ID: 1062569231

View in Genome Browser
Species Human (GRCh38)
Location 9:137177166-137177188
Sequence CCAGCCTGGCAGCACTTCTG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 290
Summary {0: 1, 1: 0, 2: 1, 3: 24, 4: 264}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1062569231_1062569239 23 Left 1062569231 9:137177166-137177188 CCGCAGAAGTGCTGCCAGGCTGG 0: 1
1: 0
2: 1
3: 24
4: 264
Right 1062569239 9:137177212-137177234 GAGCAGAGCCGCCGAGGCCAAGG No data
1062569231_1062569237 17 Left 1062569231 9:137177166-137177188 CCGCAGAAGTGCTGCCAGGCTGG 0: 1
1: 0
2: 1
3: 24
4: 264
Right 1062569237 9:137177206-137177228 CTCCAAGAGCAGAGCCGCCGAGG No data
1062569231_1062569234 -10 Left 1062569231 9:137177166-137177188 CCGCAGAAGTGCTGCCAGGCTGG 0: 1
1: 0
2: 1
3: 24
4: 264
Right 1062569234 9:137177179-137177201 GCCAGGCTGGAGTGAAAGGAAGG No data
1062569231_1062569236 -6 Left 1062569231 9:137177166-137177188 CCGCAGAAGTGCTGCCAGGCTGG 0: 1
1: 0
2: 1
3: 24
4: 264
Right 1062569236 9:137177183-137177205 GGCTGGAGTGAAAGGAAGGCAGG No data
1062569231_1062569240 30 Left 1062569231 9:137177166-137177188 CCGCAGAAGTGCTGCCAGGCTGG 0: 1
1: 0
2: 1
3: 24
4: 264
Right 1062569240 9:137177219-137177241 GCCGCCGAGGCCAAGGCTGACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1062569231 Original CRISPR CCAGCCTGGCAGCACTTCTG CGG (reversed) Intronic
900241455 1:1619470-1619492 CCCGCCTGCCAACCCTTCTGCGG - Intronic
900919409 1:5661264-5661286 GCAGCCTGGCACCATTCCTGGGG + Intergenic
901217006 1:7560586-7560608 CCTGCCTGTCTGCACGTCTGAGG - Intronic
902212763 1:14915559-14915581 CCTGCCCAGCAGCACTGCTGAGG + Intronic
902676334 1:18011044-18011066 AGAGGCTGGCAGTACTTCTGGGG + Intergenic
903535363 1:24063089-24063111 CCAGCCTGGCTGGGGTTCTGGGG + Intronic
905307990 1:37032511-37032533 CCAGCCTGGCACCATTCCAGGGG - Intronic
905881569 1:41467510-41467532 CACGCCTGCCAGCACTCCTGGGG + Intergenic
906785294 1:48610403-48610425 CCAACCTGGCAGTGATTCTGTGG - Intronic
908392902 1:63699439-63699461 CCTGCCTGGCAGGAGTTCTCAGG + Intergenic
910956890 1:92715978-92716000 CAAGCCTTGCAGCACTTTGGTGG - Intronic
915087263 1:153397246-153397268 CCAGCCTTGCAGCAGCGCTGGGG - Intergenic
915666991 1:157454097-157454119 CTAGCCTGTCAGCACTTGGGAGG - Intergenic
916211959 1:162366925-162366947 CCAGCTTAGCAGCACCTCTCCGG - Intronic
916961021 1:169890050-169890072 CCAGGCTGCCAGTACTGCTGGGG - Intronic
917333953 1:173909688-173909710 CCACTCTTGCAGCACCTCTGGGG + Exonic
919805522 1:201379060-201379082 CCACACTGCCAGCACATCTGTGG + Intronic
920285422 1:204875372-204875394 GGAGCCTGGCAACACTACTGAGG + Intronic
920971696 1:210748691-210748713 CCAGGCAGGCATCAGTTCTGAGG + Intronic
