ID: 1062569230

View in Genome Browser
Species Human (GRCh38)
Location 9:137177165-137177187
Sequence CAGCCTGGCAGCACTTCTGC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 301
Summary {0: 1, 1: 0, 2: 4, 3: 27, 4: 269}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1062569230_1062569237 18 Left 1062569230 9:137177165-137177187 CCCGCAGAAGTGCTGCCAGGCTG 0: 1
1: 0
2: 4
3: 27
4: 269
Right 1062569237 9:137177206-137177228 CTCCAAGAGCAGAGCCGCCGAGG No data
1062569230_1062569234 -9 Left 1062569230 9:137177165-137177187 CCCGCAGAAGTGCTGCCAGGCTG 0: 1
1: 0
2: 4
3: 27
4: 269
Right 1062569234 9:137177179-137177201 GCCAGGCTGGAGTGAAAGGAAGG No data
1062569230_1062569239 24 Left 1062569230 9:137177165-137177187 CCCGCAGAAGTGCTGCCAGGCTG 0: 1
1: 0
2: 4
3: 27
4: 269
Right 1062569239 9:137177212-137177234 GAGCAGAGCCGCCGAGGCCAAGG No data
1062569230_1062569236 -5 Left 1062569230 9:137177165-137177187 CCCGCAGAAGTGCTGCCAGGCTG 0: 1
1: 0
2: 4
3: 27
4: 269
Right 1062569236 9:137177183-137177205 GGCTGGAGTGAAAGGAAGGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1062569230 Original CRISPR CAGCCTGGCAGCACTTCTGC GGG (reversed) Intronic
900919410 1:5661265-5661287 CAGCCTGGCACCATTCCTGGGGG + Intergenic
900934811 1:5758579-5758601 CAGCCTGGCCCTTCTTCTGCTGG - Intergenic
901220193 1:7579277-7579299 CAGGCTGGCAAGACTTCTCCAGG - Intronic
901351271 1:8599048-8599070 CAGGCTGGGAGAAGTTCTGCAGG - Intronic
901635592 1:10668748-10668770 CAGCCTGGCCGCCTTTCTACAGG - Intronic
901701285 1:11045940-11045962 CATCCTGGCAGCGCTCCCGCTGG + Intronic
902631136 1:17705457-17705479 AAGCCTGTGAGCACTCCTGCAGG - Intergenic
902659944 1:17894081-17894103 CACCCTGGCATCCCTTCAGCGGG + Intergenic
902886899 1:19411822-19411844 CAGCCAGGCAGCCCTTCACCAGG - Intronic
903172494 1:21562890-21562912 CACCCTGGCAGCACTGGGGCAGG - Intronic
903337798 1:22636616-22636638 CAGCCTGGAGCCACTCCTGCTGG + Exonic
903391170 1:22964503-22964525 CTGGCTGGCAGCTCTGCTGCTGG - Intronic
907462365 1:54612506-54612528 CTGCCTGGCCCCACTTCAGCTGG - Exonic
907493459 1:54825892-54825914 CAGCCTGCCATCACCACTGCTGG - Intronic
907571751 1:55490356-55490378 CAGTCTGGCAGCAGTACAGCAGG - Intergenic
907575717 1:55523992-55524014 CAGCCTGGAAGCACATTTGGAGG - Intergenic
912675957 1:111680774-111680796 CAGTCTGGCCCCTCTTCTGCAGG - Intronic
912893283 1:113557966-113557988 CAGTCTGGCCACTCTTCTGCAGG - Intronic
915229749 1:154436544-154436566 CAGTTAGGCAGCTCTTCTGCTGG + Intronic
915328613 1:155094327-155094349 CAGACAGGCAGCCCTTCAGCAGG - Intergenic
915484481 1:156210705-156210727 CACCCTGCCAGCCCTTCTTCTGG + Exonic
915980631 1:160417716-160417738 CAGCCAGGCAGGGCTTGTGCAGG - Intronic
916211958 1:162366924-162366946 CAGCTTAGCAGCACCTCTCCGGG - Intronic
916973557 1:170049731-170049753 CAGCCAGGCACCTCTTCTGCAGG - Intronic
