ID: 1062569235

View in Genome Browser
Species Human (GRCh38)
Location 9:137177180-137177202
Sequence GCCTTCCTTTCACTCCAGCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 954
Summary {0: 1, 1: 0, 2: 2, 3: 64, 4: 887}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1062569235_1062569237 3 Left 1062569235 9:137177180-137177202 CCAGGCTGGAGTGAAAGGAAGGC 0: 1
1: 0
2: 2
3: 64
4: 887
Right 1062569237 9:137177206-137177228 CTCCAAGAGCAGAGCCGCCGAGG No data
1062569235_1062569239 9 Left 1062569235 9:137177180-137177202 CCAGGCTGGAGTGAAAGGAAGGC 0: 1
1: 0
2: 2
3: 64
4: 887
Right 1062569239 9:137177212-137177234 GAGCAGAGCCGCCGAGGCCAAGG No data
1062569235_1062569246 25 Left 1062569235 9:137177180-137177202 CCAGGCTGGAGTGAAAGGAAGGC 0: 1
1: 0
2: 2
3: 64
4: 887
Right 1062569246 9:137177228-137177250 GCCAAGGCTGACGGAGCAGGGGG No data
1062569235_1062569243 22 Left 1062569235 9:137177180-137177202 CCAGGCTGGAGTGAAAGGAAGGC 0: 1
1: 0
2: 2
3: 64
4: 887
Right 1062569243 9:137177225-137177247 GAGGCCAAGGCTGACGGAGCAGG No data
1062569235_1062569240 16 Left 1062569235 9:137177180-137177202 CCAGGCTGGAGTGAAAGGAAGGC 0: 1
1: 0
2: 2
3: 64
4: 887
Right 1062569240 9:137177219-137177241 GCCGCCGAGGCCAAGGCTGACGG No data
1062569235_1062569245 24 Left 1062569235 9:137177180-137177202 CCAGGCTGGAGTGAAAGGAAGGC 0: 1
1: 0
2: 2
3: 64
4: 887
Right 1062569245 9:137177227-137177249 GGCCAAGGCTGACGGAGCAGGGG No data
1062569235_1062569244 23 Left 1062569235 9:137177180-137177202 CCAGGCTGGAGTGAAAGGAAGGC 0: 1
1: 0
2: 2
3: 64
4: 887
Right 1062569244 9:137177226-137177248 AGGCCAAGGCTGACGGAGCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1062569235 Original CRISPR GCCTTCCTTTCACTCCAGCC TGG (reversed) Intronic
900205510 1:1430538-1430560 GCCTTCCTTCCCCTCCTGCCCGG + Intergenic
900381000 1:2383881-2383903 GCCTCCCCTTCCCACCAGCCAGG + Intronic
901168537 1:7237036-7237058 AACTGCCTTTCCCTCCAGCCAGG + Intronic
901268225 1:7929203-7929225 TCCTGCACTTCACTCCAGCCTGG - Intronic
901729071 1:11265326-11265348 GGCTCCCCTGCACTCCAGCCTGG - Intergenic
901747067 1:11380970-11380992 GGCATCATTGCACTCCAGCCTGG - Intergenic
901793916 1:11669418-11669440 GGCTCCATTGCACTCCAGCCTGG + Intronic
902304887 1:15528388-15528410 CCCATCATTGCACTCCAGCCTGG + Intronic
902444117 1:16450906-16450928 CCATTCATTGCACTCCAGCCTGG + Intronic
902452190 1:16503495-16503517 GCTCTCCATGCACTCCAGCCTGG - Intergenic
902512128 1:16972297-16972319 GCCTCCCTTTCTCTGAAGCCAGG + Intronic
902764265 1:18604494-18604516 TCATGCCATTCACTCCAGCCTGG - Intergenic
902865065 1:19272651-19272673 GCCATGATTGCACTCCAGCCTGG + Intergenic
902914440 1:19628119-19628141 GCCACCATTGCACTCCAGCCTGG - Exonic
903240602 1:21980434-21980456 GCCACCATTGCACTCCAGCCTGG + Intronic