921119950 1:212127520-212127542 CCAGCCGCTCAGCTCTTCTGTGG - Intergenic
922563637 1:226587122-226587144 CCAGGCTGGGAGCACATCAGAGG + Intronic
922774284 1:228207757-228207779 CCTGGCTGGCATCACTGCTGAGG + Intronic
922975685 1:229781631-229781653 CCCGCCTGGCAGCAAGGCTGAGG - Intergenic
1062797161 10:353135-353157 GCTGCCTCCCAGCACTTCTGTGG - Intronic
1063587608 10:7366779-7366801 TCAGCCTGCCAGCAGTGCTGAGG - Intronic
1065971058 10:30806370-30806392 CCAGCCTTGCAGGGCCTCTGTGG + Intergenic
1067061748 10:43081345-43081367 GCAGGCTGGGAGCACTCCTGAGG + Intronic
1067738581 10:48878233-48878255 CCAGCCTGCCTGCTCCTCTGTGG - Intronic
1068673828 10:59749927-59749949 CTCGCCTGGCAGCACTCCTGAGG + Intergenic
1069531125 10:69220325-69220347 CCAGGCTGGCAGACCTCCTGGGG - Exonic
1070620347 10:78004727-78004749 GCAGCCTGGCTGCACTGCTGAGG - Exonic
1070829516 10:79409905-79409927 CCAGCTGGGCAGCTCTTCTCTGG - Intronic
1072665642 10:97390510-97390532 CCTGCCTGGCCACCCTTCTGCGG - Exonic
1073008241 10:100340721-100340743 CCAGCCTGGGAGCACTGAGGTGG - Intergenic
1073439454 10:103544068-103544090 CCCGCCTGGCAGCCCTGCAGAGG + Intronic
1073623363 10:105072078-105072100 CCAGCCAGCCAGCACTTCCCAGG - Intronic
1074771481 10:116737724-116737746 CCAGCCCCGCAGGACATCTGCGG + Intronic
1075494029 10:122903039-122903061 ACAACCTGTCAACACTTCTGGGG + Intergenic
1075569551 10:123529722-123529744 TCAGGCTGCCAGCTCTTCTGTGG + Intergenic
1075738157 10:124676793-124676815 CCAGCATGCCAGCACGTCTTTGG - Intronic
1076302323 10:129437598-129437620 CCATTCTGTCAGCACTGCTGGGG - Intergenic
1076487463 10:130833958-130833980 TCAGGCAGGCTGCACTTCTGGGG - Intergenic
1076616400 10:131757969-131757991 CCAGCCTGGGAGCTCCACTGAGG + Intergenic
1078445555 11:11402443-11402465 CCAGCATGGCAGCAGATCAGAGG - Intronic
1078929970 11:15905465-15905487 CCAGCCTGGGGGCAGCTCTGTGG - Intergenic
1083257568 11:61506046-61506068 CCAGCCTGGCAGAGCTTCCTGGG - Intergenic
1083628355 11:64083404-64083426 CCAGCCTGGCAACACTGCCTGGG + Intronic
1083629800 11:64089633-64089655 CCAGCCTGGCCCCACTCCTGGGG + Intronic
1083961018 11:66015176-66015198 CCAGGCAGGCAGCACTGCAGTGG + Intergenic
1084008201 11:66334151-66334173 CCATCCTGGCAGCCCGCCTGCGG - Exonic
1084273496 11:68040767-68040789 CTAGCCAGGGAGCACTGCTGTGG - Intronic
1084904436 11:72334911-72334933 GCTTCCTGGCAGCACTGCTGCGG + Intronic
1084951829 11:72670721-72670743 CCAGCCTGGCCCTACTTCAGGGG + Intronic
1090830423 11:130417065-130417087 CCCGCCACGCAGAACTTCTGTGG - Exonic
1096478178 12:51921279-51921301 CCACCCTGGCAGCTCTGGTGGGG - Intronic
1098056871 12:66516372-66516394 CCACCCTGGCTGTACTTTTGTGG - Intronic
1100086796 12:90921002-90921024 CAATACTGCCAGCACTTCTGTGG - Intronic
1100329386 12:93570535-93570557 CCCTCCTGGCCGCACTTTTGCGG - Intronic
