ID: 1062568038

View in Genome Browser
Species Human (GRCh38)
Location 9:137171889-137171911
Sequence GGGGAAGGGGAGCCATGGCT GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 559
Summary {0: 1, 1: 0, 2: 2, 3: 46, 4: 510}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1062568023_1062568038 11 Left 1062568023 9:137171855-137171877 CCACCAGAAGGACACCAGAGCTC 0: 1
1: 0
2: 0
3: 19
4: 196
Right 1062568038 9:137171889-137171911 GGGGAAGGGGAGCCATGGCTGGG 0: 1
1: 0
2: 2
3: 46
4: 510
1062568018_1062568038 25 Left 1062568018 9:137171841-137171863 CCCTGCCCTGGTAGCCACCAGAA 0: 1
1: 0
2: 0
3: 12
4: 199
Right 1062568038 9:137171889-137171911 GGGGAAGGGGAGCCATGGCTGGG 0: 1
1: 0
2: 2
3: 46
4: 510
1062568017_1062568038 26 Left 1062568017 9:137171840-137171862 CCCCTGCCCTGGTAGCCACCAGA 0: 1
1: 0
2: 2
3: 36
4: 265
Right 1062568038 9:137171889-137171911 GGGGAAGGGGAGCCATGGCTGGG 0: 1
1: 0
2: 2
3: 46
4: 510
1062568022_1062568038 19 Left 1062568022 9:137171847-137171869 CCTGGTAGCCACCAGAAGGACAC 0: 1
1: 0
2: 0
3: 5
4: 146
Right 1062568038 9:137171889-137171911 GGGGAAGGGGAGCCATGGCTGGG 0: 1
1: 0
2: 2
3: 46
4: 510
1062568021_1062568038 20 Left 1062568021 9:137171846-137171868 CCCTGGTAGCCACCAGAAGGACA 0: 1
1: 0
2: 0
3: 9
4: 143
Right 1062568038 9:137171889-137171911 GGGGAAGGGGAGCCATGGCTGGG 0: 1
1: 0
2: 2
3: 46
4: 510
1062568024_1062568038 8 Left 1062568024 9:137171858-137171880 CCAGAAGGACACCAGAGCTCCCA 0: 1
1: 0
2: 0
3: 20
4: 188
Right 1062568038 9:137171889-137171911 GGGGAAGGGGAGCCATGGCTGGG 0: 1
1: 0
2: 2
3: 46
4: 510
1062568026_1062568038 -3 Left 1062568026 9:137171869-137171891 CCAGAGCTCCCACCTTGCCTGGG 0: 1
1: 0
2: 1
3: 39
4: 365
Right 1062568038 9:137171889-137171911 GGGGAAGGGGAGCCATGGCTGGG 0: 1
1: 0
2: 2
3: 46
4: 510
1062568019_1062568038 24 Left 1062568019 9:137171842-137171864 CCTGCCCTGGTAGCCACCAGAAG 0: 1
1: 0
2: 0
3: 12
4: 160
Right 1062568038 9:137171889-137171911 GGGGAAGGGGAGCCATGGCTGGG 0: 1
1: 0
2: 2
3: 46
4: 510

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1062568038 Original CRISPR GGGGAAGGGGAGCCATGGCT GGG Exonic
900182114 1:1315723-1315745 GGGGAAGGGGAGCGAGGGGGCGG + Intronic
900209959 1:1450542-1450564 GAGGATGGGGAGGCAGGGCTGGG + Exonic
900220014 1:1503446-1503468 GAGGATGGGGAGGCAGGGCTGGG + Intergenic
900222321 1:1515873-1515895 GAGGATGGGGAGGCAGGGCTGGG + Intronic
900306523 1:2011829-2011851 GTGGAAGGGGAGCCAGGGTGGGG + Intergenic
900344196 1:2203372-2203394 TGGGCAGGGCAGCCATGGGTGGG - Intronic
900344929 1:2205969-2205991 AGGGATGGGGACCCAGGGCTCGG + Intronic
900592557 1:3466567-3466589 GCTGAAGGGGAGCCATGTGTTGG + Intronic
900692827 1:3992095-3992117 GGGGAAGGGGTGTCATGGAGGGG + Intergenic
900713488 1:4129571-4129593 GGCTCAGGGGAGCCATGGCCAGG + Intergenic
900887877 1:5428252-5428274 GGGGGTGGGGGACCATGGCTGGG + Intergenic
900959888 1:5912170-5912192 GGGGCAGGGGAGCAATGGGATGG + Intronic
901379323 1:8862514-8862536 GTGGATGTGGAGCCAGGGCTGGG - Intronic
902220152 1:14959457-14959479 GGACAAGGGCAGCCCTGGCTGGG - Intronic
902260880 1:15223910-15223932 GGGGAAGGGGAGCCACGAGCAGG + Intergenic
902690137 1:18105972-18105994 GTGGAAGGGGCTCCCTGGCTGGG - Intergenic
903042426 1:20541491-20541513 GGGGAAGGGGAGGGCTGTCTTGG - Intergenic
903192873 1:21666610-21666632 GAGGAAGGGGAGGCTTTGCTGGG + Intronic
903231877 1:21927171-21927193 GGGGAAGGGGAGGCCTGGCTGGG - Intronic
903350384 1:22713129-22713151 GGGGAAGGGAAGCCACAGCAGGG + Intronic
903674815 1:25056850-25056872 TGAGAAGGGGAACCAGGGCTGGG - Intergenic
903947383 1:26972286-26972308 GGGGAAGGAGAGTCATTGCCAGG + Intergenic
904329524 1:29749181-29749203 GGGGCAGGGAAGGCAAGGCTGGG - Intergenic
905011317 1:34748872-34748894 GTGGAATGGGAGGAATGGCTTGG - Intronic
906108495 1:43308443-43308465 GGGGTAGGGGACCCAGGGATTGG + Intronic
906117235 1:43365049-43365071 AGCGAAGGGGAGGGATGGCTGGG - Intronic
906290678 1:44617573-44617595 GGGCAAGGGCAGCCAAGGCTGGG - Intronic
906331979 1:44893277-44893299 GGGGATAGGCAGCCATGGCAAGG - Intronic
906509784 1:46404493-46404515 GGGTAAGGGGAGGCTTGACTGGG + Intronic
906666314 1:47624592-47624614 GGGGAAGGAGAGCAAAGGGTTGG - Intergenic
906778719 1:48553144-48553166 GGGGAAAGGGAGGCACTGCTGGG - Intronic
906797896 1:48712109-48712131 GGAGAAGGGGAGCCTTGAGTTGG - Intronic
906835697 1:49081697-49081719 GGGGATGGGGAACTTTGGCTTGG - Intronic
908168708 1:61483948-61483970 GGGGAAAGGGAGCCCTGGGCAGG + Intergenic
909733345 1:78924488-78924510 GGGGAAGGGAAGGCATGCCTGGG + Intronic
910392206 1:86756950-86756972 GGGGAAGAGGACCCGAGGCTGGG + Intergenic
911950391 1:104166398-104166420 GGAATAGGGGAGCCATTGCTGGG - Intergenic
912375121 1:109203543-109203565 GGGCAAGGGGAGCAAGGCCTGGG + Intronic
912521677 1:110250129-110250151 GGGAAAGGGGAGCTGTGTCTGGG - Intronic
912625700 1:111203669-111203691 AGGGAAGGGGTGCCCTGTCTGGG + Intronic
912651308 1:111441972-111441994 AGGGAAGGGGAGCAGTGGGTGGG - Intronic
912684104 1:111748649-111748671 GGGGGAGGGGAGGCAAGGGTAGG - Intronic
912797234 1:112700628-112700650 GGGGAGGGGGTGGAATGGCTTGG - Exonic
914196092 1:145448825-145448847 GGGGCAGGGGGGCCTTGGCTCGG - Intergenic
914827256 1:151145298-151145320 GGAGAAGGGGAGACTGGGCTGGG + Intronic