917971907 1:180213914-180213936 CAGCTGGGCAGCTCTTCTGCAGG + Intergenic
919397583 1:197069832-197069854 GAGCCTGGTAGCCCTTCTGGTGG + Intergenic
921296741 1:213711759-213711781 CAGTCAGGCCCCACTTCTGCAGG + Intergenic
922421161 1:225461973-225461995 CAGCCAGGGAGCACAGCTGCTGG + Intergenic
923434827 1:233957875-233957897 CAGCTGGGCAGCTCTTCTGCTGG + Intronic
924071280 1:240282612-240282634 ATGCCTGGCAGCACGTCTTCTGG + Intronic
924850583 1:247825560-247825582 CCGCCCGCCAGCACTTCCGCCGG - Intergenic
1062797160 10:353134-353156 CTGCCTCCCAGCACTTCTGTGGG - Intronic
1063369977 10:5514865-5514887 GAGCCAGGCAGCACATCTGGAGG + Intergenic
1063487620 10:6434742-6434764 CAATCTGTCAGCACTACTGCTGG - Intronic
1063587607 10:7366778-7366800 CAGCCTGCCAGCAGTGCTGAGGG - Intronic
1063652413 10:7951320-7951342 CAGCCATGCGGCTCTTCTGCTGG + Intronic
1066581361 10:36886046-36886068 CAGCGAGCCAGCACTTCTGAAGG + Intergenic
1067061749 10:43081346-43081368 CAGGCTGGGAGCACTCCTGAGGG + Intronic
1067223784 10:44362656-44362678 GAGCCTGGCAGCCCCTGTGCTGG + Intergenic
1068673829 10:59749928-59749950 TCGCCTGGCAGCACTCCTGAGGG + Intergenic
1070213273 10:74348328-74348350 CAGTCAGGCACCTCTTCTGCAGG - Intronic
1071524222 10:86348875-86348897 CATCCTGGCTGCACTCATGCAGG + Intronic
1071591967 10:86883292-86883314 CAGCCTGCCAGCACTTTGGGAGG + Intronic
1072058216 10:91781960-91781982 CAGGCTGGCAGTGTTTCTGCTGG + Intergenic
1072083646 10:92057303-92057325 CGGCCTGGCAGTACTTCTCATGG + Intronic
1074408512 10:113202001-113202023 TAGCCTGGCAGTACTCCTCCTGG + Intergenic
1074555306 10:114483945-114483967 CAGCCTGGCTGTTCCTCTGCCGG + Intronic
1075475425 10:122729667-122729689 CAGCATGGGAGCACTCCTCCAGG - Intergenic
1075478421 10:122756839-122756861 CAGCCTGGCCACACTGCAGCTGG - Intergenic
1075569552 10:123529723-123529745 CAGGCTGCCAGCTCTTCTGTGGG + Intergenic
1075725317 10:124607956-124607978 CAGCCTGGCAGGGCTGATGCAGG + Intronic
1076159620 10:128233620-128233642 CAGCCAGGCGGTTCTTCTGCTGG + Intergenic
1076307982 10:129478155-129478177 CAGTCTGGCAGCATTTGAGCTGG - Intronic
1076555360 10:131317892-131317914 AAGCCTCGCTGCACTTCTGTTGG - Intergenic
1079343868 11:19634823-19634845 CAGTCTGGCATCACTTATTCTGG - Intronic
1079389107 11:20005717-20005739 CAGCCTTGCAGGAGTTCTGAAGG - Intronic
1080783005 11:35448874-35448896 CAGCCAGGCCCCTCTTCTGCAGG + Intronic
1080854309 11:36098587-36098609 CAGCCTTGCAGCCCTTGTACAGG + Intronic
1081317632 11:41650340-41650362 CAGTCAGGCTGCTCTTCTGCAGG + Intergenic
1083418252 11:62539221-62539243 CTGCCTGGCTGCTTTTCTGCAGG - Intronic
1084691636 11:70730626-70730648 GAGCCTGGCTGCTCATCTGCAGG - Intronic
1084861416 11:72020982-72021004 CTGCCTGGCAGCAGTTATGTAGG - Intronic
1085037111 11:73307509-73307531 CAGTCTGGCGGCTCTTCTCCTGG - Intergenic