1101604604 12:106238689-106238711 CCAGCCAGACAGGATTTCTGAGG + Exonic
1102481530 12:113227145-113227167 CCAGCTTGGCAGTGTTTCTGGGG + Intronic
1103691572 12:122779252-122779274 CCAGCCTGGCAGAAATTATCAGG + Intronic
1103912830 12:124361653-124361675 CCCGGCTGGCAGCAGCTCTGGGG - Intronic
1105660153 13:22485084-22485106 CCCACCTGGCACCATTTCTGAGG - Intergenic
1106287256 13:28328717-28328739 CCAGCATGGAAGCCCCTCTGAGG - Intronic
1106510415 13:30408220-30408242 CCAGCCTGGCGGGACATTTGGGG + Intergenic
1107790332 13:43995549-43995571 GCAGCCTGCCAGCACTTGAGAGG + Intergenic
1107999896 13:45896412-45896434 CCAGTCTGGCAGCCCTGGTGGGG + Intergenic
1108475418 13:50811537-50811559 CGTTCCTGGCAGAACTTCTGTGG + Intronic
1113776330 13:112947729-112947751 CCAGCCTGGGAGAACTGCTGAGG - Intronic
1114007884 14:18333352-18333374 CCAGCCTGACAGCGCCTCAGTGG + Intergenic
1114646721 14:24260172-24260194 CTAGCCTGACAGGACTGCTGTGG + Intronic
1116763875 14:49047482-49047504 CCTGCCTTGTAGCAATTCTGGGG - Intergenic
1119432265 14:74576032-74576054 CCAGACTCTCAGCACTCCTGAGG + Intronic
1119483255 14:74973132-74973154 CCAGCCTGGCGGCGCTCTTGCGG + Intergenic
1121085532 14:91143384-91143406 CGCGCCTGGCAGCAGTTCTGAGG + Intronic
1121495376 14:94388481-94388503 CCAGGCAGGCAGCAGGTCTGGGG - Intronic
1122015405 14:98790996-98791018 CCACCCTAGCAGCAGTTCTCTGG - Intergenic
1122631101 14:103108121-103108143 CCAGCCTGAAAGCACTGCTAGGG - Intronic
1122650891 14:103226473-103226495 TCAGCCGGGCAGCAATTCTGAGG - Intergenic
1122862007 14:104586933-104586955 CCAGCCTGGCAGTGCCTCAGAGG - Intronic
1122896390 14:104759665-104759687 CTTGTCTGTCAGCACTTCTGAGG + Intronic
1127556563 15:60093691-60093713 CTAGCCTGGCTGCACTGCTCCGG + Intergenic
1128232234 15:66043404-66043426 CTCTCCTGGCAGGACTTCTGAGG + Intronic
1128351871 15:66896274-66896296 CCAGTCTGTCGGCACTGCTGTGG + Intergenic
1129228818 15:74185113-74185135 CCACCCTGGCAGGGGTTCTGAGG - Intronic
1129270847 15:74418559-74418581 CCAGCTGGGCAGCGCTGCTGCGG - Intronic
1129391795 15:75224416-75224438 GCAGCCTGGCAGCCCTCCCGTGG - Intergenic
1129721137 15:77878783-77878805 CCAGCCTGGCAGAACTAGAGGGG + Intergenic
1129878870 15:78994284-78994306 CCAGCCCTGCAGCACTGCTCTGG + Intronic
1132081859 15:98872884-98872906 CCAGCCTGGCTGCATTTTTAAGG - Intronic
1132233252 15:100200403-100200425 CCATGCCGGCCGCACTTCTGGGG + Intronic
1132282471 15:100632227-100632249 CCAGACTGCCAGGACTACTGAGG - Intronic
1132705420 16:1241248-1241270 CCATACTGGATGCACTTCTGCGG + Exonic
1132708550 16:1256611-1256633 CCATACTGGATGCACTTCTGCGG + Exonic
1134220936 16:12353392-12353414 CAGGCTTGGCAGCACATCTGGGG - Intronic
1135283157 16:21170567-21170589 CCACCCTGGCTGCTCTGCTGGGG + Exonic