915319341 1:155047722-155047744 GGGGCAGGGCAGCCCTGGGTTGG - Intronic
915328165 1:155092020-155092042 GGGGCTGGGGGGCCATGGATTGG + Intergenic
915505685 1:156354857-156354879 GGAGAAGGGGGGCCTTGGATGGG - Intronic
915531981 1:156508070-156508092 GGGGAGTGGGAGCCAGAGCTAGG - Intergenic
915892156 1:159782359-159782381 GGGGAAGGGGAGTGAGGGCCTGG - Exonic
916174458 1:162025895-162025917 TGGGAGGGGGGGCCATGGCAGGG + Intergenic
916214765 1:162385263-162385285 TGGGAAGGGGAGCAGAGGCTTGG - Intronic
916548557 1:165828446-165828468 GGGGAAGGGGAGCCCAGTGTGGG + Intronic
916694271 1:167220834-167220856 GGGGGAGGGGAGCCAGAGCGAGG + Exonic
917471180 1:175327252-175327274 TGGGAAGGGGAGCCAGGCTTTGG - Intronic
917972806 1:180219558-180219580 GGAGAAGGGGTGCCCTGGGTGGG - Intergenic
918344915 1:183598646-183598668 GGAGAGGGAGAGTCATGGCTTGG + Intergenic
919857915 1:201718296-201718318 GGTGGAGGGGAGGCATTGCTGGG + Intronic
920072316 1:203311269-203311291 AGGGTAGGGGAGCCAGGGATGGG + Intergenic
920212619 1:204339277-204339299 GGGGAGGGGTAGCCCTTGCTTGG - Intronic
921047877 1:211490347-211490369 GTGCAAAGGGAGCCATGGCCAGG + Intronic
921159348 1:212462389-212462411 GGTGCAGGGGAGCCATGGAGTGG + Intergenic
921929556 1:220743994-220744016 GTGGAAGAAGAACCATGGCTAGG - Intergenic
921985023 1:221303452-221303474 GGGGAAGGCGAGGCATGTGTGGG + Intergenic
922412935 1:225393082-225393104 GAGGAAGGGGAGACAGGGTTGGG + Intronic
922989515 1:229894455-229894477 GAGGAAGGGGAGCCCTCACTGGG + Intergenic
924557284 1:245129025-245129047 GGGGAGGGGCAGCCAGGACTGGG + Intergenic
924647411 1:245891485-245891507 GGGGGAGGGGAGCAATGACCTGG + Intronic
1063485631 10:6417959-6417981 GGGGAAGGAGACCCATGTCTGGG - Intergenic
1066249161 10:33616199-33616221 GGGGAAGAGGAGGGGTGGCTAGG - Intergenic
1066323098 10:34325365-34325387 GGGAATGGGGAGCCATCTCTGGG - Intronic
1068894664 10:62186151-62186173 AGGGCAGGGGAGCCAAGGCATGG - Intronic
1069716813 10:70526383-70526405 GCGGAGGAGGAGGCATGGCTGGG + Intronic
1070092110 10:73297496-73297518 GGGGAAAGGGAGAAAGGGCTGGG + Intronic
1070557153 10:77537412-77537434 GGGGAAGGTGGGCCCTGGGTGGG - Intronic
1070570306 10:77636273-77636295 GGGGAAGGGAAGACATCTCTAGG + Intronic
1071427922 10:85578102-85578124 GAGGAAGCGGAGCAATAGCTGGG + Intergenic
1072217309 10:93298236-93298258 AGGGTAGGGGCCCCATGGCTGGG - Intergenic
1073125657 10:101147203-101147225 GGGGAGGAGGAGCCAGGGCTGGG - Intergenic
1073272770 10:102280221-102280243 GGGGATGGGGAGGCAAGGGTAGG + Intronic
1074017026 10:109544827-109544849 CAGGGAGGAGAGCCATGGCTGGG - Intergenic
1074387687 10:113029817-113029839 GGGGATGGGGAGGCTTGGCGCGG - Intronic
1074830128 10:117241848-117241870 GGGGAAGGGGCGCTGGGGCTGGG - Intronic
1075198262 10:120379650-120379672 GGAGAAGAGGAAACATGGCTGGG + Intergenic
1076889668 10:133277353-133277375 GGGGAGGGGGAGCCCTAGGTGGG + Intergenic
1077063357 11:627128-627150 GGGGCCGGGGGGCCATGGCGGGG + Exonic
1077077168 11:707005-707027 GGGGAGGGGGAGGCAGGGCCGGG + Intronic
1077338969 11:2017615-2017637 GGGGAAGGGGAGCCAGGCGGGGG + Intergenic
1077466074 11:2734352-2734374 GAGGCAGGGGAGCAATGGATGGG + Intronic
1077630477 11:3808139-3808161 GGGGGAGGGGCGCCAGGGCTGGG + Intronic
1077843825 11:6002961-6002983 GGGGCAGTGGAGTCATTGCTGGG + Exonic
1077888919 11:6405075-6405097 GGGGGAGGGGAGCCAGGGCGAGG - Intronic
1078307590 11:10205705-10205727 GGGGAAAGGGAGTCAGGGCCAGG - Intronic
1080874756 11:36265501-36265523 GGGGATGGGGGGACATGGCAAGG - Intergenic
1081527504 11:43936784-43936806 GAGGTGGGGGAGTCATGGCTGGG + Intronic
1082808425 11:57464130-57464152 GGGGGAGGTGAGCCCTGGTTGGG + Intronic
1083213842 11:61206324-61206346 GAGGAAGGGACGCCAGGGCTGGG + Intronic
1083216726 11:61225153-61225175 GAGGAAGGGACGCCAGGGCTGGG + Intronic
1083219608 11:61243979-61244001 GAGGAAGGGACGCCAGGGCTGGG + Intronic
1083267597 11:61553972-61553994 GGGGAGGGGGTGGCAGGGCTTGG + Intronic
1083334205 11:61913358-61913380 GGGGAAGGGGAGCCAGAGTAGGG + Intronic
1083890506 11:65593419-65593441 GGGGAAGAGGAGCCTGGACTAGG - Intronic
1084177233 11:67429219-67429241 GGGCAAGGGGGGCTATGGCAAGG + Exonic
1084332231 11:68437019-68437041 GGGGAAGGGGCGTCCGGGCTGGG + Intronic
1084450398 11:69233397-69233419 AGGGAAGGGGAGCCATGCATGGG + Intergenic
1084529187 11:69717098-69717120 GGGGACTGGAAGCCCTGGCTGGG - Intergenic
1084541107 11:69787747-69787769 GGGGAAAGGGAACCGTGGCTGGG + Intergenic
1084595080 11:70112057-70112079 GGGGTAGGGGAGCCCAGGCCAGG - Intronic
1084667414 11:70583897-70583919 GAGAGAGGGGAGGCATGGCTGGG - Intronic
1085313678 11:75530872-75530894 GGTGGAGGGGAGCCATGGGAGGG + Intergenic
1085734840 11:79030326-79030348 GGGTAAGGGGAGCCCAGGTTGGG + Intronic
1086786196 11:90972321-90972343 GGGGAGGAGGAGCCACGGCCGGG - Intergenic
1087400972 11:97667076-97667098 GGGGAGGGAGAGGCATGGGTGGG + Intergenic
1089079584 11:115764553-115764575 GGGGCAGGGGAGGAAGGGCTAGG + Intergenic
1089335743 11:117722381-117722403 GGGGGAGGGGAGCCAGGGAGAGG + Intronic
1089377073 11:118002049-118002071 GGGCAAGGGGAGCCAGGGACAGG - Intergenic
1089401250 11:118166007-118166029 GGGCAGGGGCAGCCAAGGCTGGG - Exonic
1089748663 11:120634787-120634809 GAGGAAGGGAAGCCCTGGCAAGG - Intronic