1086268998 11:85037051-85037073 CAGCCTGCCAGCTCCTCTGAAGG + Intronic
1086510624 11:87553973-87553995 CAGTCAGGCAGGACTTCTCCTGG - Intergenic
1088278664 11:108115515-108115537 CAGGCTGGGAGTATTTCTGCTGG + Intergenic
1090042881 11:123306163-123306185 GAGAATGGCAGCACTTCAGCTGG + Intergenic
1091046374 11:132329429-132329451 CAGCCTCCCAGCATTTCTACAGG + Intronic
1091323986 11:134670525-134670547 CTGTCTGCCAGCACTCCTGCAGG + Intergenic
1091847868 12:3671177-3671199 TAGCCTGGCATCTCATCTGCAGG - Intronic
1095907779 12:47395331-47395353 CACCCTGGTGGCACTGCTGCAGG + Intergenic
1098515929 12:71376786-71376808 CACCCTGGGAGCCCTTCTCCGGG + Intronic
1099588014 12:84546205-84546227 CAGGCTTGCAGCATATCTGCTGG - Intergenic
1100329384 12:93570534-93570556 CCTCCTGGCCGCACTTTTGCGGG - Intronic
1102571912 12:113831894-113831916 CAGCCTCCCTGCACTGCTGCAGG + Intronic
1102785236 12:115599302-115599324 CAGGCTGGCGCCACTGCTGCGGG + Intergenic
1103214021 12:119187803-119187825 CAGCCTGGAAGATATTCTGCTGG - Intronic
1104237598 12:126954202-126954224 CAGACTGGCAGCTCTTAGGCAGG + Intergenic
1104976369 12:132553696-132553718 CAGCCAGGCCCCGCTTCTGCTGG - Intronic
1105028639 12:132867344-132867366 CAGCCTGGCTGCTCTGCTACAGG - Intronic
1107405413 13:40107924-40107946 CAGCCTGGGAGCATTTCCCCAGG + Intergenic
1107427841 13:40312058-40312080 CAGCCAGACAGCCTTTCTGCTGG - Intergenic
1107790333 13:43995550-43995572 CAGCCTGCCAGCACTTGAGAGGG + Intergenic
1108698475 13:52923636-52923658 CAGCCTGACAGCTCTTTTGGAGG + Intergenic
1110441085 13:75525715-75525737 CACCCTGTCTGCATTTCTGCAGG - Intronic
1112225122 13:97532111-97532133 CAGCCTGGCACCAACTTTGCAGG + Intergenic
1112718761 13:102217803-102217825 CATCAAGGCAGCACTTCAGCTGG - Intronic
1113926975 13:113947074-113947096 CAGCCTGGCAGCACTACAGAAGG + Intergenic
1114788284 14:25626056-25626078 CAACCTGGCAACATCTCTGCTGG + Intergenic
1115357275 14:32461469-32461491 CAGCCAGGCTCCTCTTCTGCAGG - Intronic
1115498804 14:34031505-34031527 CAGCCTAGCAGCCCCTCTTCTGG + Intronic
1117253066 14:53954260-53954282 CAGCCTGGCATGGCTTCTTCGGG - Intronic
1118151054 14:63191074-63191096 AATCCTGGCAGCATTTCTTCTGG + Intergenic
1122121686 14:99557568-99557590 TAGCCTGGCTTCACCTCTGCTGG - Intronic
1122650890 14:103226472-103226494 CAGCCGGGCAGCAATTCTGAGGG - Intergenic
1122854742 14:104554684-104554706 CAGCCTCGCTGCCCTCCTGCAGG + Intronic
1123113020 14:105881860-105881882 CCCCCTGGCAGGACTTCTTCGGG + Intergenic
1123115367 14:105892009-105892031 CCCCCTGGCAGGACTTCTTCGGG + Intergenic
1124180326 15:27467164-27467186 CAGCCAGGGTGCACATCTGCAGG - Intronic
1125790278 15:42360217-42360239 GATCCTGGCAGCAGCTCTGCTGG + Intronic
1125984829 15:44039567-44039589 CAGCCAGGCCCCTCTTCTGCAGG - Intronic
1128147478 15:65340040-65340062 CAGCCTGGTCGCACCTCTGGTGG - Intronic