1137502898 16:49024993-49025015 GCAGCCTCCCAGCACTTCTTGGG + Intergenic
1137676991 16:50308661-50308683 CGAGCTGGGCAGCACCTCTGTGG - Exonic
1139599190 16:67976415-67976437 CCAGCCTAGCAGACCTGCTGTGG - Intronic
1141054669 16:80804161-80804183 GCAGCCTGGCATGGCTTCTGGGG - Exonic
1141605368 16:85150126-85150148 GCAGCCTGGCAGCCCCTCCGAGG + Intergenic
1141655779 16:85415676-85415698 CCACCCTCGCAGCTCTGCTGTGG - Intergenic
1141689500 16:85588274-85588296 CCAGCCTGGCCGCTCTTGAGGGG + Intergenic
1141948839 16:87327759-87327781 CCAACCTGTCTGTACTTCTGGGG - Exonic
1142160153 16:88553173-88553195 CCCGGCTGGCACCACCTCTGTGG - Intergenic
1142682775 17:1560280-1560302 CCAGCCCGGCAGTTCCTCTGTGG - Intronic
1143010181 17:3861904-3861926 CCAGCCGGGTGGCATTTCTGAGG + Intronic
1143092790 17:4458966-4458988 CCTGCGTGGCAGGACTTCAGTGG - Intronic
1143239060 17:5428534-5428556 CCATGCTGGCACCACTTTTGCGG + Exonic
1145296040 17:21593299-21593321 CCAGGCTTCCAGCCCTTCTGTGG - Intergenic
1145922053 17:28616965-28616987 CCAGACTGGCAGGAGCTCTGGGG + Exonic
1146059887 17:29599086-29599108 CCACCCTGACAGCCCATCTGAGG - Intronic
1146634154 17:34491764-34491786 CCAGCCATGCAGCAGATCTGAGG - Intergenic
1150286297 17:63956080-63956102 CCAGCTGGCCAGCATTTCTGCGG - Intronic
1150334429 17:64320285-64320307 GGAGCCTGGCAGCAATTCTTAGG + Exonic
1152705021 17:81838881-81838903 CCAGCGTGGCTGCATTTCTAGGG + Intergenic
1153062950 18:1012971-1012993 CCAGCCAGGCAGAACCTGTGTGG - Intergenic
1153964308 18:10166403-10166425 ACAGCCTGGCAGCAGCTCGGAGG - Intergenic
1154475143 18:14748063-14748085 CCAGCCCGGCAGCGCCTCAGCGG + Intronic
1155735501 18:29217690-29217712 TCAGTCTGGCAGCACCTCTCAGG + Intergenic
1157335522 18:46734418-46734440 CCACCCTGGCAGTACACCTGGGG + Intronic
1157733042 18:50021257-50021279 CAAGCCTGGCAACACTTTGGAGG + Intronic
1160413344 18:78689275-78689297 CCACCCTGGCAGCTCCTTTGTGG - Intergenic
1160535647 18:79589999-79590021 CCAGCCTCACAGCCCTCCTGGGG + Intergenic
1160986269 19:1840403-1840425 CCAGCCTGGGAGCGCTCCTGCGG - Intronic
1161069620 19:2253584-2253606 CCAGCCTCGCCCCACCTCTGGGG + Intronic
1161232285 19:3180256-3180278 GCAGCCTGGGAGCCCTACTGAGG - Exonic
1161567570 19:5012140-5012162 CCAGCCTGTCAACCCTGCTGCGG - Intronic
1161577032 19:5060034-5060056 CTGGCCTGGCAGCAGCTCTGAGG - Intronic
1162120055 19:8459278-8459300 CCAGACAGGCTGCACTGCTGGGG - Intronic
1162998381 19:14350683-14350705 ACAGCCTGGCCTCAGTTCTGGGG + Intergenic
1164807429 19:31127785-31127807 CCAGTCTGGAAGCCCTGCTGTGG - Intergenic
1164906837 19:31974741-31974763 CCCTCTTTGCAGCACTTCTGTGG - Intergenic
1164936777 19:32220880-32220902 CCAGCCTGGCCACACACCTGGGG + Intergenic
1165122721 19:33571626-33571648 CCAGCCTGTTAGCATTTCTAGGG - Intergenic
