCTCAGCCCTCTACTCAGGTGG 0: 1
1: 0
2: 1
3: 16
4: 172
Right 1062567801 9:137171008-137171030 CTCCTCTGAAGAAGCCTCCATGG 0: 1
1: 0
2: 0
3: 22
4: 224
1062567786_1062567802 22 Left 1062567786 9:137170964-137170986 CCCTCAGCCCTCTACTCAGGTGG 0: 1
1: 0
2: 1
3: 16
4: 172
Right 1062567802 9:137171009-137171031 TCCTCTGAAGAAGCCTCCATGGG 0: 1
1: 0
2: 0
3: 17
4: 166
1062567786_1062567800 -2 Left 1062567786 9:137170964-137170986 CCCTCAGCCCTCTACTCAGGTGG 0: 1
1: 0
2: 1
3: 16
4: 172
Right 1062567800 9:137170985-137171007 GGTAGGGGCGGGGGTGGTGGCGG 0: 1
1: 1
2: 51
3: 783
4: 6356
1062567786_1062567798 -8 Left 1062567786 9:137170964-137170986 CCCTCAGCCCTCTACTCAGGTGG 0: 1
1: 0
2: 1
3: 16
4: 172
Right 1062567798 9:137170979-137171001 TCAGGTGGTAGGGGCGGGGGTGG 0: 1
1: 0
2: 4
3: 70
4: 848
1062567786_1062567805 27 Left 1062567786 9:137170964-137170986 CCCTCAGCCCTCTACTCAGGTGG 0: 1
1: 0
2: 1
3: 16
4: 172
Right 1062567805 9:137171014-137171036 TGAAGAAGCCTCCATGGGGATGG 0: 1
1: 0
2: 1
3: 33
4: 356
1062567786_1062567799 -5 Left 1062567786 9:137170964-137170986 CCCTCAGCCCTCTACTCAGGTGG 0: 1
1: 0
2: 1
3: 16
4: 172
Right 1062567799 9:137170982-137171004 GGTGGTAGGGGCGGGGGTGGTGG 0: 1
1: 1
2: 61
3: 827
4: 7304

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1062567786 Original CRISPR CCACCTGAGTAGAGGGCTGA GGG (reversed) Exonic
900992911 1:6106220-6106242 CCAGCTGAGGTGAGGGCTGCTGG - Exonic
901002511 1:6155595-6155617 CCACCTGAGGAACTGGCTGAAGG + Exonic
904049089 1:27627283-27627305 CCAACTGAGAAGGGGTCTGAAGG - Intronic
905561477 1:38930681-38930703 ACACCAGAGCACAGGGCTGAAGG + Intronic
905647512 1:39634611-39634633 CCATCTGAGTTGAGATCTGATGG - Intronic
906142177 1:43540362-43540384 CCACTTGAGCAGAGTTCTGAGGG + Intronic
907457588 1:54585389-54585411 GCACCTGAGTGGAGTCCTGAGGG + Intronic
907494637 1:54835786-54835808 CAGCCTGAGAAGAGGGATGAAGG + Intronic
908311709 1:62890748-62890770 CCATCTGAGTGTAGGTCTGATGG - Intergenic
908894643 1:68884716-68884738 CATCCAAAGTAGAGGGCTGAAGG - Intergenic
909542195 1:76803521-76803543 CCACTCGAGTAAATGGCTGAAGG - Intergenic
911501035 1:98684500-98684522 CCACCTTATAAGAGGGCTGTAGG - Intronic
911832715 1:102574653-102574675 CCACCGTAGTAGAGTCCTGAAGG + Intergenic
915849482 1:159305998-159306020 CCACCTCAGCAGAGGCCTGAAGG - Exonic
916098655 1:161374238-161374260 AAACCTTAGTAGAGAGCTGATGG - Exonic
920264553 1:204712114-204712136 GCAGCTGAGTAGAGGGATGGAGG - Intergenic
920642718 1:207769306-207769328 CCTCCTGAGTTGAGTGCTGTAGG + Intronic
920884271 1:209911334-209911356 TCACCTGAGTAAATGGCTGTAGG - Intergenic
922351496 1:224737824-224737846 CAACCTGAGAAGTGGGGTGATGG - Intronic
923603866 1:235425836-235425858 GCATCTGAGCAGAGAGCTGAGGG - Intronic
1064932242 10:20640714-20640736 CCCACTGAGAAGAGGGCTGTGGG + Intergenic
1075400005 10:122154089-122154111 CCAGCTGAGGCCAGGGCTGAAGG - Intronic
1076440327 10:130477022-130477044 CTACCTGGGAAGAGGGATGATGG - Intergenic