903244345 1:22005054-22005076 GCCACCATTGCACTCCAGCCTGG + Intronic
903368718 1:22820626-22820648 GCACTCCATGCACTCCAGCCGGG + Intronic
903474721 1:23611644-23611666 GGCATCATTGCACTCCAGCCTGG + Intronic
903805867 1:26005322-26005344 CCCATCCCTTCCCTCCAGCCAGG - Intergenic
904789672 1:33009836-33009858 GGCTTCTTTTCCTTCCAGCCAGG + Intronic
905163093 1:36054314-36054336 CCCATCATTGCACTCCAGCCTGG - Intronic
905169905 1:36103621-36103643 CCATTCATTGCACTCCAGCCTGG - Intronic
905373080 1:37497279-37497301 GCCGCCCCTGCACTCCAGCCTGG - Intronic
905439187 1:37982976-37982998 TCATTCATTGCACTCCAGCCTGG - Intronic
905517956 1:38576145-38576167 CCCTGCCTTTCACTCAAGCCAGG + Intergenic
905552408 1:38853701-38853723 GGCATCATTGCACTCCAGCCTGG + Intronic
905577637 1:39058437-39058459 GCACTCCATGCACTCCAGCCTGG + Intergenic
905642819 1:39603482-39603504 GGCTCCCCTGCACTCCAGCCTGG - Intergenic
905992148 1:42347428-42347450 GGCATCCCTGCACTCCAGCCTGG - Intergenic
906010448 1:42519593-42519615 GGCATCATTGCACTCCAGCCTGG - Intronic
906196715 1:43934408-43934430 GCCTGCCTTTCCCTCCATCACGG + Intronic
906284086 1:44574740-44574762 GCCTTCCCTGACCTCCAGCCCGG + Intronic
907254685 1:53169871-53169893 CCATTCATTGCACTCCAGCCTGG + Intergenic
907533748 1:55128501-55128523 CCCTTCCTTCCATTCCAGCTTGG + Intronic
907665246 1:56428766-56428788 GTCTTCCTCACACTCCAGCCAGG + Intergenic
907684252 1:56594635-56594657 TCCCCCCTTGCACTCCAGCCTGG - Intronic
907753600 1:57287837-57287859 GGCTTCATTGCCCTCCAGCCTGG - Intronic
907942494 1:59102819-59102841 GGCAACCTTGCACTCCAGCCTGG - Intergenic
908151392 1:61306318-61306340 GGCTTCACTGCACTCCAGCCTGG - Intronic
909452233 1:75810913-75810935 CACGCCCTTTCACTCCAGCCTGG - Intronic
909491964 1:76236017-76236039 CACATCCTTGCACTCCAGCCTGG - Intronic
910179998 1:84472361-84472383 TCGTGCCTTGCACTCCAGCCTGG - Intergenic
910886184 1:91965801-91965823 GCCACCATTGCACTCCAGCCTGG + Intronic
911294791 1:96101981-96102003 TCGTGCCTTTCACTCTAGCCTGG - Intergenic
911590695 1:99744740-99744762 CCCTTCATTGCACTCCAGCCTGG + Intronic
912676666 1:111687981-111688003 GTATTCCTTGTACTCCAGCCTGG + Intronic
912916736 1:113822913-113822935 CGCATCATTTCACTCCAGCCTGG + Intronic
913193241 1:116431556-116431578 GCAGTCATTGCACTCCAGCCTGG - Intergenic
913479415 1:119272731-119272753 GCACTCCATGCACTCCAGCCTGG + Intergenic
914266619 1:146043535-146043557 GACGTCCCTGCACTCCAGCCTGG + Intergenic
914722584 1:150301456-150301478 CCATTCATTGCACTCCAGCCTGG + Intronic
915190819 1:154149127-154149149 GGCATCATTGCACTCCAGCCTGG - Intronic
915464598 1:156089547-156089569 GCCTCCATTGCACTCCAGCCTGG + Intronic
915743981 1:158142067-158142089 GGCTTCCTTTCAGACCAGTCAGG - Intergenic
915952482 1:160198746-160198768 GCCTTCCCTCCAGTCCAACCCGG - Intronic