1090416988 11:126547536-126547558 GGGGTAGGGGACCCACTGCTGGG + Intronic
1090440097 11:126718273-126718295 GGGGCAGGGGCTCCCTGGCTGGG + Intronic
1091229609 11:133979541-133979563 GGGAATGGGTAGCCATGGCCAGG + Intergenic
1202821953 11_KI270721v1_random:72797-72819 GGGGAAGGGGAGCCAGGCGGGGG + Intergenic
1091917967 12:4282782-4282804 GGGGCAGGGCTGCCATGGCAAGG - Intronic
1091980180 12:4858302-4858324 AGAGAAGGGGAGGCATGCCTGGG + Intergenic
1092042406 12:5396094-5396116 GGGGAATGGGAGGCCTGGCTGGG - Intergenic
1093483606 12:19629399-19629421 GGGGAAAGGGAGGAATGGCATGG + Intronic
1093715481 12:22376898-22376920 GTGGAAGGGGAGGCACGGCTGGG + Intronic
1093959511 12:25256827-25256849 GGGGAGGGAAAGCAATGGCTTGG - Intergenic
1095969817 12:47894044-47894066 GGGGAAGGGGAATCATAGCTTGG - Intronic
1096658216 12:53104916-53104938 GGGGAAGGGCAGGCATTGGTGGG - Intronic
1096743907 12:53713281-53713303 TGGGAAGAGCAGCCAAGGCTAGG + Intronic
1097054131 12:56239902-56239924 AAGGAAGAGGGGCCATGGCTGGG + Exonic
1097055028 12:56244018-56244040 GGGGAAGGGGGCTCCTGGCTGGG - Intronic
1097246708 12:57611249-57611271 GGGGCAGGGGAGCACGGGCTGGG + Intronic
1098575924 12:72042322-72042344 TGGGAAGGGGAACAATGGTTGGG + Intronic
1101409871 12:104458610-104458632 GGAGCAGGGGAGCCACGGCTTGG - Intronic
1102012325 12:109626383-109626405 GGGGTGGGGGAGCACTGGCTGGG - Intergenic
1102034777 12:109764955-109764977 CGGGATGGGGGTCCATGGCTGGG + Intronic
1102755403 12:115335508-115335530 GGTGGAGAGGAGCCAGGGCTTGG + Intergenic
1103516197 12:121509877-121509899 GGTGAAGTGGAGCCATCGGTGGG + Exonic
1103764000 12:123269339-123269361 GGGGACGAGGAGCAATAGCTCGG + Intronic
1103861068 12:124014349-124014371 GGGGAAGGGGAGAGATGCCGAGG + Exonic
1104966330 12:132510202-132510224 GGGAATGGGGAGCAACGGCTGGG - Intronic
1105389238 13:19959262-19959284 GGGGGAGGGGCGCCCCGGCTGGG + Intronic
1105416664 13:20219151-20219173 GGGGCAGGAGAACCATGGTTAGG + Intergenic
1105704355 13:22960264-22960286 GGGGAAGGAGAGCCTGGGCCTGG + Intergenic
1106473454 13:30077849-30077871 GGGGAAGTTGAGCCCTGGCCAGG - Intergenic
1107135318 13:36938223-36938245 AGGGAAGGGGAGCCAAGGGATGG - Intergenic
1107791462 13:44006297-44006319 GGAGAAGGGGACCCTTGGCCTGG + Intergenic
1108403886 13:50081201-50081223 GGGGGAGGGCAGCCAGGGCTTGG + Intergenic
1113358346 13:109604524-109604546 GAGGCAGGGGAGCCACGGCATGG + Intergenic
1113597700 13:111546351-111546373 GGGGAAGCTGAGGCAGGGCTGGG + Intergenic
1113647211 13:112006982-112007004 GGGGAGGGGGAGTCAGTGCTTGG + Intergenic
1113665868 13:112141982-112142004 GGCCCAGGGGAGCCGTGGCTGGG - Intergenic
1113986591 13:114321458-114321480 CGGGAAGAGGAGGGATGGCTGGG + Intronic
1114172904 14:20291967-20291989 AGGAAAGGTGAGCAATGGCTAGG - Exonic
1114423283 14:22602370-22602392 GAGAAAGGGTAGCTATGGCTGGG - Intronic
1115073492 14:29357173-29357195 GTGGAAATGGAGCAATGGCTGGG - Intergenic
1116870808 14:50067709-50067731 GGGGAAGGGGAGGCAGGACAGGG + Intergenic
1117786941 14:59295798-59295820 TGGGAAGGGAAGCAGTGGCTGGG + Intronic
1117931464 14:60846132-60846154 GGGGAAGGGGAGGCAAGGGGAGG - Intronic
1118470098 14:66067500-66067522 GAAGTAGGGGAGCCAGGGCTTGG - Intergenic
1119032392 14:71202913-71202935 GGGGAAGGGGAGCAAAGGAGAGG + Intergenic
1119702318 14:76763217-76763239 GGGGCAGGGGACCACTGGCTCGG + Intronic
1119774543 14:77240249-77240271 GGGGAAAGTGAGGCATAGCTAGG - Intronic
1119949962 14:78734845-78734867 AGGGAAGAGGAGACAGGGCTTGG + Intronic
1120532839 14:85655247-85655269 GGGGCAGGGAAGCAAGGGCTGGG - Intergenic
1121718113 14:96090568-96090590 GGGGAAGGACAGCATTGGCTTGG - Exonic
1121976011 14:98404738-98404760 GAGGAAGGGAAGCCAAGCCTGGG + Intergenic
1122588958 14:102831656-102831678 GGGCAACGGGACCCATGGCTGGG - Intronic
1122774767 14:104112253-104112275 GGGGATGCTGAGCCCTGGCTGGG - Intronic
1122969125 14:105145304-105145326 GGGGAAGGAGAGGCAGGGCGGGG + Intronic
1124015431 15:25869922-25869944 GGGGATGTGGAGCCCTGGGTGGG - Intergenic
1125626912 15:41116241-41116263 GGACACGGGGAGCCATGGCGGGG + Exonic
1126067462 15:44837144-44837166 GTGGAAGGGCAGGCATGTCTAGG - Intergenic
1126226211 15:46273024-46273046 TGGGAAGGGGAGACATGACTAGG + Intergenic
1126354379 15:47779833-47779855 GGGGGAGGGGAGGAATGGCAGGG - Intergenic
1126799895 15:52289161-52289183 GGGGCAGGGGAGCCAGGGGAGGG - Intronic
1128894186 15:71357568-71357590 GGGGAAAGGGAGCAAGGGCGTGG - Intronic
1128944396 15:71811220-71811242 GGGAAAGTGGAGCTAGGGCTCGG + Intronic
1129274866 15:74438395-74438417 GGGGAGGGTGAGGCATGGCCTGG - Intergenic
1129675322 15:77630185-77630207 GGGGAAGTGGAGCCAGGGAAGGG - Intronic
1129792174 15:78348710-78348732 GGGTCAGGGGAGACTTGGCTTGG + Intergenic
1129843882 15:78759449-78759471 CGGGAGGGGGCGCCGTGGCTGGG + Exonic
1129932012 15:79419138-79419160 GGGGATGGGGAGCGGTGGCATGG + Intronic
1130108820 15:80948715-80948737 GGCGATGGGGAGCCATGGAACGG + Intronic
1130257926 15:82334351-82334373 CGGGAGGGGGAGCCGTGGCTGGG - Intergenic
1130597007 15:85255612-85255634 CGGGAGGGGGCGCCGTGGCTGGG + Intergenic
1131027615 15:89158036-89158058 GAAGATGGGGAGGCATGGCTTGG + Intronic
1131053625 15:89363135-89363157 GGGGTAGGGGGGCAGTGGCTAGG - Intergenic
1131155602 15:90073366-90073388 GGGCAAGAGGAGCCCCGGCTGGG + Intronic