1166750543 19:45162243-45162265 CCAGGCGGGCAGCACTGCAGAGG + Intronic
1166955826 19:46464204-46464226 CCATCCTGGCCGCACCTGTGGGG + Intergenic
1167422268 19:49411147-49411169 CCAGTCTGGCTGAACTCCTGGGG + Intronic
1168710637 19:58498151-58498173 CCAGCCTCGCAGCTGCTCTGAGG - Intronic
925008206 2:461914-461936 CCAGCCTGCCCTCACTGCTGTGG + Intergenic
925062540 2:904686-904708 CCTCCCTGGCAGCACTGGTGTGG + Intergenic
925725237 2:6865496-6865518 CCCGCCTGGCGGCGCTGCTGGGG - Exonic
926773788 2:16402198-16402220 TCAGCCTTGCTGCACATCTGTGG - Intergenic
927481358 2:23456802-23456824 CCAGGATGGCAGCCCTTGTGGGG + Intronic
932406363 2:71515398-71515420 GCAGCCTGGCAGCTCTTCTATGG + Intronic
938100584 2:128495314-128495336 CCTGCCTGCCACCTCTTCTGGGG + Intergenic
942594018 2:177575158-177575180 CTAGGGTGGCAGCACTTCAGTGG + Intergenic
942850968 2:180485155-180485177 CCACCCTGGCTGCAATACTGTGG - Intergenic
943740526 2:191402464-191402486 CCAGCCTGACACCAATTCTTTGG + Intronic
945655669 2:212620128-212620150 CAAACTTGGCAGCATTTCTGGGG - Intergenic
946331372 2:219010846-219010868 CCAGCCAGGCAGCACTGCCCGGG - Exonic
946740542 2:222796811-222796833 GCAGCCTGGAATCACTTCTGAGG - Intergenic
947700562 2:232230803-232230825 CCAGCAGGGCAGCTCTTCTCAGG + Intronic
948277560 2:236721136-236721158 CCAGCCTGGCAGCGCTTCCACGG + Intergenic
1171181704 20:23095693-23095715 CCAGCCTGGCGGCACTAAGGAGG - Intergenic
1171238463 20:23546621-23546643 CCACCCTCCCAGCACTTCTATGG + Intergenic
1171437575 20:25135126-25135148 CCAGCCTGTGCGCACTTCAGAGG + Intergenic
1171446129 20:25205970-25205992 ACAGCATGGCTGCACTGCTGAGG - Intronic
1171967902 20:31544209-31544231 CCAGCCTGGTGGCAGTACTGTGG - Intronic
1172005497 20:31816630-31816652 CCAGCCTGGGACAACTTCAGGGG - Intergenic
1174376377 20:50129181-50129203 CCTGCCTGGCAGGGCTTCTGGGG - Intronic
1174486618 20:50865448-50865470 GCAGCTTGGCAAGACTTCTGGGG + Intronic
1174839172 20:53885584-53885606 ACATCCAGGCAGCACCTCTGGGG - Intergenic
1175883090 20:62271746-62271768 CCAGCCTGGGACCACTACTCTGG + Intronic
1175922324 20:62455995-62456017 GCAGCAGGGCAGCTCTTCTGGGG - Intergenic
1175951213 20:62584383-62584405 CCAGGCAGCCAGCAGTTCTGGGG - Intergenic
1176045786 20:63091978-63092000 CCTGCGGGGCAGCCCTTCTGTGG - Intergenic
1176253506 20:64138516-64138538 CCAGCCTGTCTCCACTTTTGGGG + Intergenic
1179781691 21:43704993-43705015 TCAGCTTGACAGCACTCCTGCGG + Intergenic
1180982048 22:19883162-19883184 CCAGCCTGTCTGGAGTTCTGGGG - Intronic
1182696547 22:32202760-32202782 CCACCCTGGCTGCACTCCTCGGG + Exonic
1183358463 22:37371581-37371603 CCAGCCTGGCAGCAGCTCCTGGG - Exonic
1183507590 22:38218237-38218259 CCAATCTGCCAGCCCTTCTGGGG + Intergenic
1184640044 22:45865872-45865894 CCGGCCTGGCAGTGCGTCTGCGG - Intergenic