916214957 1:162386305-162386327 GCCTTCCTGTGACTGTAGCCTGG + Intronic
916576573 1:166072277-166072299 GCCCTCCCTTCACTTCAGGCTGG - Intronic
916918553 1:169438058-169438080 GCCTGCTTTTCAAGCCAGCCTGG - Intronic
917026661 1:170650725-170650747 GGCGTCATTGCACTCCAGCCTGG - Intergenic
917236655 1:172899962-172899984 CCATTCATTGCACTCCAGCCTGG - Intergenic
917330402 1:173874383-173874405 GCACTCCATGCACTCCAGCCTGG - Intronic
917337911 1:173944127-173944149 GCACTCCATGCACTCCAGCCTGG + Intronic
917760784 1:178154865-178154887 GGCACCCTTGCACTCCAGCCTGG - Intronic
917870730 1:179239676-179239698 TGCTTCATTGCACTCCAGCCTGG - Intergenic
918002056 1:180506795-180506817 CGCTTCATTGCACTCCAGCCTGG - Intergenic
918332729 1:183474518-183474540 GGCGTCATTGCACTCCAGCCTGG + Intronic
918701055 1:187608315-187608337 GGCTCCATTGCACTCCAGCCTGG + Intergenic
918852984 1:189716765-189716787 GCGTTCACTTCACTGCAGCCTGG - Intergenic
919066212 1:192695165-192695187 TGCTTCATTGCACTCCAGCCTGG + Intergenic
919634526 1:199990559-199990581 GCCACCATTGCACTCCAGCCTGG - Intergenic
919953048 1:202383678-202383700 CCCACCCTTGCACTCCAGCCTGG + Intronic
920148137 1:203880626-203880648 GCCACCATTGCACTCCAGCCTGG + Intergenic
920407630 1:205729975-205729997 ACCTCCATTGCACTCCAGCCTGG + Intronic
920549282 1:206845042-206845064 TGCTTCATTGCACTCCAGCCTGG + Intergenic
920833142 1:209483107-209483129 CCCTTCCTTCAGCTCCAGCCTGG - Intergenic
921084845 1:211779807-211779829 GCCATCACTGCACTCCAGCCTGG + Intronic
921138393 1:212283591-212283613 GCCACCATTGCACTCCAGCCTGG + Intergenic
921562404 1:216674659-216674681 GCCATGATTGCACTCCAGCCTGG - Intronic
921720512 1:218465468-218465490 GCACTCCATGCACTCCAGCCTGG + Intergenic
921789447 1:219272734-219272756 CCATTCATTTCACTCCAGCCTGG + Intergenic
922175631 1:223195085-223195107 CTCTTCCTTTCCCTGCAGCCAGG + Intergenic
922530582 1:226341990-226342012 TCATGCCATTCACTCCAGCCTGG + Intergenic
922589454 1:226763561-226763583 GCCTCCACTGCACTCCAGCCTGG + Intergenic
922953751 1:229581511-229581533 GGCATCATTGCACTCCAGCCTGG + Intergenic
923334406 1:232954830-232954852 TCCTTCCTGTCCATCCAGCCTGG - Intronic
923518332 1:234716278-234716300 GCCATTATTGCACTCCAGCCTGG + Intergenic
923728420 1:236527777-236527799 TGCATCATTTCACTCCAGCCTGG - Intronic
924019114 1:239761954-239761976 CCCTTCCCTGCACTGCAGCCTGG + Intronic
924363639 1:243266897-243266919 GCACTACTTGCACTCCAGCCTGG + Intronic
924693654 1:246377411-246377433 GGCGTCATTGCACTCCAGCCTGG - Intronic
924716906 1:246583983-246584005 ACCATCCCTTCACTCCAGCCTGG - Intronic
924792077 1:247260775-247260797 TCCTCCATTGCACTCCAGCCTGG + Intergenic
1063108795 10:3017359-3017381 GGCATCATTGCACTCCAGCCTGG + Intergenic
1063241812 10:4177485-4177507 GGCTTGCTTTCTCTCCAACCTGG - Intergenic
1063705221 10:8423845-8423867 TCGTGCCTTGCACTCCAGCCTGG + Intergenic