1131506947 15:93027720-93027742 GGGCGAGGGGAGCCATGCCAAGG + Exonic
1132233169 15:100200045-100200067 GAGGAAGCGGAGCCAGCGCTGGG + Intronic
1132750533 16:1455467-1455489 GGGGAAGGTGGGGCAGGGCTGGG + Intronic
1132847376 16:2006726-2006748 GGGGCAGGGGGGAGATGGCTGGG + Intronic
1134008909 16:10836727-10836749 GGGAAAAGGGTGCTATGGCTTGG + Intergenic
1134380762 16:13723277-13723299 GGGTAAGGTGTGCAATGGCTAGG - Intergenic
1134625225 16:15718442-15718464 GGGGAAGGGCGGCCATGGTGGGG + Intronic
1135132200 16:19862205-19862227 GGGGAAGGAGGCCCATGGTTGGG + Intronic
1135257821 16:20955355-20955377 GAGGAAGCGGAGGCATGGCAAGG + Intronic
1135603060 16:23799825-23799847 GGGAAAGGGGAGGAAGGGCTTGG - Intergenic
1135963042 16:27013570-27013592 GGGGAAAGAGAGGCATTGCTGGG - Intergenic
1136365641 16:29807931-29807953 GGGGAAGGGGAGCCACTCCCAGG + Intronic
1136418946 16:30120500-30120522 GGGGGAGGACAGCCAAGGCTAGG + Intronic
1136515439 16:30765344-30765366 GGGGCAGGTGAGGCAAGGCTGGG + Intronic
1136775160 16:32867917-32867939 GAGGAAGGGGAACCAGGGCCTGG + Intergenic
1136895457 16:33993595-33993617 GAGGAAGGGGAACCAGGGCCTGG - Intergenic
1137614611 16:49839047-49839069 GGGGAAGAGGGGGGATGGCTGGG - Intronic
1137711140 16:50567698-50567720 CAGGTAGCGGAGCCATGGCTGGG - Intronic
1138342333 16:56298261-56298283 GGTGAAGAGGAACCCTGGCTGGG + Intronic
1138497368 16:57416539-57416561 GGGGAGAGGGAGCCAGGGCCAGG - Intergenic
1139428172 16:66895932-66895954 GGTGAGGGGGAGCCATGGTTCGG - Intergenic
1139483460 16:67243677-67243699 GGGGAAGTGGAGTGAGGGCTGGG + Intronic
1139633767 16:68245824-68245846 GGATAAGGGGAGGCAAGGCTTGG - Intronic
1140354211 16:74291116-74291138 GGGTGAGGGGAGCCAGGGATGGG - Intergenic
1141127108 16:81408646-81408668 CGGGAAGTGGAGCCACTGCTAGG - Intergenic
1141174827 16:81712006-81712028 GGGGAAGGGGTGCTACTGCTGGG - Intergenic
1141618102 16:85221595-85221617 GGGTAGGGGCAGCCCTGGCTGGG - Intergenic
1141730914 16:85822296-85822318 GCGGCAGGGGAGCCATGGTGGGG + Intergenic
1142026731 16:87818420-87818442 GAGGAGGGGGAGCCAGGGCAGGG + Intergenic
1142361690 16:89630607-89630629 GGGCTGGGGGAGCCAGGGCTGGG + Intronic
1203077578 16_KI270728v1_random:1130026-1130048 GAGGAAGGGGAACCAGGGCCTGG + Intergenic
1142668060 17:1473677-1473699 GGGGAAAGGCAGGCATGGCCAGG - Intronic
1143099377 17:4497043-4497065 CGGGAAGGGGACCCTGGGCTTGG + Intergenic
1143162331 17:4879701-4879723 GGGGGAGGAGGGCAATGGCTGGG + Intronic
1143654424 17:8285622-8285644 GGGGAAGTGGAGCCAAGCGTGGG + Intergenic
1143947253 17:10604232-10604254 GGGGACAAGGAGCCTTGGCTGGG - Intergenic
1144107228 17:11997245-11997267 GGGCCGGGGCAGCCATGGCTGGG - Intronic
1144232972 17:13227717-13227739 GGGCATGGGGAGAGATGGCTAGG + Intergenic
1145066138 17:19762569-19762591 GGGGAAGGAGAGCCAGCGCAAGG + Intergenic
1145268224 17:21390565-21390587 GGGGAGGGGGAGCAATTGCAGGG + Intronic
1145889040 17:28402158-28402180 GCTGATGGGCAGCCATGGCTGGG - Exonic
1146401602 17:32504278-32504300 GGGGAGGGGCAGCCCAGGCTGGG - Intronic
1147142320 17:38466598-38466620 GGGCCCGGGGGGCCATGGCTGGG - Exonic
1147158888 17:38559418-38559440 GGGGAAGGGGAGAAAGGGTTCGG + Intronic
1147600093 17:41740036-41740058 GGGGATGTGGAGCCCTGGTTTGG - Intergenic
1147677624 17:42218939-42218961 GGGGAACGGGAGCTGTGTCTTGG - Intronic
1147688416 17:42300632-42300654 GGGGAACGGGAGCTGTGTCTTGG + Intronic
1147790810 17:43013428-43013450 GGGGAAGTGGAGCTGTGTCTGGG + Intronic
1147909185 17:43844643-43844665 TGGGAAGTGGAGCAAGGGCTGGG - Intergenic
1148050986 17:44769833-44769855 GGGGCGGGGGAGACATGGCTAGG + Intronic
1148065122 17:44863540-44863562 GGGGATGGGGAGGCAAGGGTGGG + Intronic
1148578831 17:48729241-48729263 GGGGAAGGGGAGTCGGGGGTGGG + Intergenic
1148826563 17:50398156-50398178 GGGGAGGGAGGGCCATCGCTGGG - Intergenic
1149641427 17:58205350-58205372 GGGGAAGGGCAGACATGGTAGGG + Intergenic
1149659336 17:58326230-58326252 GGAAGAGGGGAGCCAGGGCTGGG - Intronic
1150186020 17:63182093-63182115 GAAGAAGGGGAGGCAGGGCTCGG - Intronic
1151232370 17:72694140-72694162 GGGGAAGTGGAGCCAGCGGTGGG + Intronic
1151338071 17:73452012-73452034 GGGGAAGGGAGGGCAGGGCTGGG - Intronic
1151653828 17:75486206-75486228 TGGGAAGGGGAGCTGTGGCCTGG + Intronic
1151711344 17:75808796-75808818 GGGGCAGGGGAGCCCAGTCTAGG + Intronic
1151766295 17:76135141-76135163 GGGGAAGGGGGGCAATGTCTGGG - Intergenic
1152103570 17:78316386-78316408 TGGGCAGGGGAGACATGGCTGGG - Intergenic
1152263874 17:79282171-79282193 GGGCATGGGGAGCTATGGGTGGG + Intronic
1152269064 17:79313236-79313258 GGGGTAGGGCAGGCAGGGCTGGG + Intronic
1152419329 17:80183676-80183698 GGGGCATGGGAGTCATGCCTCGG + Intronic
1152463271 17:80452213-80452235 GCAGAAGGGGAGCCCTGGCATGG + Intergenic
1152724556 17:81938867-81938889 AGGGGAGGGGACCCAGGGCTGGG - Intronic
1153060011 18:985495-985517 GGGGGAGGGGAGCCAAGGACAGG - Intergenic
1153412308 18:4807562-4807584 GGGAAAAGGGATACATGGCTTGG + Intergenic
1153703401 18:7719373-7719395 GGGGACGTGGAGGGATGGCTGGG + Intronic
1154412612 18:14149426-14149448 AGGGAGGAGGGGCCATGGCTGGG + Intergenic
1155048951 18:22129975-22129997 GGGGAAGGGGAGGCAAGGGAAGG - Intergenic
1156497295 18:37534294-37534316 GGGGAAGGGCAGGGCTGGCTTGG + Intronic