1185009386 22:48304811-48304833 CCTGCCTGGGAGCCCTTCTGCGG + Intergenic
1185067672 22:48640218-48640240 CCTGCCTGGGAGCCCTGCTGAGG - Intronic
1185376453 22:50484670-50484692 CCAGCTTGGCACCCCGTCTGGGG + Exonic
950520414 3:13494766-13494788 CCAGCCTGCCCACACTGCTGGGG - Intronic
954327460 3:49871229-49871251 CCAGGCTGGTGCCACTTCTGGGG + Intergenic
954594763 3:51814829-51814851 CCAGCCTGGTAGCACCTCCGGGG - Intergenic
955960343 3:64334242-64334264 CTAGCTTTGCAGCACTTTTGAGG + Intronic
956125392 3:66006202-66006224 CCAGTATGGAAGCACTTGTGTGG + Intronic
957837750 3:85619898-85619920 CCAGCCTGTCAGAAGTTCTAAGG + Intronic
957938504 3:86974711-86974733 GTAGCATGGTAGCACTTCTGTGG + Intronic
959748639 3:109807431-109807453 CCAGCCTGGCTCCTCTTCTCTGG - Intergenic
961075536 3:123978378-123978400 CTACCTGGGCAGCACTTCTGTGG - Intronic
961268786 3:125671850-125671872 CCAGCAGGCCAGCACTGCTGGGG - Intergenic
961308150 3:125974130-125974152 CTACCCGGGCAGCACTTCTGTGG + Intronic
961461619 3:127053692-127053714 CCAGCCTTGCAGCACAACTTTGG - Intergenic
961506757 3:127375265-127375287 GCCCCCTGGCAGCATTTCTGGGG + Intergenic
961933159 3:130554946-130554968 CCAGCCTGGCTGCCCAACTGGGG - Intergenic
964772491 3:160239166-160239188 CCTGCCTGCCACAACTTCTGTGG - Intronic
966557841 3:181283959-181283981 GGAGCCTGGCAACATTTCTGAGG + Intergenic
969942939 4:10753177-10753199 TCAACCTGGCAGAAATTCTGGGG + Intergenic
969946982 4:10793536-10793558 CCGGCCTGCCAGCACTTGGGAGG - Intergenic
970350029 4:15193093-15193115 GCAGCCTGGAACCACTTCTGTGG - Intergenic
970615751 4:17766994-17767016 CCAGCGGGCCAGCACTGCTGGGG + Intronic
972665378 4:41160191-41160213 CCAGGCCGGCAGCACCTGTGAGG - Intronic
976404170 4:84643275-84643297 TCAACGTGGCAGCATTTCTGTGG - Intronic
979206678 4:118046503-118046525 CCAGCCTGCCAGCCCCTCTCAGG + Intronic
979701709 4:123675734-123675756 CCAGCCTGTGAGCACATCTGAGG - Intergenic
981283123 4:142984049-142984071 CCATCCTGGCAGTATATCTGAGG - Intergenic
981720170 4:147793632-147793654 TCAGCCTGCCCTCACTTCTGAGG + Intronic
982532159 4:156558582-156558604 CAGGCCTGGCAGCACAGCTGTGG + Intergenic
983557406 4:169070662-169070684 CCGGCCTGGCAGCACCCCTCAGG + Intergenic
985701665 5:1377177-1377199 TCAGCCTGGCATAGCTTCTGTGG - Intergenic
985834298 5:2259539-2259561 TGACCCTGGCAGCATTTCTGGGG + Intergenic
986147003 5:5087726-5087748 ACAGCCTGGCACCACTCCTGGGG + Intergenic
987616230 5:20277399-20277421 CCACCCAGGCAGCACCTCTATGG + Intronic
988092993 5:26567437-26567459 GCAGCCTGCCAGCACTTGGGAGG + Intergenic
988175254 5:27715026-27715048 CCTGCCTGTAAGCACTACTGTGG - Intergenic
991066767 5:62432295-62432317 CCATCCAGGCACCACTCCTGCGG - Intronic
991516567 5:67442747-67442769 CCAGCGAGGCAGCACTACAGGGG - Intergenic