1063783761 10:9356514-9356536 GCAGTCCTTGCACTCCAGCCTGG + Intergenic
1063819936 10:9822684-9822706 GGCATCATTGCACTCCAGCCTGG - Intergenic
1063895696 10:10679331-10679353 CACATCATTTCACTCCAGCCTGG - Intergenic
1063957680 10:11281699-11281721 GCCATAATTTCACTCCAGCCCGG + Intronic
1064009862 10:11727241-11727263 GCAATCCCTGCACTCCAGCCTGG + Intergenic
1064275031 10:13897891-13897913 TCCGTCATTGCACTCCAGCCTGG + Intronic
1064639985 10:17405839-17405861 GCCATCATTGCACTCCAGCCTGG + Intronic
1064984114 10:21192798-21192820 TCATGCCTTGCACTCCAGCCTGG + Intergenic
1065403236 10:25330980-25331002 GCACTGCTTGCACTCCAGCCTGG - Intronic
1065476051 10:26139278-26139300 CCATTCATTGCACTCCAGCCTGG - Intronic
1065499380 10:26364296-26364318 GGCTTCACTGCACTCCAGCCTGG - Intergenic
1066003125 10:31123106-31123128 GGCGTCATTGCACTCCAGCCTGG + Intergenic
1066342795 10:34552309-34552331 GCCATAGTTTAACTCCAGCCTGG - Intronic
1067192664 10:44084074-44084096 GCCTGCCCTTCTCTCCATCCAGG - Intergenic
1067348497 10:45455512-45455534 GCCATCCTTTCACTAAACCCAGG + Exonic
1069035440 10:63641884-63641906 GCCGTCCCTTTATTCCAGCCAGG - Intergenic
1069485385 10:68819300-68819322 CCATTCATTGCACTCCAGCCTGG - Intergenic
1069655782 10:70087137-70087159 GCCATCACTGCACTCCAGCCTGG + Intronic
1069985391 10:72279498-72279520 GCCCAGCTCTCACTCCAGCCTGG + Intergenic
1070220504 10:74438266-74438288 GGCGTCATTGCACTCCAGCCTGG - Intronic
1070259930 10:74845165-74845187 GCCTTGATTGTACTCCAGCCTGG + Intronic
1070358378 10:75662830-75662852 GTCTTTCTGTCACTGCAGCCAGG - Intronic
1070679699 10:78439946-78439968 CACTTCATTGCACTCCAGCCTGG - Intergenic
1071555420 10:86597780-86597802 GCCATCATTGCACTCCAGCTTGG - Intergenic
1071796255 10:89009515-89009537 GTCTTTCCTACACTCCAGCCAGG - Intronic
1072418531 10:95269773-95269795 CCATTCATTGCACTCCAGCCTGG - Intronic
1072475313 10:95754262-95754284 GGCTCCATTGCACTCCAGCCTGG + Intronic
1072627516 10:97122645-97122667 GCCTTCCTCACACTCCACTCTGG - Intronic
1073002488 10:100295991-100296013 GCCCCCACTTCACTCCAGCCTGG + Intronic
1073155794 10:101345509-101345531 GGCATCATTGCACTCCAGCCTGG - Intergenic
1073235939 10:102016089-102016111 CACGTCCTTCCACTCCAGCCTGG + Intronic
1073396568 10:103223076-103223098 GCACTCCATGCACTCCAGCCTGG - Intergenic
1073544831 10:104338947-104338969 GCCACCATTGCACTCCAGCCTGG - Intergenic
1074976687 10:118587018-118587040 CCCATCCTTCCACTCCAGGCTGG + Intergenic
1075040349 10:119103210-119103232 TCCTGCCACTCACTCCAGCCTGG - Intergenic
1075752289 10:124782767-124782789 CCCTCCATTGCACTCCAGCCTGG + Intronic
1075919313 10:126197375-126197397 GCCTCCCTTCCGCTCAAGCCTGG - Intronic
1076910522 10:133386057-133386079 GCATTCCATGCATTCCAGCCTGG - Intronic
1077139070 11:1015618-1015640 GCCTTCCCTACACACCTGCCAGG - Intronic