1157334703 18:46729365-46729387 GGGGAAAGGGGGCCAGGGGTGGG + Intronic
1157492707 18:48135735-48135757 GGGGGAGGGGCGCGCTGGCTTGG - Intronic
1157623125 18:49027326-49027348 GGGGAGGGTGAGCTATGGCAAGG + Intergenic
1159055027 18:63454755-63454777 GGGTAAATGGAGCCATGGGTGGG - Intergenic
1160014397 18:75129234-75129256 GGGGAAGCGCAGCTATTGCTAGG + Intergenic
1160746917 19:716086-716108 AGGGAAGGGGAGCTAGGCCTTGG + Intronic
1160982602 19:1823261-1823283 GGGAATGGGGAGCCATGTCGGGG - Intronic
1161001876 19:1914706-1914728 GGGGAAGGGGCATCCTGGCTGGG + Intronic
1161085292 19:2332393-2332415 GGGGAAGGACAGCTCTGGCTTGG - Intronic
1161270710 19:3387919-3387941 GGGGGCGGGGAGGCCTGGCTGGG - Intronic
1161898285 19:7099110-7099132 GGAGAAGCCGAGCCATGGCCAGG + Intergenic
1162548098 19:11343138-11343160 GGAGAAGGTGAGCCATGCCTGGG + Intronic
1162561629 19:11420995-11421017 AGGGAAGGGGAGCCAGGGATGGG - Intronic
1163444267 19:17337676-17337698 GGGGAAGGGGTGCGACAGCTTGG + Intronic
1163578419 19:18123854-18123876 GGGGCAGGAGAGGCATGGTTGGG - Intronic
1163861121 19:19743378-19743400 GGGGATGGGCTCCCATGGCTGGG + Intergenic
1164450510 19:28358872-28358894 GGGGAGGGGGAACAATTGCTGGG + Intergenic
1165317623 19:35066178-35066200 GGGGAAGGGAAGCCAGTGGTGGG + Intronic
1165404116 19:35619586-35619608 GGGGAAGGGGAGGGGTGGGTGGG - Intronic
1165774071 19:38394844-38394866 AGGGAGCGGGAGCCATGGCCCGG + Intronic
1166300305 19:41908946-41908968 GGGGAAGGGGGCCCAGGGCCAGG - Intronic
1166330625 19:42076235-42076257 GTGCAAGGGGAGCCGTGGCCCGG + Intronic
1166359707 19:42248001-42248023 GGGGCAGGGCAGGCAGGGCTGGG + Exonic
1166916491 19:46199078-46199100 TGGGAAGGGGAGGCAGGCCTTGG - Intergenic
1166977494 19:46613349-46613371 GGGGAAGGGGGGGCATGGGGGGG - Intergenic
1168333919 19:55586116-55586138 GGAGATGGGGAGCCATGGACGGG - Intergenic
924978727 2:200878-200900 GGTGATTGGGAGTCATGGCTGGG + Intergenic
925160239 2:1678307-1678329 GGTGATGGGGAGCCATGGGAGGG - Intronic
925886870 2:8401119-8401141 GGGGAAGGAGAAGCATTGCTGGG + Intergenic
926670214 2:15570112-15570134 TGGGAAGGGGAGGCTTGGATTGG - Intergenic
926728286 2:16015256-16015278 GGGGATGGGGTACCATGGCAGGG - Intergenic
926766334 2:16325634-16325656 GGGGAAATGGAGACAGGGCTCGG + Intergenic
927307950 2:21595396-21595418 GGGAATGGGGAGCCAGGGCAGGG - Intergenic
927806224 2:26149116-26149138 AGGGAAGTGAAGCCAGGGCTTGG + Intergenic
928370533 2:30737069-30737091 CTGGAAGGGGAGCCATGAGTAGG + Intronic
929147799 2:38722012-38722034 GGGGAAGGGAAGGCATAGTTGGG - Intronic
929879074 2:45821032-45821054 GGGTCAGGGGAGCCAAGCCTGGG + Intronic
930412248 2:51039823-51039845 GGGGAACAGGAGCCAAGGCCTGG - Intergenic
931251718 2:60536849-60536871 GGGGAGGGGGACCCAGAGCTGGG + Intronic
931434465 2:62234973-62234995 GGGGCAGGAGAGCCAGGGCGGGG + Intergenic
932036848 2:68253911-68253933 GGGGAAGGGGAGGGATGGAGGGG - Intronic
932341090 2:70963041-70963063 GGGGCAGGGGAGGAATGGCCAGG - Intronic
933761351 2:85674385-85674407 GGGGAAGGGGAAACATGGATGGG - Intergenic
933773307 2:85757140-85757162 GGGGAAGGGGCAGAATGGCTAGG - Intronic
937014700 2:118594555-118594577 GAGGAAGGGGATCCATGGTGAGG - Intergenic
937250215 2:120519089-120519111 AGGCAAGGAGAGCCATCGCTGGG - Intergenic
937416035 2:121715195-121715217 GGGGCAGAGGAGCAATGCCTGGG + Intergenic
937989242 2:127653262-127653284 GTGGCAGGGGAAGCATGGCTGGG + Intronic
938077122 2:128345920-128345942 GGGGGATGGGAGCTAGGGCTGGG + Intergenic
938460619 2:131493786-131493808 GGGGGAGGGTGGCCATGGCAGGG + Intergenic
939513103 2:143131712-143131734 GGAGAAAGGGAGGCCTGGCTAGG - Intronic
945033599 2:205686027-205686049 GGGGAAGGGGAGGGAGGGCTAGG - Intronic
945225606 2:207529477-207529499 GGGGACGGGCAGCCCGGGCTGGG - Intergenic
946003059 2:216499035-216499057 GGGGCGGGGGCGCCTTGGCTGGG + Intronic
946189618 2:218001573-218001595 GGGAAATGGGAGCCTTGGCCAGG - Intronic
947316595 2:228866078-228866100 GGGGAAGGGGAGCCTTTCCAGGG - Intronic
947744892 2:232502465-232502487 GGGGAAGGGAAGCCTTGTCAAGG - Intergenic
947816405 2:233040357-233040379 GGGGAAGGGATTCCAAGGCTGGG + Intergenic
948432645 2:237929868-237929890 GAGGAGTGGGAGGCATGGCTGGG - Intergenic
948485629 2:238279127-238279149 GGGGATGGGGAGACATCACTGGG - Intronic
948741921 2:240053920-240053942 GGGGCAGGGGCTCCATGGCCAGG - Intergenic
948768919 2:240237519-240237541 GGGGAAGGGGGGCCAATTCTGGG - Intergenic
948908961 2:240993597-240993619 GTGGAGGGGGAGCCCTGGCCTGG - Intergenic
1169051442 20:2582000-2582022 TGGAAAGAGGAGCCTTGGCTTGG + Intronic
1169318258 20:4610687-4610709 GGGGGACAGGGGCCATGGCTGGG + Intergenic
1169457885 20:5768358-5768380 GGGGCAGGCCAGCCATGGCTAGG - Intronic
1170464197 20:16608116-16608138 GGGGAAGGGGAGCAGTGGAGGGG - Intergenic
1170587782 20:17748341-17748363 GGGGGAGGGGAGCAACTGCTAGG - Intergenic
1172181891 20:33008561-33008583 CGGCCAGGGCAGCCATGGCTTGG + Exonic
1173439375 20:43062110-43062132 GAGGAAGGAGAGCCATTTCTAGG + Intronic
1173448680 20:43143085-43143107 GGAGAAGAGGAGCCGTGGCAGGG - Intronic
1173522744 20:43711635-43711657 GGGGAATTGGAGCCGTGGCATGG + Intronic
1173823436 20:46032455-46032477 TGGGATGGGGAGCCCCGGCTGGG + Intronic
1175107847 20:56627328-56627350 GGGAAAGGAGAGCCAGGGCCTGG + Intergenic