991690359 5:69219385-69219407 CCAGCCTGGCAGCAGGAGTGTGG + Intronic
994098825 5:95872745-95872767 CCATCCTGGCAGCACTTCTTGGG + Intergenic
994171826 5:96666490-96666512 CCAGGCTGGCAGCAATGATGGGG - Intronic
994342399 5:98646467-98646489 AGAGCATGGCATCACTTCTGGGG + Intergenic
995054717 5:107746214-107746236 TCATACTGGCTGCACTTCTGTGG + Intergenic
995833507 5:116378376-116378398 CTAGCCTGACACCACCTCTGAGG - Intronic
996054591 5:118968978-118969000 CCAGCCTGCCGGCTCCTCTGGGG + Intronic
996347987 5:122508264-122508286 CTTGCCTGGCAGCTCTTGTGAGG - Intergenic
996791097 5:127293903-127293925 CCACCTTTGCAGCACTTCTCAGG + Intronic
996946129 5:129070348-129070370 CTTCCCTGGCACCACTTCTGGGG - Intergenic
998727884 5:145039482-145039504 CAAGCCTGGCAGAGCTTCTAAGG + Intergenic
1001286514 5:170427680-170427702 GCAGCCTGGGAGCAGTCCTGGGG - Intronic
1001770927 5:174295252-174295274 CCAGCCTGCCTCCTCTTCTGGGG + Intergenic
1002976823 6:2087170-2087192 CTATCCTGTCAGAACTTCTGAGG - Intronic
1003155560 6:3590698-3590720 CCAGGCTGAAAGCACTGCTGGGG + Intergenic
1003991854 6:11494156-11494178 CCAGCATGGCAGCCCTTCTCTGG - Intergenic
1004175329 6:13335078-13335100 CCAGCCTGGCAGCTGTGTTGGGG + Intergenic
1004930504 6:20458760-20458782 GCATCCTGGAACCACTTCTGGGG - Intronic
1006671345 6:35731638-35731660 CCCGCCTGGCCGCCCTTCTCGGG + Intergenic
1007289613 6:40775526-40775548 GCAGCCTGTGAGCACTCCTGGGG + Intergenic
1008751284 6:54736895-54736917 CCAGCCCAGCAGTACTTCTTCGG - Intergenic
1012202829 6:96427020-96427042 CAAGGCTGGCAGATCTTCTGAGG - Intergenic
1012880376 6:104781006-104781028 ACATCATGGCATCACTTCTGTGG - Intronic
1014832035 6:126114281-126114303 CTAGACTGGAATCACTTCTGAGG - Intergenic
1015322626 6:131893353-131893375 GCAGCCTGGCACCCCTCCTGTGG - Exonic
1019102615 6:169643485-169643507 ACAGCGTGGCAGCACTTTCGTGG - Intronic
1019731010 7:2629691-2629713 CCAGCCTGGCAGCCCTGCCAGGG - Intergenic
1021785940 7:24152642-24152664 CCAGCCTGGCAGTCCCTATGTGG - Intergenic
1025251827 7:57356529-57356551 CCAGCCTGCCCCCAGTTCTGTGG - Intergenic
1025996435 7:66530260-66530282 CCATTCCGGCAGCATTTCTGGGG - Intergenic
1026535675 7:71236752-71236774 CCTCCCTCGCAGCACTTCTGCGG + Intronic
1029083917 7:97996713-97996735 CCAGCCTGGCTGCCCTTGTGGGG + Intergenic
1030181745 7:106716696-106716718 CCAGCTTTGGAGCACTTCTCTGG - Intergenic
1034397173 7:150835984-150836006 ACAGCCTGGAAGCCCTTCTCCGG - Intronic
1034479360 7:151307848-151307870 TGAGGCTGGCAGCACTTCTGAGG + Intergenic
1035148288 7:156842776-156842798 CCAGGCTGCCAGCACTGCTGAGG - Intronic
1035156714 7:156920318-156920340 CAAGCCTGGCAGCACTGGCGAGG + Intergenic
1035333753 7:158112851-158112873 CCAGCCTGGACGCCCTGCTGTGG - Intronic
1035574762 8:697448-697470 GCACCCTGGCAGCACCCCTGAGG - Intronic