1129777220 15:78244682-78244704 CAGGATGGCAGCTCTTCTCCAGG - Intronic
1130313010 15:82771347-82771369 CAGCCTGACAGCACCTGTCCTGG - Intronic
1131858610 15:96626960-96626982 AAGCCTGCCAACACTTCGGCTGG + Intergenic
1131963288 15:97810860-97810882 CAGCTGGGCAGTTCTTCTGCTGG - Intergenic
1131993103 15:98109445-98109467 CACCATGGCAGCACCACTGCAGG + Intergenic
1132435894 15:101802278-101802300 CAGCTGGGCAGTTCTTCTGCTGG - Intergenic
1132629054 16:907993-908015 CCGCCTGGCGGCTCCTCTGCGGG + Intronic
1132705421 16:1241249-1241271 CATACTGGATGCACTTCTGCGGG + Exonic
1132708551 16:1256612-1256634 CATACTGGATGCACTTCTGCGGG + Exonic
1132764166 16:1526011-1526033 CAGCCTGGTAGAACTTGTTCAGG + Exonic
1133017504 16:2951028-2951050 CAGCCCGGCAGCAGCTCAGCGGG + Exonic
1133031419 16:3012996-3013018 CAGCCTGGCAGTGCGTCTGGAGG + Exonic
1133098603 16:3465335-3465357 CATCTTGGCAGCACATCTTCTGG + Intronic
1133224813 16:4335945-4335967 CACCCTGGCAGCACATCTCCAGG + Intronic
1138212814 16:55177386-55177408 CAGCCTTAGAGCAGTTCTGCTGG - Intergenic
1141098010 16:81176623-81176645 CATCCTGGCAACACTACTGGTGG + Intergenic
1142285993 16:89171770-89171792 CAGCCTGGACGCGCTTCTTCGGG + Exonic
1142292384 16:89199084-89199106 CGGCCTGGCTGCGCTTGTGCAGG - Exonic
1143645825 17:8229406-8229428 CTACCTGGCTGAACTTCTGCAGG - Exonic
1144616792 17:16783541-16783563 CAGTCTGGCCACTCTTCTGCAGG + Intronic
1144676619 17:17166232-17166254 CAGACTGGGAGCACTGCTGCAGG - Intronic
1144895902 17:18532132-18532154 CAGTCTGGCCACTCTTCTGCAGG - Intergenic
1145136314 17:20412100-20412122 CAGTCTGGCCACTCTTCTGCAGG + Intergenic
1145795819 17:27654830-27654852 CGGCCTTCCAGCACTACTGCCGG + Intergenic
1146544489 17:33726323-33726345 CAGCGGGGCAGTTCTTCTGCTGG - Intronic
1149955308 17:61042931-61042953 CACTCTGGCAGCACTGCAGCAGG + Intronic
1150334430 17:64320286-64320308 GAGCCTGGCAGCAATTCTTAGGG + Exonic
1151595136 17:75073935-75073957 GGGCCTGGCAGCACTGCCGCAGG + Intergenic
1151957626 17:77388276-77388298 CAGCCAGGCAGCCCGTCTTCTGG + Intronic
1151961121 17:77406098-77406120 CAGTCTGGGAGCAATTCAGCTGG - Intronic
1152271826 17:79329368-79329390 CATCCTGGCCACACTCCTGCCGG + Intronic
1152894803 17:82905008-82905030 AAGCCTGGCAGCACTTGGGGAGG + Intronic
1153119177 18:1700530-1700552 CAGTCAGGCACCTCTTCTGCAGG - Intergenic
1153331561 18:3879903-3879925 CAGCCTGGAAGGAGTTCCGCTGG + Exonic
1153389159 18:4534682-4534704 CAGTCTGGCAGTACTTCTTGTGG - Intergenic
1156472715 18:37387690-37387712 TACCCTAGCAGCCCTTCTGCGGG + Intronic
1157021481 18:43788047-43788069 CAGACTGCCATCACTTCTCCAGG + Intergenic
1158491673 18:57916015-57916037 CAGCCAGGCAGTTCTGCTGCTGG + Intergenic
1160086055 18:75778354-75778376 CAGCCTGCCACCACATCTGCAGG + Intergenic
1161613035 19:5254197-5254219 CAGCCTGGCAGCTCGCATGCTGG + Intronic