1175410979 20:58768945-58768967 GGGGCAGGGCAGCCATGGCCAGG - Intergenic
1175551684 20:59821994-59822016 GGGGAAGGGGTGGGATTGCTGGG - Intronic
1175551692 20:59822014-59822036 GGGGAAGGGGTGGGATCGCTGGG - Intronic
1175551700 20:59822034-59822056 GGGGAAGGGGTGGGATCGCTGGG - Intronic
1175612731 20:60365059-60365081 GGGGCAAGGGAGCCAGGGCCTGG - Intergenic
1175929151 20:62485460-62485482 AGGGCAGGGGATCCAGGGCTCGG - Intergenic
1176092837 20:63326556-63326578 GGGCATGGGGAGCCAGGGCCTGG + Intronic
1176168327 20:63685951-63685973 GGGGCAGGAGATCCACGGCTGGG - Intronic
1176177425 20:63735303-63735325 GGGGAAGAGGGGCCAGGCCTGGG + Exonic
1176860394 21:14008829-14008851 AGGGAGGAGGGGCCATGGCTGGG - Intergenic
1177166778 21:17612660-17612682 GGGGAAAGGCAGACATGGCGGGG - Intronic
1177609310 21:23424370-23424392 GGGGGAGGGTATCCATGCCTTGG + Intergenic
1179024116 21:37666270-37666292 GGGGAAGGGGAGTGAGGACTTGG - Intronic
1179427586 21:41294243-41294265 GGGGGAGGTGAGGCCTGGCTGGG - Intergenic
1179924498 21:44526854-44526876 GGCTCAGGGGAGCCATGGGTGGG - Intronic
1180205470 21:46256745-46256767 GGGGCAGGGGAGCCCTGACGAGG + Intronic
1181571377 22:23769381-23769403 GGGCAAGGGGAGTGGTGGCTGGG + Intronic
1181583875 22:23842413-23842435 GGGGGAGGCCAGCCAGGGCTGGG + Intergenic
1182917964 22:34052655-34052677 TGGTAAGGGGAGCCAAGGGTGGG + Intergenic
1183321378 22:37167104-37167126 GGGGAAGGTGAGAAATTGCTTGG - Intronic
1183369935 22:37426817-37426839 GGGGAAGGGGGGCCAGGGTGGGG - Intronic
1183487442 22:38097184-38097206 GGGGAACGGGAGTTCTGGCTGGG + Intronic
1183978227 22:41525381-41525403 GGGGACGGGGGGCCCTGGCAGGG - Intronic
1184508157 22:44916683-44916705 GGGGAGGGGCCGCCCTGGCTCGG + Intronic
1184659138 22:45957882-45957904 GGGGCAGAGGAGCCCTGGCAGGG - Intronic
1184927586 22:47654114-47654136 TGTGAAGGGGAGACAAGGCTGGG + Intergenic
1185048469 22:48541052-48541074 GGGGTGGGGGAGTCAGGGCTGGG + Intronic
950377179 3:12581373-12581395 GAGGAAGGGGAGAGTTGGCTTGG + Intronic
950441737 3:13014609-13014631 GGGGTGGGGGAGGCTTGGCTGGG + Intronic
950442178 3:13016478-13016500 GGGGCGGGAGAGCCACGGCTGGG - Intronic
950668881 3:14513500-14513522 TGGGAAGGGAAGCCTTGGCACGG - Intronic
952416784 3:33096971-33096993 GGGTACGGGGAGGCATTGCTAGG - Intronic
952835934 3:37601927-37601949 GGAGAAGGGGAGCCATCGTGTGG + Intronic
953019223 3:39103338-39103360 GAAGAAGGGGAGACAGGGCTGGG + Intronic
953666494 3:44929652-44929674 AGGGAAGGGAAGCCCTGGCTGGG - Intronic
954619955 3:51989829-51989851 GGGGCAGGAGAGACAGGGCTGGG + Intergenic
954743125 3:52770689-52770711 GGGCAAGGGGAGCTATGGAGAGG - Exonic
954809008 3:53236512-53236534 GGGAAAGAGGAGGCAAGGCTGGG - Intronic
961081881 3:124034166-124034188 GGGGAGGGGGAGCCAAGGGAGGG - Intergenic
961125188 3:124411194-124411216 TGGGAAGGGGAGGGATGGATTGG + Intronic
961306101 3:125959772-125959794 GGGAATGGGGAGCAACGGCTGGG - Intergenic
961450805 3:127001473-127001495 GGGGAGGGGGAGCTGGGGCTGGG + Intronic
961644813 3:128387185-128387207 GGGGTATGGGAGCCATGGACTGG + Intronic
963953336 3:151226492-151226514 GGAGCAGGGGAGCCCTGGCTTGG - Intronic
968989033 4:3896296-3896318 AGGGAAGGGGGGCCATGGGAAGG - Intergenic
969334065 4:6496494-6496516 GGGGAAGAAGAGCCAAGTCTAGG + Intronic
969524705 4:7698300-7698322 GTGGGAGGGGGGCCGTGGCTGGG - Intronic
971355517 4:25891341-25891363 GTGGAAGGAGAGCCAGGTCTCGG - Intronic
971944423 4:33255396-33255418 GGGGAAGGGGAGACCTGGGGAGG + Intergenic
972337899 4:38124248-38124270 GAGGAAGGTGAGACAGGGCTAGG + Intronic
978133821 4:105233049-105233071 GGGGAAGGGCAGACGGGGCTAGG + Intronic
978387284 4:108188764-108188786 GGGGTTGGGGAGCCTTGGCTTGG + Intergenic
978571169 4:110139704-110139726 GGGAAAGGGGAGGCAGGGGTAGG - Intronic
978659532 4:111108188-111108210 GCTGGAGGGGAGGCATGGCTTGG + Intergenic
980249477 4:130295997-130296019 GGGGAAGGGAAGGCAGGGCAGGG - Intergenic
981853222 4:149256455-149256477 GGGGAAGGGGAACCAAGGAGAGG + Intergenic
982042489 4:151409438-151409460 GGGGAGGAGGAGCCACGGCCGGG + Exonic
982069975 4:151686486-151686508 GGGCAGGGGGAGCCCAGGCTGGG - Intronic
983377300 4:166946275-166946297 AGGAAAGGGGAGCCATTGCAGGG - Intronic
983593454 4:169440766-169440788 AGGGCTGAGGAGCCATGGCTAGG - Intronic
984269899 4:177537335-177537357 AGCCAAGGGAAGCCATGGCTAGG - Intergenic
986210269 5:5665196-5665218 AGGGATGGGGGCCCATGGCTTGG + Intergenic
986825034 5:11511364-11511386 GGGGAAGATGAGCGATGGCAGGG + Intronic
988001800 5:25358784-25358806 GGGAAAGGGGAGGGAAGGCTGGG + Intergenic
988202127 5:28082741-28082763 GCAGCAGGGGAGGCATGGCTGGG + Intergenic
988244606 5:28663432-28663454 GGAGAAGGGAAGCCATGGACTGG + Intergenic
989275030 5:39578642-39578664 AGGGAGGGGGAGGCTTGGCTTGG + Intergenic
989543538 5:42646033-42646055 GTAGAAGGTGAGCCATGTCTAGG - Intronic
990008177 5:50966433-50966455 GGGGAAGGAGAGGCAGAGCTCGG + Intergenic
990460095 5:56023664-56023686 GTGGAAGGGGAGCTCTGGGTGGG - Intergenic
990670564 5:58124930-58124952 GGGGAGGGGTAGAAATGGCTTGG + Intergenic
990738406 5:58888517-58888539 GGGGAAGGGGAGAAATGACTGGG - Intergenic
990759456 5:59112359-59112381 GGGAAATGGGAGCCATTGCAAGG + Intronic
992033817 5:72751485-72751507 GGGGAAGGGTACCCATGCGTGGG + Intergenic