1037447305 8:18978919-18978941 GCTGCCTGGAAGCTCTTCTGTGG - Intronic
1037654749 8:20873275-20873297 AGAGGCTGGCAGCACTTTTGAGG - Intergenic
1040009537 8:42649805-42649827 ACAGGCTGGCAGGATTTCTGAGG - Intergenic
1040027701 8:42796777-42796799 CCAGCGGGCCAGCACTGCTGGGG - Intergenic
1040547537 8:48410470-48410492 CCAGCTTGGCAGCAGTTTTGAGG + Intergenic
1040958424 8:53004789-53004811 CTAGCTTGGCATCACATCTGTGG + Intergenic
1041148596 8:54907560-54907582 CCAGGCTGGCTGGACTTCAGTGG + Intergenic
1041692949 8:60707327-60707349 CTTGACTGGCAGCTCTTCTGTGG + Intronic
1044521578 8:93205352-93205374 CAAGCCTTGCAGCACTGCAGTGG + Intergenic
1044798939 8:95933539-95933561 CAAGCCTTGCAGCACTGCAGTGG + Intergenic
1047168647 8:122467492-122467514 CCAGTCTGGAAGCACCTCAGGGG + Intergenic
1047861851 8:128975852-128975874 CCAGCCTGCCAGCATTTCCTGGG + Intergenic
1049284825 8:141768920-141768942 CCAGCCTGGGAGCATCTGTGGGG + Intergenic
1049582861 8:143420709-143420731 GCAGCCTCGCAGCACATCTGAGG - Intronic
1049709264 8:144056343-144056365 CCAGCCTGACAGCACCCATGGGG - Intronic
1049760595 8:144330477-144330499 CCAGTCTGGCAGTACCTCAGAGG - Intergenic
1049848756 8:144819583-144819605 TCAACCTGGCAGCAACTCTGGGG + Intergenic
1050490605 9:6184424-6184446 CCTGCCAGGCAGCCCTTTTGTGG + Intergenic
1050949178 9:11566610-11566632 GTAGCCTGGCAGTACTCCTGTGG - Intergenic
1052585751 9:30425479-30425501 GTAGCCTGGCAGTACCTCTGTGG + Intergenic
1053707289 9:40768392-40768414 CCAGCCCGACAGCACCTCAGTGG - Intergenic
1054417205 9:64889160-64889182 CCAGCCCGACAGCACCTCAGTGG - Intergenic
1056198444 9:84251226-84251248 CCAGGATGGCAGCACCACTGTGG + Intergenic
1056753345 9:89367414-89367436 CCAGCCTGGCCGCTCTCTTGAGG - Intronic
1056808087 9:89744124-89744146 CCAGCCAGGCAGCTCTTCACAGG - Intergenic
1057719578 9:97521074-97521096 CCAGCTGGGAAACACTTCTGGGG - Intronic
1058966347 9:110042394-110042416 CCAGCCTGGCAGTAAGTCTATGG + Intronic
1060217315 9:121746167-121746189 CCTTCCTGCCAGCACTTCTCTGG - Intronic
1060869666 9:127029546-127029568 CCAGCCTGGCAGTGGTCCTGAGG + Intronic
1061370370 9:130194315-130194337 CCACCCCGGCAGCGCTCCTGAGG - Intronic
1061452906 9:130678269-130678291 TCAGCTTGGAAGCACTCCTGTGG + Intronic
1062569231 9:137177166-137177188 CCAGCCTGGCAGCACTTCTGCGG - Intronic
1062664248 9:137658918-137658940 CCAGCCCAGGAACACTTCTGTGG + Intronic
1186507969 X:10109358-10109380 GGAGGCCGGCAGCACTTCTGGGG + Intronic
1194990538 X:100542777-100542799 CCAGCCAGGCAGCAGCTGTGTGG + Intergenic
1196234397 X:113261866-113261888 ACAGTCTGGCAGCTTTTCTGTGG + Intergenic
1199980521 X:152918056-152918078 CCAGACTGGCAGCACTAGAGAGG - Exonic
1200775557 Y:7167177-7167199 GCAGCCTGCCAGCACTTGGGAGG + Intergenic