1077433717 11:2528282-2528304 TCCTTCCTTCCAGCCCAGCCTGG - Intronic
1077515465 11:2999179-2999201 TGCTTCCCTGCACTCCAGCCTGG + Intergenic
1078222138 11:9360599-9360621 GGCATCATTGCACTCCAGCCTGG - Intergenic
1078298582 11:10101256-10101278 GCCTTTGATTCACTCCAGGCGGG - Intronic
1078298646 11:10101877-10101899 GCCTACCTTTCAAGCCAGCCTGG + Intronic
1078333446 11:10444988-10445010 GACTCTCTTTCACTCCAGTCTGG + Intronic
1079945102 11:26732204-26732226 GCCACCATTGCACTCCAGCCTGG + Intergenic
1080498838 11:32848926-32848948 GGCTCCATTGCACTCCAGCCTGG + Intronic
1080945737 11:36972053-36972075 CCCTTCCTTTGAATCCAGGCTGG - Intergenic
1081183576 11:40014735-40014757 GGCATCATTGCACTCCAGCCTGG - Intergenic
1081916642 11:46735876-46735898 CCCTCCATTGCACTCCAGCCTGG + Intronic
1081925368 11:46823001-46823023 GTGTTCATTCCACTCCAGCCTGG - Intronic
1082012279 11:47458303-47458325 GCCGTCACTGCACTCCAGCCTGG - Intergenic
1082051311 11:47772694-47772716 GGCATCATTGCACTCCAGCCTGG - Intergenic
1083268652 11:61559406-61559428 GCCGTCCTTTCCTTCCAGGCTGG - Intronic
1083358798 11:62090533-62090555 GGCGTCATTGCACTCCAGCCTGG - Intergenic
1083958731 11:66002256-66002278 GACTTCCTTTCTCTGCTGCCCGG - Exonic
1083999851 11:66290082-66290104 GGGTTCCTTTCTCTCCACCCAGG + Intergenic
1084072765 11:66746833-66746855 GCCATCACTGCACTCCAGCCTGG + Intronic
1084249289 11:67883887-67883909 TCCTGCCATTCATTCCAGCCAGG - Intergenic
1084356121 11:68639852-68639874 GCCGACATTTCACTCCAGCCTGG + Intergenic
1084392594 11:68888111-68888133 GCCATTGTTACACTCCAGCCTGG - Intergenic
1084880470 11:72167856-72167878 GGCATCCCTGCACTCCAGCCTGG - Intergenic
1085511956 11:77092930-77092952 GCATTCCATGCACTCCAGCCTGG + Intronic
1085737724 11:79053844-79053866 GCTTTCCTTTGACTTCAGTCTGG - Intronic
1085913762 11:80860077-80860099 GTCTCCATTGCACTCCAGCCTGG - Intergenic
1086288612 11:85278554-85278576 GGTTTCATTGCACTCCAGCCTGG + Intronic
1086471025 11:87110409-87110431 GCCATGCTTGCACTCCAGCCTGG + Intronic
1087348044 11:96996581-96996603 GGCATCATTGCACTCCAGCCTGG - Intergenic
1087685787 11:101263255-101263277 GACTTACCTGCACTCCAGCCTGG - Intergenic
1087947143 11:104176596-104176618 GCCATGATTGCACTCCAGCCTGG - Intergenic
1087983569 11:104648883-104648905 TGCATCATTTCACTCCAGCCTGG - Intergenic
1088560145 11:111106455-111106477 GCCTTACTTGCAAGCCAGCCTGG - Intergenic
1088631580 11:111778856-111778878 AGCATCCTTGCACTCCAGCCTGG - Intergenic
1088948781 11:114543319-114543341 GTATTCCATGCACTCCAGCCTGG + Intronic
1089154719 11:116392516-116392538 TGCGTCCTTGCACTCCAGCCTGG + Intergenic
1089265798 11:117260693-117260715 GCCATTATTGCACTCCAGCCTGG - Intronic
1089407152 11:118207407-118207429 GCTTTCCTTTCACTCAGACCTGG - Intronic
1089616842 11:119699562-119699584 GTCATCCTGTGACTCCAGCCAGG - Intronic