1162484777 19:10952902-10952924 CAGACTGAGAGCACATCTGCAGG + Intergenic
925290236 2:2743254-2743276 CAGCTTGGCAGCCCTTCTCATGG + Intergenic
926113702 2:10197866-10197888 CAGACTTTCAGCACTGCTGCTGG + Intronic
926848326 2:17166747-17166769 CAGCTTGGCAGTACCTCTGTTGG + Intergenic
927703514 2:25282969-25282991 CAGCCTGGTTGCACTTCTCAAGG + Intronic
927717008 2:25359595-25359617 CAGCCTGGCAGCAGGTGGGCTGG - Intergenic
929757654 2:44780590-44780612 CAGCTGGGCAGTTCTTCTGCTGG - Intergenic
931820745 2:65949445-65949467 GAGCATGGCAGCCCTTTTGCTGG + Intergenic
932438907 2:71719493-71719515 CAAGCTGGCAGTATTTCTGCTGG + Intergenic
932494679 2:72140467-72140489 CAGCCAGGCAGCTCTGCTGCTGG - Intronic
932505506 2:72226732-72226754 CATTCTGGCAGCACTTATGAAGG + Intronic
932773141 2:74512950-74512972 CAGGCTGCCAGCCCATCTGCTGG + Intergenic
933771667 2:85748559-85748581 AAGCACAGCAGCACTTCTGCAGG + Intergenic
934950365 2:98571563-98571585 CAGCCTGGCTGCTCTGCTTCCGG - Intronic
935575370 2:104704064-104704086 CAGCCAGGCCGCACTGCTGAAGG - Intergenic
936373428 2:111921542-111921564 CAGCCCTACAGCCCTTCTGCAGG - Intronic
937329774 2:121019222-121019244 CCTCCTGCCAGCTCTTCTGCGGG + Intergenic
938677890 2:133657274-133657296 AAGGCTGGCAGCACAGCTGCTGG + Intergenic
946156666 2:217811532-217811554 CAGCCTAGGAGCGCTTCTGAAGG + Intronic
948164435 2:235850456-235850478 CACCCTGGCAGGACATCAGCCGG + Intronic
948482219 2:238257392-238257414 CAGCCAGGCAGCCCTTCTGCAGG + Intronic
1170625144 20:18024698-18024720 AAAACTGGCAGCCCTTCTGCAGG - Exonic
1170885127 20:20334061-20334083 TTGCCTGGCAGCACTGGTGCTGG - Intronic
1170913896 20:20603725-20603747 CAGCCAGTCAGTTCTTCTGCTGG - Intronic
1171205010 20:23272360-23272382 CAGCATGGCTGCATTTCTGCAGG + Intergenic
1171976310 20:31596855-31596877 CAGCCTGGGAGCACTTTGGGAGG - Intergenic
1172025106 20:31943126-31943148 CAGCCTGGCACCAGCTTTGCTGG + Exonic
1172856119 20:38003910-38003932 CAGCCTGTAAGAACTTCTGATGG + Intronic
1172959428 20:38788057-38788079 CAGCTGGGCAGTTCTTCTGCTGG + Intergenic
1173448461 20:43141289-43141311 CAGTCGGGCAGCTCTTCTGCTGG + Intronic
1173478369 20:43379651-43379673 CATCCAGGCAGCTCTTCTGCTGG + Intergenic
1174212470 20:48890765-48890787 CAGCCAGGCAGGCCCTCTGCAGG - Intergenic
1174839171 20:53885583-53885605 CATCCAGGCAGCACCTCTGGGGG - Intergenic
1175337567 20:58206146-58206168 CAGCTGGGCAGCTCTGCTGCAGG - Intergenic
1175630054 20:60528172-60528194 CAGCCTTGTAGCAGTTCTGAAGG - Intergenic
1175922323 20:62455994-62456016 CAGCAGGGCAGCTCTTCTGGGGG - Intergenic
1175982547 20:62746336-62746358 CAGCCTGGCTGCAGTAGTGCTGG - Intronic
1176271760 20:64239090-64239112 CAGCCTGACTGCACATCTGCAGG - Intronic
1178326333 21:31648219-31648241 CAACCTGGCAGCACCACTGCAGG - Intergenic
1179424000 21:41258437-41258459 CATCCTGGCAGCTCTTCACCTGG - Intronic