1076466111 10:130682749-130682771 TCACCTGAGTAGATGGCGGTGGG - Intergenic
1077159657 11:1106961-1106983 CACCCTGAGCAGAGTGCTGAGGG - Intergenic
1077277476 11:1720957-1720979 CCATCTTGGGAGAGGGCTGAGGG + Intergenic
1078725977 11:13931388-13931410 CCTCAGGAGTAGAGGGATGAGGG + Intergenic
1079341333 11:19613997-19614019 CAACCTGATAATAGGGCTGAAGG + Intronic
1081867189 11:46366433-46366455 CCTCCTGAGTTGCGGGGTGAGGG + Exonic
1084568040 11:69942708-69942730 ACACTTGAGTTGAGGCCTGAAGG - Intergenic
1084629999 11:70341806-70341828 CCAACTGGGTAGAGTGCTCAGGG + Intronic
1085620844 11:78037092-78037114 ACACCTGAGTAGGGGACAGAGGG - Intronic
1086351426 11:85945709-85945731 CAACCTGAGCTGAGGTCTGAGGG - Intergenic
1089699639 11:120236804-120236826 CCACCTGTGTATAGGGTTGAGGG - Intronic
1090548489 11:127792301-127792323 CCCGCTGAGCAGAGGGCTGAAGG - Intergenic
1095791588 12:46174076-46174098 ACACCTGAGAAGAGACCTGAGGG + Intergenic
1095942464 12:47735982-47736004 TCGCCTCAGTTGAGGGCTGAGGG - Intronic
1100068683 12:90683143-90683165 CCACCTATGGACAGGGCTGATGG + Intergenic
1100243265 12:92730896-92730918 ACTCCTGAGAAGAGGGCAGAGGG - Intronic
1104427188 12:128687481-128687503 CCACCAGATTAAAGAGCTGAAGG + Intronic
1104970195 12:132527568-132527590 CCATCCGAGTTGAGGGCTGCGGG + Intronic
1105012724 12:132766461-132766483 CCATCTGAAGTGAGGGCTGAAGG - Intergenic
1105885449 13:24637799-24637821 TCAGCTGAGGTGAGGGCTGAGGG + Intergenic
1106340651 13:28823588-28823610 CCAGTTGAGAAGAGGGCTCAGGG - Intronic
1107966721 13:45604048-45604070 CCACCTGTGTAGAGAGCTCTTGG - Intronic
1111422077 13:88025218-88025240 CCACCTAAGAAGAAGGCTAAAGG - Intergenic
1112106707 13:96248264-96248286 CAACCTGAGCCGAGGGCTTAAGG - Intronic
1118252574 14:64176567-64176589 CCAGCAGAGGAGAGGGGTGACGG + Intronic
1118442090 14:65821434-65821456 CCACCTGAGCAGCAGGCTGTGGG - Intergenic
1121145978 14:91582742-91582764 CCACCTGACTGCAGGGGTGAGGG + Intronic
1122293425 14:100691948-100691970 CCACCTGACACGCGGGCTGATGG - Intergenic
1125592518 15:40863800-40863822 CCCCCTGAGTATAGGGCTGATGG + Intergenic
1127395581 15:58541766-58541788 CCACCTGAGGAGGGGACAGAGGG - Exonic
1129054480 15:72809185-72809207 CCACCTGAACTGAGGGCTGTGGG - Intergenic
1129077219 15:73007562-73007584 GCAGCTGAGTTGAGAGCTGATGG - Intergenic
1129198318 15:73983996-73984018 CTACATGAGTGGACGGCTGAAGG - Exonic
1129688527 15:77700088-77700110 CCAGCAGAGGGGAGGGCTGAGGG + Intronic
1129723615 15:77890837-77890859 CCATCTGAATACAGGGCAGAGGG - Intergenic
1132615933 16:841096-841118 CCACCTGAGAAAGGGGCTCAGGG - Intergenic
1135298017 16:21300299-21300321 TCATCTGAGTTGGGGGCTGAAGG + Intronic
1137671893 16:50284033-50284055 CCAACTGAGTCGAGGGCTGGTGG + Intronic
1138166355 16:54805339-54805361 CCTCCTGAGCATATGGCTGATGG + Intergenic
1138537278 16:57666774-57666796 CCACCTGGGAAGTGGGCAGAGGG - Intergenic
1139384254 16:66554369-66554391 CCACCTGAGTAAAGGCATGGAGG + Intronic
1140988890 16:80188806-80188828 ACATCTGAGCAGAGGCCTGAAGG - Intergenic