1089670371 11:120052634-120052656 GCATCCCTTTCACTGCAGCAGGG - Intergenic
1089939347 11:122398957-122398979 GCCATCATTGCACTCCAGCTTGG + Intergenic
1090007764 11:123017807-123017829 TCAGTCCTTTCACTCCTGCCAGG - Intergenic
1090833032 11:130432755-130432777 GGCTCCATTGCACTCCAGCCTGG - Intergenic
1090841621 11:130493937-130493959 GCCACCATTGCACTCCAGCCTGG + Intergenic
1091124327 11:133082309-133082331 GCCTTCCCTTTGCCCCAGCCGGG - Intronic
1091498793 12:995211-995233 TCCGTCGTTGCACTCCAGCCTGG + Intronic
1091507069 12:1082531-1082553 GCACTCATTGCACTCCAGCCTGG - Intronic
1091893999 12:4085560-4085582 GCCTTCCTTTTACTCCATACGGG - Intergenic
1092039883 12:5374736-5374758 TCCTTGCTCTCACACCAGCCTGG - Intergenic
1092192921 12:6533576-6533598 GCCTTTCATTCCATCCAGCCTGG - Intergenic
1092987995 12:13865586-13865608 GGCATCATTGCACTCCAGCCTGG + Intronic
1093485296 12:19645763-19645785 GGCTTCACTGCACTCCAGCCTGG + Intronic
1093804654 12:23417514-23417536 GCGGAGCTTTCACTCCAGCCTGG - Intergenic
1094130388 12:27068684-27068706 GGCGTCATTGCACTCCAGCCTGG - Intergenic
1094138137 12:27151159-27151181 GCACTCCATGCACTCCAGCCTGG + Intergenic
1094349376 12:29506762-29506784 GCCTTGCTTTCACATCAGCAGGG - Intronic
1094613746 12:32017805-32017827 CCCGTCATTGCACTCCAGCCTGG - Intergenic
1094853205 12:34391540-34391562 GCCTTCCTTCCACTTCGGGCTGG - Intergenic
1094856834 12:34406609-34406631 GCCTTCCTTCCACCTCAGACTGG - Intergenic
1095225138 12:39670232-39670254 GCCACCATTACACTCCAGCCTGG - Intronic
1095907830 12:47395953-47395975 GGCATCATTGCACTCCAGCCTGG - Intergenic
1095971953 12:47908132-47908154 GGCTTCCTTTTTCTGCAGCCTGG + Intronic
1096288319 12:50319542-50319564 GGCACCATTTCACTCCAGCCTGG - Intergenic
1096681524 12:53258556-53258578 CCATTCATTGCACTCCAGCCTGG + Intergenic
1097197505 12:57251530-57251552 CGCTTCATTGCACTCCAGCCTGG - Intronic
1097271577 12:57778332-57778354 GTGCTACTTTCACTCCAGCCTGG - Intronic
1097593603 12:61601042-61601064 GGCTTCCTTTCATTCCATCAAGG - Intergenic
1097688134 12:62710028-62710050 CCATTCATTGCACTCCAGCCTGG + Intronic
1099155965 12:79176243-79176265 TCACTCCATTCACTCCAGCCTGG + Intronic
1099211319 12:79792688-79792710 ATCTCCCTTCCACTCCAGCCTGG + Intronic
1099458250 12:82891350-82891372 CCCGTCATTGCACTCCAGCCTGG - Intronic
1099794257 12:87377543-87377565 TCCAGCCTTGCACTCCAGCCTGG + Intergenic
1099903685 12:88745350-88745372 GGCTGCCCTGCACTCCAGCCTGG + Intergenic
1099936644 12:89133826-89133848 CCTTTCCTTTCACTCCATCCTGG - Intergenic
1100438887 12:94597269-94597291 TGCTCCCTTGCACTCCAGCCTGG + Intronic
1100506924 12:95230458-95230480 GCAATACTTGCACTCCAGCCTGG - Intronic
1101048704 12:100838184-100838206 CGCTTCATTACACTCCAGCCTGG + Intronic
1101648172 12:106650682-106650704 GTCGCCATTTCACTCCAGCCTGG + Intronic