992115003 5:73531399-73531421 GGAGAAAGGGAGCCATAACTGGG + Intergenic
992775578 5:80085868-80085890 GGGGAATGGGAGGCGTGGCTGGG + Intergenic
992775589 5:80085916-80085938 GGGGAATGGGAGGCGTGGCTGGG + Intergenic
993703463 5:91144197-91144219 GCAGAAGGGGAGGTATGGCTGGG - Intronic
997984731 5:138492952-138492974 GGGTGAGGGGAGCCACAGCTGGG + Intergenic
998372401 5:141670397-141670419 GGGAAAGTGGGGCCATGCCTGGG - Intronic
999641728 5:153679521-153679543 GGGGAAGAGGAGCCCTGGACTGG - Intronic
1000037452 5:157460098-157460120 GGGGCAGGGGGCCCAGGGCTGGG - Exonic
1001042380 5:168346109-168346131 GTGGAGGGAGAGCCAGGGCTGGG - Intronic
1001401533 5:171449247-171449269 GGGGAAGGTGAGTGATGGTTTGG + Exonic
1001592207 5:172873344-172873366 GAGGAAAGGCAGCCAGGGCTTGG - Intronic
1001661429 5:173396461-173396483 GGGGACAGAGAGCCATTGCTGGG - Intergenic
1001773859 5:174314407-174314429 GCAGCAGGGGCGCCATGGCTGGG + Intergenic
1001949458 5:175806111-175806133 GGTGATGGGGAGCCATTGCAGGG - Intronic
1002063330 5:176639505-176639527 TGGGAAGGGGTGCTGTGGCTGGG + Intronic
1002401763 5:178995000-178995022 GGGGAAGGAGAGCGCGGGCTCGG + Exonic
1002435334 5:179227839-179227861 GGGGCAGGGCAGCCCTGGCTTGG + Intronic
1003261580 6:4521390-4521412 GGGGAAGGGGTGCCAGGGACTGG - Intergenic
1003330270 6:5123498-5123520 GGGGAAGGGGACCCTTGGCCGGG + Intronic
1003794191 6:9581659-9581681 GGGGAAGGGGATCCTTGGGATGG - Intergenic
1004594598 6:17087074-17087096 GGGGAAGGGGAGTAAAGGGTTGG - Intergenic
1005198997 6:23322028-23322050 GGGGCAGGGAAGTCATGGCAAGG - Intergenic
1005987662 6:30884509-30884531 CGGGGAGAGGAGCCAGGGCTGGG - Intronic
1006070561 6:31495098-31495120 GGGGGAGGGGACCCAGGCCTCGG + Intronic
1006329822 6:33382393-33382415 GGGGCGGGGGAGCCATCACTAGG + Intergenic
1006401221 6:33818692-33818714 GGTGAAGGAGAGCCAGGCCTGGG + Intergenic
1006445148 6:34075945-34075967 TGGGAATGGGAGCCAGCGCTGGG + Intronic
1007075892 6:39065856-39065878 GGGAGCGGGGAGCCATGTCTTGG + Intronic
1007414721 6:41684753-41684775 GGGAATGGGGAGCCATGCCCCGG + Exonic
1007701098 6:43767142-43767164 GGGGAAGGGGAGAAAGGGGTGGG - Intergenic
1007708222 6:43804507-43804529 GGGGAAAGGGAGGCATTCCTAGG + Intergenic
1007938856 6:45758046-45758068 GGGGAAAGGAAGACATGGGTGGG + Intergenic
1011603678 6:89081614-89081636 GGGGAAGGGGAGGCATGCGCTGG + Intronic
1012697624 6:102408466-102408488 GGGGAAGGGGAGCAAAGGGAAGG - Intergenic
1013207467 6:107958001-107958023 GAGGAGGGGGTGCCATGGCCGGG - Exonic
1017035365 6:150262407-150262429 GGGGAAGGGGTGACAGAGCTCGG - Intergenic
1017563612 6:155660547-155660569 GGGGAAGGGGAGGGGTGGCACGG + Intergenic
1018671260 6:166179432-166179454 TGGGAAGAGGTGCCATGGGTGGG - Intergenic
1018910868 6:168100395-168100417 GGGGAAGGGGCGCCGTCGCTGGG - Intergenic
1019357630 7:589138-589160 GGGCATGGGGAGTCATGGGTAGG - Intronic
1019475430 7:1241845-1241867 GAGGAAAGGGAGTCACGGCTGGG - Intergenic
1019520605 7:1459077-1459099 GGGGATGGGGAGCCGAGGCGTGG - Intronic
1019528871 7:1493916-1493938 GGGGTGGGGGAGGCATGACTCGG + Intronic
1019575834 7:1737231-1737253 GGGAAAGAGGAGGCTTGGCTGGG - Intronic
1019599686 7:1874991-1875013 GGGGAAGGAGGCCCTTGGCTCGG - Intronic
1020080437 7:5283390-5283412 GGGGCAGGGGAGCGATGGGGTGG - Intronic
1020130835 7:5557816-5557838 GGGGAAGGGGAGGACTTGCTGGG + Intronic
1021075610 7:16300598-16300620 GGGGAAGGGGAGTGAGGGATGGG + Intronic
1022248651 7:28585345-28585367 GGGGAAGGAGAGCCCAGGGTGGG + Intronic
1022401464 7:30042567-30042589 GGGAATGGGGAGCCAAGGTTTGG + Intronic
1022575720 7:31495158-31495180 GAGGAAGGGGAGCCCAGGCCAGG + Intergenic
1023015657 7:35967553-35967575 GGGGAAGGGGCGCCTGGGCGCGG - Intergenic
1023247593 7:38221939-38221961 TGGGAAGGGTAGGCATGGCTGGG - Intronic
1023638913 7:42238356-42238378 GGAGATGGGGAGCCAAGGATGGG - Intergenic
1024044785 7:45579301-45579323 GGGGAAAGGGAGGCAGGGCATGG - Intronic
1024065279 7:45727134-45727156 GGGGAAGGGGCGCCCGGGCGCGG + Intergenic
1024866581 7:53910444-53910466 GGGGACGGGCAGCCATGGGGTGG - Intergenic
1024945783 7:54806273-54806295 TGGGAGGGGGAGCCAGGGCGTGG + Intergenic
1025198477 7:56948789-56948811 GGGGCAGGGGAGCGATGGGGTGG + Intergenic
1025247156 7:57326054-57326076 GGGAAGTGGGAGCCATGGCAGGG - Intergenic
1025673474 7:63628144-63628166 GGGGCAGGGGAGCGATGGGGTGG - Intergenic
1028058709 7:86282252-86282274 GGGGGAGGGGGGCAGTGGCTTGG + Intergenic
1028561288 7:92179120-92179142 GGGAAAGAGGAGCCACGGCCCGG - Exonic
1029382043 7:100220862-100220884 GGGGCAGGGGGGCCAGGGCTGGG + Intronic
1029402200 7:100353307-100353329 GGGTAGGGGGGGCCAGGGCTGGG + Intronic
1029647721 7:101868828-101868850 GGGGGATGGGAGCAGTGGCTTGG + Intronic
1029701839 7:102252326-102252348 GCTGAAGGGGAGCCATGCCGAGG - Exonic
1031922100 7:127609533-127609555 GCAGATGGGGAGGCATGGCTGGG - Intergenic
1032217653 7:129969971-129969993 GGGGAAGGTGAGGCCTGGGTGGG - Intergenic
1032387288 7:131533545-131533567 GGGGAAGGGCAGCCTTCGCTTGG + Intronic
1033170097 7:139076489-139076511 GGGGCAGGGCAGGCATGGATGGG - Intronic
1033767189 7:144506500-144506522 GGGGAAGGGCAGACATATCTTGG - Intronic
1034262090 7:149763635-149763657 AGGGAGGGGGAACCATGGCAAGG - Intergenic
1034966558 7:155394970-155394992 AGGGAAGGGGAACCGGGGCTGGG + Intronic