1141181162 16:81754182-81754204 CCACCTGAGTTGAGAGGGGATGG + Intronic
1141256829 16:82410110-82410132 CCACGTGAATGGAGGGCTCAGGG - Intergenic
1147423619 17:40334780-40334802 CCACCTGGGGAAAGGGATGAGGG - Intronic
1147964157 17:44184756-44184778 CCTCCTGAGTAGCTGGCTCATGG + Intergenic
1148544207 17:48504473-48504495 CCACCTGAGCACAGGGGTCATGG - Intergenic
1150099445 17:62409418-62409440 CCAGCTGATTAGGAGGCTGAGGG + Intronic
1150288969 17:63970998-63971020 CCACGTGACCAGAGGGCAGATGG - Intronic
1152253764 17:79225687-79225709 CCAGCTGGGTAGGGGGCTGCTGG + Intronic
1152617081 17:81342949-81342971 CCGCCTGAGAAGGGGGCGGAAGG - Intergenic
1153253819 18:3150443-3150465 CCACCTTTGTAGAGGACTGCTGG - Intronic
1155676054 18:28430078-28430100 CCACCTGAGAAGAGGGATTATGG + Intergenic
1156637449 18:39048734-39048756 CCACCTCAGTAGACGGTTTATGG - Intergenic
1157343108 18:46797487-46797509 CCAGCTGAGGAAAGAGCTGATGG + Intergenic
1157412120 18:47471832-47471854 GCACCTGATTAGAGGGTTGCGGG + Intergenic
1159030740 18:63228347-63228369 ACACTTGAGCAGAGGCCTGAAGG - Intronic
1161508350 19:4656527-4656549 CCACATGAGGAAAGGACTGACGG - Intronic
1161510693 19:4669676-4669698 CAAGCTGAGTACAGGGCTGAGGG + Intronic
1162971934 19:14185947-14185969 CTATCTGAGCAGAGGCCTGAAGG - Intronic
1163544283 19:17931946-17931968 CGACCTGAGCAGAGAGCTAATGG + Intergenic
1164852802 19:31498941-31498963 CCAACAGAGCTGAGGGCTGAGGG + Intergenic
1165774945 19:38398982-38399004 CCACCAGAGCTGAGGGCGGAGGG + Intergenic
1168292171 19:55362115-55362137 ACCCCTGAGTAGAGGGAGGAGGG - Intronic
925746634 2:7049134-7049156 CCCTCTGAGTTGAGGGTTGAAGG + Intronic
926651789 2:15354722-15354744 CTAGCTGAGAAGAGGGCTCAGGG - Intronic
929546691 2:42860336-42860358 CCATCTGAGTAGAGGAATGAAGG + Intergenic
931589400 2:63865315-63865337 CCAGCTGCCTAGAGGGCTGAAGG + Intronic
933748970 2:85591039-85591061 CCAGCTGAGTGGAAGGCTGGAGG + Intronic
935193043 2:100793574-100793596 ACAGATGAGTAGATGGCTGATGG - Intergenic
936960847 2:118072993-118073015 TCAACTGTGTAGAGGGCTCAAGG - Intergenic
937261340 2:120588366-120588388 ACACCTGAGCAGAGACCTGAGGG + Intergenic
939367378 2:141250616-141250638 ACATCTGAGGAGAGGGCTGTAGG + Intronic
942596029 2:177592687-177592709 CAACCTGAGTAAGTGGCTGAGGG - Intergenic
948281448 2:236750446-236750468 CCACCTGATTTGAGGACTCAGGG - Intergenic
948685459 2:239666970-239666992 ACATCTGAGCAGAGGGCTGGAGG - Intergenic
1168890594 20:1293453-1293475 CCACCTGGGGAGAGGCCTGCGGG + Intronic
1169150098 20:3282818-3282840 CCGCCTGAGCAGAGACCTGAAGG - Intronic
1169270398 20:4194900-4194922 ACATCTGAGTAGAGATCTGAAGG - Intergenic
1172174190 20:32962229-32962251 CCAGCTGCCAAGAGGGCTGATGG - Intergenic
1172426440 20:34859471-34859493 CCACCTGCGTAGAAGGCAGCCGG + Exonic
1173001648 20:39109748-39109770 CCAGCTGAGGAGGGGGCTGCTGG - Intergenic
1174180734 20:48672721-48672743 ACATTTGAGCAGAGGGCTGAGGG - Intronic