1180701114 22:17781856-17781878 CAGCCTCCCAGAGCTTCTGCAGG - Intergenic
1180983684 22:19891657-19891679 CAGTCAGCCAGCACTGCTGCGGG - Intronic
1181457638 22:23068813-23068835 CAGCCAGGTAGCACAGCTGCCGG + Intronic
1181782221 22:25201533-25201555 CAGCCAAGCAGCACCTCTGCAGG + Intronic
1182700515 22:32233575-32233597 CAGTCTGGCAGCACTCCCTCTGG - Intronic
1183747433 22:39699655-39699677 CAGGCTGGTGGCACTTCTCCTGG + Intergenic
1184835196 22:47016838-47016860 CAGCCACGCAGCAGCTCTGCAGG - Intronic
1185009387 22:48304812-48304834 CTGCCTGGGAGCCCTTCTGCGGG + Intergenic
1185061668 22:48610198-48610220 GGGCCTGGCTGCACTGCTGCAGG + Intronic
950143491 3:10631657-10631679 CAGGCTGCCAGGACTTGTGCAGG - Intronic
952256139 3:31697330-31697352 TAGCGGGGCAGCTCTTCTGCTGG - Intronic
952884163 3:38002607-38002629 CAGCCTGGCACCACTACATCTGG - Intronic
954660495 3:52224421-52224443 CAGCCAGGAAGAACTTCTGCAGG - Intronic
955969038 3:64418775-64418797 CTGCATGGCATCACTGCTGCTGG + Intronic
960177391 3:114532883-114532905 CAGTCTGGCATCTCTGCTGCAGG - Intronic
960274575 3:115713509-115713531 CAGCCTGGTTGCAATGCTGCTGG - Intronic
960997028 3:123347042-123347064 CAGCCTGGCTGTACCACTGCTGG + Intronic
962655959 3:137543983-137544005 CAGCCAGGCTGCACCCCTGCAGG - Intergenic
964999264 3:162931642-162931664 AAGGATGTCAGCACTTCTGCTGG - Intergenic
965077722 3:164001408-164001430 CAGACTGGGAGCACTACTACAGG + Intergenic
966154652 3:176902712-176902734 CAGCTGGGCAGCTCTTCTGTTGG + Intergenic
966825762 3:183963702-183963724 CAGCATGGCAGTTCATCTGCGGG - Intronic
966825766 3:183963729-183963751 CAGCATGGCAGTTCATCTGCGGG - Intronic
969518696 4:7663412-7663434 CAGCCAGGCAGCCCCACTGCAGG + Intronic
970467038 4:16334596-16334618 CACCCTGGAAGAACTTATGCAGG - Intergenic
971223723 4:24732694-24732716 CAGCCTGTCCTCACATCTGCAGG + Intergenic
973735615 4:53868674-53868696 CAGCTTGGTAGTTCTTCTGCTGG - Intronic
975582526 4:75919908-75919930 CAGCCTGGAGGCACTTTTCCAGG - Exonic
976404169 4:84643274-84643296 CAACGTGGCAGCATTTCTGTGGG - Intronic
981676137 4:147345159-147345181 CAGCTGGGCAGTTCTTCTGCTGG - Intergenic
983896123 4:173084070-173084092 CAGCCAGGCCCCTCTTCTGCAGG + Intergenic
985163589 4:187069582-187069604 CACCCTGGCAGCCCTGCTCCTGG + Intergenic
985701664 5:1377176-1377198 CAGCCTGGCATAGCTTCTGTGGG - Intergenic
986484448 5:8220905-8220927 CAGTCAGGCCCCACTTCTGCAGG - Intergenic
986633115 5:9793814-9793836 CAGGGTGCCAGCACTTCTCCAGG - Intergenic
986720191 5:10555539-10555561 CATCCTGGCAGGTCTGCTGCGGG + Intergenic
987519668 5:18964711-18964733 CAAGCTGGTAGCATTTCTGCTGG + Intergenic
988092994 5:26567438-26567460 CAGCCTGCCAGCACTTGGGAGGG + Intergenic
991237796 5:64419242-64419264 TAGCCTGGCAGTACTTCTCATGG + Intergenic
995500027 5:112794577-112794599 CAGCTTGGCAGCAGTCCTGGTGG - Intronic