1101982926 12:109423040-109423062 TCATTCATTGCACTCCAGCCTGG + Intronic
1102019286 12:109670507-109670529 GCCTCTCTTTCTCTGCAGCCTGG + Intergenic
1102138115 12:110592256-110592278 GCACTCCATGCACTCCAGCCTGG - Intergenic
1102359046 12:112267853-112267875 GCACTCCATGCACTCCAGCCTGG - Intronic
1102925348 12:116821858-116821880 GCACTCCATGCACTCCAGCCTGG - Intronic
1103296165 12:119889002-119889024 CCATTCATTGCACTCCAGCCTGG - Intergenic
1103367037 12:120390875-120390897 CCCTTCCTCCCTCTCCAGCCTGG + Intergenic
1103396091 12:120608293-120608315 CCCGTCATTGCACTCCAGCCTGG + Intergenic
1103540126 12:121660212-121660234 GACGTCATTGCACTCCAGCCTGG + Intronic
1103782356 12:123407475-123407497 GCCCTCCTTCCCCTCCAGCGTGG + Exonic
1103990325 12:124794884-124794906 CCCGCCCTTGCACTCCAGCCTGG + Intronic
1104186978 12:126442194-126442216 CCCGTCATTGCACTCCAGCCTGG + Intergenic
1104353981 12:128068979-128069001 GCCATGATTGCACTCCAGCCTGG - Intergenic
1104638480 12:130452343-130452365 TCCTGCTGTTCACTCCAGCCTGG - Intronic
1104727286 12:131085803-131085825 GCCTGACTTACCCTCCAGCCTGG - Intronic
1104853184 12:131888414-131888436 CACTTCATTGCACTCCAGCCTGG + Intergenic
1104957205 12:132472718-132472740 GCCCTCCTCTCTCTCCAGGCAGG - Intergenic
1105363953 13:19747062-19747084 GGCGCCATTTCACTCCAGCCTGG + Intronic
1105792880 13:23819963-23819985 TGCATCCTTGCACTCCAGCCTGG + Intronic
1105900616 13:24748787-24748809 CCGTTCGTTGCACTCCAGCCTGG - Intergenic
1106151688 13:27109866-27109888 GCCGCCATTGCACTCCAGCCTGG + Intronic
1106256952 13:28030858-28030880 GACTTCACTGCACTCCAGCCTGG + Intronic
1106427836 13:29649726-29649748 GACATCATTGCACTCCAGCCTGG + Intergenic
1106606697 13:31235135-31235157 CCCTGCCATTCTCTCCAGCCTGG - Intronic
1106719502 13:32424213-32424235 GCCTTCACTTCAATCAAGCCCGG + Intronic
1106723796 13:32463618-32463640 CCCTCCATTGCACTCCAGCCTGG + Intronic
1106951132 13:34885211-34885233 CCCTTCACTGCACTCCAGCCTGG + Intergenic
1107417023 13:40210246-40210268 GGCGTCATTGCACTCCAGCCTGG + Intergenic
1107472356 13:40702662-40702684 GGCGTCATTGCACTCCAGCCTGG + Intergenic
1108038941 13:46321455-46321477 GCCTTCTTTTCATTTCAGCCTGG + Intergenic
1108194166 13:47975202-47975224 CGCATCATTTCACTCCAGCCTGG - Intronic
1108523789 13:51268026-51268048 CCCTTCCTCTCACTCAAGGCAGG - Intronic
1108638627 13:52361170-52361192 GCCCTACACTCACTCCAGCCTGG - Intergenic
1109634505 13:65096621-65096643 GGCGTCATTGCACTCCAGCCTGG - Intergenic
1110650940 13:77939950-77939972 GGCATCATTGCACTCCAGCCTGG + Intergenic
1111999454 13:95196503-95196525 TCCCTCATTGCACTCCAGCCTGG + Intronic
1112931583 13:104746284-104746306 GCCACCGTTGCACTCCAGCCTGG - Intergenic
1113239070 13:108316269-108316291 GGCTCCCTTTCACTCCTGCAAGG - Intergenic
1113438712 13:110311941-110311963 GCCTTCCCTGCCCTCCAGGCCGG + Intronic