1174263038 20:49311238-49311260 ACATCTGAATAGAGAGCTGAAGG + Intergenic
1174584034 20:51593542-51593564 CCACTGGAGCAGAGGGCTGCAGG - Intergenic
1174919210 20:54683670-54683692 AAACCTGAGCAGAGAGCTGAGGG + Intergenic
1175073049 20:56350754-56350776 CCAACTGAGAAGTGGTCTGAAGG + Intergenic
1175723448 20:61301125-61301147 CCATCTGTGAAGCGGGCTGAGGG - Intronic
1176053134 20:63131099-63131121 CCACCTGAGAGGAGGCCTGTCGG + Intergenic
1177500365 21:21947200-21947222 CCACCTGCTCAGAAGGCTGAGGG + Intergenic
1178466552 21:32853683-32853705 CCACCTGAGTGCAGGGGTGGGGG - Intergenic
1178888203 21:36498806-36498828 CCACCTTCGTGCAGGGCTGATGG - Intronic
1179726195 21:43342861-43342883 CCAACTGAGTGCAGGGCAGAGGG - Intergenic
1179795913 21:43783343-43783365 CAACCTGAGTAGAAGTCTGCAGG - Intergenic
1181992567 22:26848510-26848532 ACAGGTGAGCAGAGGGCTGAGGG + Intergenic
1182831412 22:33307536-33307558 GAACCTGAGGAGAGGGCCGAGGG - Intronic
1183228437 22:36565917-36565939 CCACCTGAGTAGAACAGTGAGGG + Intronic
1183293209 22:37015409-37015431 TCACCTGAGAGGAGGGCTGGAGG - Intronic
1184102224 22:42346841-42346863 CCACCTGGAGAGAGGGATGAGGG + Intergenic
949619739 3:5797163-5797185 TCACCTGAGTAGATTACTGATGG + Intergenic
950480050 3:13238435-13238457 ACAGCTGAGTAGAGGCCTGGAGG - Intergenic
950954662 3:17039306-17039328 CCTGCTGAGTAGGGGCCTGAAGG + Intronic
952974474 3:38682221-38682243 CCCACTGAGTAGAGGGGTGGCGG - Intergenic
953189467 3:40670089-40670111 CCATCTTAGTAAAGGGCTGTGGG + Intergenic
953573475 3:44093006-44093028 CCAGCTGTGTAGAAGGCTGGAGG - Intergenic
953697421 3:45170903-45170925 CCACCTGAGCAAAGGCCTGGGGG - Intergenic
954296754 3:49678666-49678688 CTGCCTGAGTAGGTGGCTGAGGG - Intronic
954633840 3:52060983-52061005 CTAGGTGACTAGAGGGCTGAGGG - Intergenic
955764737 3:62330272-62330294 CAATCTAAGTAGAGGGCTGTTGG - Intronic
957931824 3:86888456-86888478 CTACTTGAGTGGAGGGCTTAGGG + Intergenic
958828991 3:99065500-99065522 CCATTTGAATAGAGAGCTGAAGG + Intergenic
963410471 3:144921287-144921309 CCACTGGAGTTGAGGGCTGAAGG + Intergenic
965403385 3:168240719-168240741 CCACCAGAGAAGATGGCTGAGGG - Intergenic
966774894 3:183535350-183535372 ACACCTGAGTTCAGGACTGATGG - Intronic
971016176 4:22491455-22491477 CCCCTTGAGAAGAGGGCTCAAGG - Intronic
978371228 4:108031302-108031324 ACACCTGAGCAGAGGCCTGGAGG + Intronic
979302736 4:119106275-119106297 CCCCCAGAGTAGAGGTGTGATGG + Intergenic
982383127 4:154771038-154771060 ACTCCTGAGTAAAGAGCTGAAGG + Intergenic
982536909 4:156618408-156618430 CCAAATGAGCAGATGGCTGAGGG - Intergenic
986588788 5:9346752-9346774 CCACAGGAGTTGAGAGCTGAGGG + Intronic
986883307 5:12202931-12202953 CCTCAAGAGTAGAGGGATGAAGG - Intergenic
999709339 5:154302504-154302526 CCTCCAGAGCACAGGGCTGATGG + Intronic
1002710198 5:181190656-181190678 CCACCTGGGTAGAGACCGGAGGG - Intergenic
1003100996 6:3176432-3176454 CCACCTGAGTGGAGGGGAGCTGG + Intergenic
1005798797 6:29397104-29397126 CCATCTGGGTACAGAGCTGAGGG - Exonic