995596950 5:113757500-113757522 CAACCAGGCAGCAGTTCTGCAGG - Intergenic
998453141 5:142250066-142250088 TAGCCTGGCAGAACTTGTTCTGG - Intergenic
1000346782 5:160321193-160321215 CAGCCTGACAGGGATTCTGCAGG + Intronic
1001615845 5:173042903-173042925 CAGCTTGGCTGCCCTTCAGCTGG + Intergenic
1002021275 5:176365765-176365787 CAGCCTGCCCGCCCTTCCGCAGG - Intronic
1002187209 5:177459918-177459940 CAGCCTGGGAGCAGTACAGCAGG + Intronic
1002425530 5:179172406-179172428 CAGCAAAGCAGAACTTCTGCAGG + Intronic
1002441669 5:179267524-179267546 CAGCCTGGTAGCAGTTCCCCAGG + Intronic
1003526410 6:6901635-6901657 CTGCCTTGTAGCGCTTCTGCCGG - Intergenic
1004489662 6:16102368-16102390 CTGCCAGGCAGCACAGCTGCAGG + Intergenic
1007268341 6:40614936-40614958 CAGCCTGACAGCACCAGTGCTGG - Intergenic
1007785534 6:44277249-44277271 CACCCTGGCAACAGCTCTGCAGG - Exonic
1008881809 6:56387764-56387786 GAGCCAGCCAGGACTTCTGCTGG - Intronic
1013192548 6:107815965-107815987 CTGCCTGGCAGGGCTGCTGCAGG - Intronic
1013827990 6:114238319-114238341 CAGCCCAGCAGAACTTCTGGTGG + Intronic
1013929830 6:115516986-115517008 CAGTCTGGCCCCTCTTCTGCCGG - Intergenic
1016937659 6:149459544-149459566 CAGTCTTGGAGCACTTCTGGTGG + Intronic
1018847887 6:167567669-167567691 CGGCCTGGCAGGACCTCGGCTGG - Intergenic
1019688115 7:2393660-2393682 CAGACTGGGAGCACTTTTGCAGG + Intergenic
1020195912 7:6038917-6038939 CAGCCTGGCCCCCCTTCTGCTGG - Intronic
1021051835 7:15995084-15995106 CAGCCAGGCCCCTCTTCTGCAGG + Intergenic
1024150785 7:46569465-46569487 CAGCCAGGCTGCCCATCTGCCGG + Intergenic
1024970703 7:55067088-55067110 CACCCTGACAGCAGTGCTGCAGG - Intronic
1024995719 7:55271936-55271958 CAGCCTGGCAGCACTGTGTCTGG - Intergenic
1026126505 7:67584259-67584281 CAGCCTGCAAGCATTTCTGGAGG + Intergenic
1026535676 7:71236753-71236775 CTCCCTCGCAGCACTTCTGCGGG + Intronic
1027576131 7:79933611-79933633 CAGCCTGGCCACACTTCTGCAGG + Intergenic
1027582986 7:80021018-80021040 CAGTCAGGCATCTCTTCTGCAGG - Intergenic
1029220220 7:98982864-98982886 CAGCCTGGCATCCCTGCTGCAGG - Intronic
1029339223 7:99929434-99929456 CAGCCTTGCAGCCCGGCTGCTGG + Exonic
1029347969 7:99992564-99992586 CAGCCTTGCAGCCCGGCTGCTGG - Intergenic
1029463669 7:100711576-100711598 CTGCCTGCCACCACCTCTGCTGG - Intergenic
1032076098 7:128836905-128836927 CAGCCTGGCACCAGCCCTGCTGG - Intronic
1032169146 7:129569820-129569842 CAAGCTGGCAGTATTTCTGCTGG - Intergenic
1034566407 7:151919232-151919254 CACATTGGCAGCACTTCTTCAGG + Intergenic
1035148287 7:156842775-156842797 CAGGCTGCCAGCACTGCTGAGGG - Intronic
1036727093 8:11230097-11230119 CAGCCTCGAGGCACTTCTGTTGG - Intergenic
1039474865 8:37834304-37834326 GAGTCTGGCATCACTTCTCCAGG - Intronic
1041167234 8:55102258-55102280 CAGCCAGGCGGCGCTCCTGCCGG + Intergenic