1035410601 7:158637599-158637621 GGGGATGTGGAGCCATCGCAGGG - Intronic
1035727527 8:1834013-1834035 GGGGAAGGGTAAGCAGGGCTGGG + Intronic
1036678182 8:10851983-10852005 GGGGAAGGGAAGCGTTAGCTCGG + Intergenic
1036723904 8:11201639-11201661 GGGGAAGGGGAGCCCTGGCGGGG - Intergenic
1037552630 8:19989617-19989639 GGGGTGGAGGAGTCATGGCTGGG + Intergenic
1037776804 8:21840976-21840998 GGGGAATGGGAGCAGTTGCTTGG - Intergenic
1038675864 8:29622463-29622485 GGGAAAGGAGAGCCATTTCTGGG + Intergenic
1041007398 8:53508441-53508463 GGGGGAAGGGAACCATTGCTGGG - Intergenic
1041700015 8:60778101-60778123 GTGGAGGGGGGGACATGGCTGGG + Intronic
1042392318 8:68250147-68250169 GGGCACAGAGAGCCATGGCTGGG - Intergenic
1042591593 8:70403021-70403043 GGGGAAGGGGAGCCGCGGCCCGG - Intronic
1044053884 8:87543245-87543267 GCAGATGGGGAGGCATGGCTGGG - Intronic
1045244538 8:100431413-100431435 GGGGAAGGGGAGGTCTGGCCAGG + Intergenic
1045322095 8:101089850-101089872 GGGAATGGGGAGTCATTGCTTGG - Intergenic
1045366178 8:101478165-101478187 TGGGAAGGGGTCCCAAGGCTTGG + Intergenic
1046611351 8:116429174-116429196 GGGGAAGGGCAGGCATAGCTAGG - Intergenic
1047189021 8:122661288-122661310 GGGCAGCTGGAGCCATGGCTCGG - Intergenic
1047640965 8:126821192-126821214 GAGGACGGGGATCCCTGGCTAGG - Intergenic
1047732283 8:127737364-127737386 GCGGCAGGGGAGTCAGGGCTGGG - Intronic
1048302242 8:133260258-133260280 AGGGTAGGGGATCCCTGGCTGGG - Intronic
1048377659 8:133836739-133836761 GGTGAAGGGGAAGCAGGGCTGGG + Intergenic
1049066587 8:140321213-140321235 GGGCTAGGAGAGCCATGGCTGGG + Intronic
1049164763 8:141119039-141119061 GGGCAAGGGCAGACATGGCGAGG - Intronic
1049264923 8:141662689-141662711 AGGGAGGTGGAGGCATGGCTGGG + Intergenic
1049266766 8:141671727-141671749 GGGGCCTGGGAGGCATGGCTGGG + Intergenic
1049431725 8:142568476-142568498 GGGGCAGGGAAGCCAGGCCTGGG - Intergenic
1049615153 8:143572706-143572728 AGGCAAGGGCCGCCATGGCTGGG - Exonic
1049827565 8:144679264-144679286 GGGGAAGGTGAGCCCCTGCTCGG - Intergenic
1049919734 9:352115-352137 GGGGAATGGGAGGCATGGTGCGG + Intronic
1050089612 9:2004262-2004284 GGGGAAGGGGAGACATGGGAGGG + Intergenic
1050786510 9:9410447-9410469 GGGGAAAGGGAGACATGGAAAGG - Intronic
1051127522 9:13821389-13821411 GGGGAAATGGTGCCAAGGCTTGG - Intergenic
1051245014 9:15101290-15101312 GGGGGAAGGGAGCCTTGGCAGGG - Intergenic
1051582853 9:18695911-18695933 GTGGTACAGGAGCCATGGCTGGG + Intronic
1052533002 9:29711531-29711553 GTGGAAGGGGGCACATGGCTAGG + Intergenic
1052652517 9:31321962-31321984 GCAGCAGGGGAGGCATGGCTGGG - Intergenic
1053004382 9:34594317-34594339 GGGGGAGGGGGGCCATGTCCTGG - Intergenic
1053443730 9:38136001-38136023 GTGACAGGGAAGCCATGGCTGGG - Intergenic
1053451546 9:38197993-38198015 GGGGTTGGGGCACCATGGCTTGG - Intergenic
1053463685 9:38289674-38289696 GGGGAACCGGAGCCAGGGCTAGG + Intergenic
1056454682 9:86748424-86748446 GGGGATGGAGAGGCATGGATTGG - Intergenic
1056687414 9:88778090-88778112 GGGGAGGAAGAGCCCTGGCTGGG + Intergenic
1057797935 9:98171672-98171694 AGGGAAGGGGAGGCATGGGGTGG + Intronic
1058065140 9:100540491-100540513 GGGGAGGGGGAGGCACGGGTGGG - Intronic
1058670935 9:107359902-107359924 GGGGAAGGGGAGGGTTGGCTTGG + Intergenic
1059304455 9:113342759-113342781 GGAGAAGGGGAGGAATGGGTAGG - Intergenic
1060444690 9:123677350-123677372 AGTGAAGGGGAGCAATGGCCAGG - Intronic
1060663786 9:125420648-125420670 AGGGTAGGGGTGGCATGGCTGGG + Intergenic
1060800996 9:126545854-126545876 GGGGAGGAGGAGTCCTGGCTTGG + Intergenic
1060823669 9:126675304-126675326 TGGGGAGGGGACCGATGGCTAGG + Intronic
1060913752 9:127371322-127371344 TGGGAAAGGGAGTCCTGGCTAGG - Intronic
1060933928 9:127505289-127505311 GGGGACGGGGGGCCTGGGCTGGG - Intergenic
1061225623 9:129279277-129279299 GGGGAGCGGGGGCCTTGGCTGGG + Intergenic
1061239573 9:129361825-129361847 GGAGAAGGGGAGCCAGTGGTGGG - Intergenic
1061336235 9:129938890-129938912 GGGAAAGGGGGGCCAAGTCTTGG - Intronic
1061433682 9:130547262-130547284 TGGGAAGGGGAGCCAGGAATGGG - Intergenic
1061806422 9:133139932-133139954 GTGGGATGGGAGCCCTGGCTTGG - Intronic
1061889642 9:133611267-133611289 GGGGATTAGGAGCAATGGCTTGG - Intergenic
1062165339 9:135104784-135104806 GGGAGGGAGGAGCCATGGCTGGG - Intronic
1062331729 9:136047906-136047928 GGGTGATGGGAGCCAGGGCTGGG - Intronic
1062393375 9:136342801-136342823 GCGGAGGGGGCGCCAGGGCTGGG + Intronic
1062568038 9:137171889-137171911 GGGGAAGGGGAGCCATGGCTGGG + Exonic
1062698640 9:137888010-137888032 GGGGCAGGGGGGCCTTGGCTCGG + Intronic
1187800572 X:23058056-23058078 GGGGAAGGGGAGGTATGAATAGG + Intergenic
1190405361 X:50081412-50081434 GGGGGAGGGGAGTGATAGCTGGG - Intronic
1192575887 X:72242672-72242694 GGGGAATGGGAGCCCTTGATTGG - Intronic
1194469303 X:94272687-94272709 GGGCTACGTGAGCCATGGCTTGG - Intergenic
1195246920 X:103003289-103003311 AGGGAAGGGCAGCCATGCCAAGG + Intergenic
1196657173 X:118230553-118230575 GGGGAGGGGTTGCCTTGGCTTGG - Intergenic
1198534355 X:137572699-137572721 GTGGAAGTAGAGCCATGGGTTGG + Intronic
1201587821 Y:15580841-15580863 TGGGCAGGTGACCCATGGCTGGG - Intergenic
1201765672 Y:17571542-17571564 GGGGAAGAAGCACCATGGCTCGG + Intergenic
1201835880 Y:18334447-18334469 GGGGAAGAAGCACCATGGCTCGG - Intergenic