1005800515 6:29417684-29417706 CCATCTGGGTACAGAGCTGAGGG - Intronic
1017051558 6:150398346-150398368 CCACCTGAGAAGAGCAATGAGGG - Exonic
1017649506 6:156568002-156568024 CCACCTGAGTAGTGGGTAGCAGG - Intergenic
1018674238 6:166205359-166205381 CTTCCTGAGAAGAGGGCTGGCGG + Intergenic
1018880053 6:167868875-167868897 CCAGCTGCTTGGAGGGCTGAGGG - Intronic
1018883236 6:167905979-167906001 CCTCCTGAGTAGGGGGCTACAGG - Intronic
1018919601 6:168162036-168162058 CCACCTGTGGTGAGGACTGAAGG + Intergenic
1019028410 6:168991203-168991225 GCACCTGAGTAAAGGGCTCCAGG - Intergenic
1019641880 7:2107632-2107654 GCATCTGAGCAGAGGCCTGAGGG - Intronic
1022383346 7:29881095-29881117 CCACCTGAGCAGAGACCTGCAGG - Intronic
1023418404 7:39951834-39951856 TCACCTGAGCACAGGGCTGTAGG - Exonic
1023736901 7:43243385-43243407 CCATCTGAGTAAATGCCTGAGGG + Intronic
1024445289 7:49470630-49470652 AAACCTGAGGAGAGGGCTGTGGG + Intergenic
1025167995 7:56730009-56730031 CCACCTGAGTAGAGGACTACAGG - Intergenic
1028846136 7:95482449-95482471 CAACCTGAGGAAAGGACTGAAGG + Intronic
1033290080 7:140076164-140076186 CCACCTGGGTGGTGGGATGATGG - Intergenic
1034402961 7:150877904-150877926 ACACTGGGGTAGAGGGCTGAGGG + Intergenic
1034967759 7:155401991-155402013 CCACCTGTGTAGAAAGCAGAAGG + Intergenic
1036673768 8:10811876-10811898 CCACCTGGGTAGAGGGGAGGGGG + Intronic
1038334686 8:26636625-26636647 CCACCTGAGAAGAACCCTGAGGG - Intronic
1038348781 8:26757356-26757378 CCACCTGCCTAGAAGGCTGCTGG + Intronic
1044760184 8:95509809-95509831 CCAGGTGAGTAGGGGGCTGTTGG + Intergenic
1047610811 8:126518973-126518995 CCAGCTGAGCAGAGGGGAGAAGG + Intergenic
1048228532 8:132614227-132614249 ACATCTGAGCAGAGGCCTGAAGG + Intronic
1048400128 8:134057944-134057966 ACATCTGAGTACATGGCTGAGGG - Intergenic
1048469097 8:134691325-134691347 CCGCCTGAGCATGGGGCTGAAGG - Intronic
1048984932 8:139730269-139730291 CCACCTGAGGTGGGGGCTGACGG + Intergenic
1049655578 8:143795527-143795549 ACACCTGAGAAGAGGGGTGTGGG + Exonic
1050234734 9:3565933-3565955 CCACATAAGTAGTGGGCTCAAGG + Intergenic
1056792708 9:89636481-89636503 CCTCCTGAGCAAAGGGCTGAGGG + Intergenic
1060063520 9:120482629-120482651 CCACCTGTTTACAAGGCTGAGGG + Intronic
1060100875 9:120840236-120840258 CCAGCTACTTAGAGGGCTGAGGG - Intronic
1061236298 9:129344505-129344527 CCTCCTGAGTAGTGGGATTACGG - Intergenic
1062121048 9:134834185-134834207 TCCCCTGAGTAGAGGGGTGCAGG - Intronic
1062567786 9:137170964-137170986 CCACCTGAGTAGAGGGCTGAGGG - Exonic
1062720291 9:138038426-138038448 CCACCAGAGTACAGGGGTGGGGG - Intronic
1189960862 X:46323677-46323699 CCAACTGAGTAGAGGACTCAGGG - Intergenic
1190715046 X:53096053-53096075 ACAGCTGAGTAGAGGCCTGAAGG - Intergenic
1192671135 X:73143100-73143122 CCACCTGGGCAAAGGGCTGATGG - Intergenic
1194585787 X:95732515-95732537 ACACCTGCGGAGAGGGCAGATGG - Intergenic
1196372856 X:114998582-114998604 CCATCTCAGTACAGGTCTGAGGG - Intergenic
1196894467 X:120321442-120321464 CCACATATGTAGGGGGCTGATGG + Intergenic