1042373441 8:68019253-68019275 AAGCCTGCCAGCAACTCTGCTGG + Intronic
1042448997 8:68922790-68922812 TAGTCTGGCAGCACTTCTTCAGG + Intergenic
1042497247 8:69469243-69469265 CTTCCTGACAGCACTTGTGCTGG + Intronic
1043039819 8:75248978-75249000 CAAGCTGGCAGTATTTCTGCTGG - Intergenic
1043323323 8:79017945-79017967 TAGCCTGGCAGTACTTCTCATGG - Intergenic
1044581510 8:93830426-93830448 CAGTCTGTCAGAACTTCTGGAGG + Intergenic
1045496826 8:102716385-102716407 CAGCCGGGCAGCTCTCCTGTTGG + Intergenic
1048455608 8:134575484-134575506 CAGCCTGGCTGCATTCCTTCTGG - Intronic
1048843442 8:138584706-138584728 CAGCCTGGCTGCACTCAAGCTGG + Intergenic
1049381745 8:142319687-142319709 GAGCCTGGCACCACCACTGCAGG + Intronic
1049582860 8:143420708-143420730 CAGCCTCGCAGCACATCTGAGGG - Intronic
1049717490 8:144099829-144099851 CTCCCTGCCAGCTCTTCTGCAGG + Exonic
1049800701 8:144516272-144516294 CAGCTTGGCTGCTCTCCTGCTGG + Exonic
1050574441 9:6978627-6978649 CAGGCTGGCAGCATTTCTGCTGG + Intronic
1050949177 9:11566609-11566631 TAGCCTGGCAGTACTCCTGTGGG - Intergenic
1053140557 9:35680114-35680136 CAGCCAGGCAGGAATTCAGCTGG - Exonic
1055317631 9:75049745-75049767 GAGCCTTGCAACACCTCTGCAGG + Intergenic
1057183959 9:93045991-93046013 CAGGCTGGCAGCATTTCTGCTGG - Intergenic
1058199955 9:102027477-102027499 CAGCCTGGCCACTCTTCTGTAGG + Intergenic
1060110125 9:120901030-120901052 CAGCCTGGCAGCACCCCAGGAGG - Intergenic
1061857159 9:133448690-133448712 CAGCCTGGCAGACCTCCCGCCGG - Exonic
1062569230 9:137177165-137177187 CAGCCTGGCAGCACTTCTGCGGG - Intronic
1186507970 X:10109359-10109381 GAGGCCGGCAGCACTTCTGGGGG + Intronic
1188729766 X:33631597-33631619 CAGCCTGCCACCACAACTGCTGG + Intergenic
1188841541 X:35023851-35023873 CAGCCTGGCAGTGCCTCTCCTGG + Intergenic
1189173257 X:38929926-38929948 CATCCTGGCAGCAGTCCTGCAGG - Intergenic
1191258817 X:58291655-58291677 CTTCCCGGCAGCACTTGTGCTGG + Intergenic
1192268900 X:69559916-69559938 CAGCCTGGCAGTTCTTCTGAAGG + Intergenic
1192757736 X:74064179-74064201 CAAGCTAGCAGCATTTCTGCTGG + Intergenic
1193337345 X:80306548-80306570 TAGCCTGGCAGTACTCCTGCTGG - Intergenic
1193571772 X:83152549-83152571 CAGTCAGGCACCTCTTCTGCAGG - Intergenic
1195418536 X:104647172-104647194 CACCCTGCCTGCACCTCTGCAGG - Intronic
1196234398 X:113261867-113261889 CAGTCTGGCAGCTTTTCTGTGGG + Intergenic
1197273239 X:124448902-124448924 CAGTCTGGAAGTACCTCTGCTGG - Intronic
1197684741 X:129427428-129427450 CAGCCTGGCTTCACTTCCCCTGG - Intergenic
1200775558 Y:7167178-7167200 CAGCCTGCCAGCACTTGGGAGGG + Intergenic
1201782332 Y:17737523-17737545 CAGTCAGGCATCTCTTCTGCAGG + Intergenic
1201819221 Y:18168465-18168487 CAGTCAGGCATCTCTTCTGCAGG - Intergenic
1202342183 Y:23881571-23881593 CAGTCAGGCATCTCTTCTGCAGG + Intergenic
1202528586 Y:25788514-25788536 CAGTCAGGCATCTCTTCTGCAGG - Intergenic