1113447045 13:110377360-110377382 GCCTACCCCTCACTCCTGCCTGG + Intronic
1113589773 13:111490155-111490177 TCCTCCCCTGCACTCCAGCCTGG + Intergenic
1113664186 13:112129514-112129536 CCCGTCATTGCACTCCAGCCTGG + Intergenic
1114238569 14:20844592-20844614 CACTTCATTGCACTCCAGCCCGG + Intergenic
1114284935 14:21232419-21232441 GCCGTGATTGCACTCCAGCCTGG - Intronic
1114767567 14:25391385-25391407 GCTTCCCCTGCACTCCAGCCTGG + Intergenic
1115682485 14:35757159-35757181 CCATTCATTGCACTCCAGCCAGG - Intronic
1115991349 14:39153743-39153765 GCTATCATTGCACTCCAGCCTGG - Intronic
1116220035 14:42072380-42072402 GGCGTCATTGCACTCCAGCCTGG - Intergenic
1116625393 14:47256352-47256374 ACTTTCCTTCCACTCCAGTCAGG + Intronic
1116686244 14:48042645-48042667 GCTTGCCCTGCACTCCAGCCTGG + Intergenic
1116839773 14:49808214-49808236 GGCATCATTGCACTCCAGCCTGG - Intronic
1117087896 14:52220341-52220363 GCATTCCATGCACTCCAGCCTGG - Intergenic
1117363196 14:54998159-54998181 GCCACCATTGCACTCCAGCCTGG + Intronic
1117623562 14:57612351-57612373 GCCTGCCTTTTTCTCTAGCCTGG + Intronic
1118248806 14:64138264-64138286 GCACTCCATGCACTCCAGCCTGG - Intronic
1118798651 14:69168662-69168684 GCCTGACTGTCCCTCCAGCCTGG + Intergenic
1118922148 14:70159367-70159389 CACTTCACTTCACTCCAGCCTGG + Intronic
1119160239 14:72446443-72446465 GCCTTCATTGCCCTCCAGACTGG - Intronic
1119313115 14:73667540-73667562 GGCATCATTGCACTCCAGCCTGG - Intronic
1119358644 14:74028750-74028772 GGCGTCATTGCACTCCAGCCCGG - Intronic
1119361464 14:74053753-74053775 GGCATCATTGCACTCCAGCCTGG - Intronic
1119731985 14:76956848-76956870 TCCTTCCCTTCCCTCCAGCAGGG + Intergenic
1119958171 14:78823453-78823475 ACCTTCCTTCTACTCCAGGCAGG + Intronic
1120007047 14:79370360-79370382 GGCGCCATTTCACTCCAGCCTGG - Intronic
1120293311 14:82605672-82605694 GCATTTCAATCACTCCAGCCTGG - Intergenic
1120316296 14:82897980-82898002 GCCTCCCATTCACTCAAGACAGG + Intergenic
1120793200 14:88604635-88604657 GGCTCCATTGCACTCCAGCCTGG - Intronic
1121894023 14:97628646-97628668 CCCGTCATTGCACTCCAGCCTGG - Intergenic
1122001895 14:98665369-98665391 CCATTCATTGCACTCCAGCCTGG - Intergenic
1122488834 14:102099511-102099533 GCGCACCATTCACTCCAGCCTGG + Intronic
1122631582 14:103109717-103109739 GTCTCCCTCTCTCTCCAGCCTGG + Intronic
1122937766 14:104967826-104967848 GCCTTCCTCTCTCTCCCGACTGG - Intronic
1122955221 14:105067245-105067267 GCCTGCCCTCCACCCCAGCCTGG - Intergenic
1123476724 15:20596236-20596258 CCCAACCTTTCACTCCAACCTGG - Intergenic
1123477733 15:20602671-20602693 GCCTGCCTTTCAAGCCAGCCTGG + Intergenic
1123640282 15:22397711-22397733 GCCTGCCTTTCAAGCCAGCCTGG - Intergenic
1123641287 15:22404128-22404150 CCCAACCTTTCACTCCAACCTGG + Intergenic
1123911108 15:24967762-24967784 TGCTTCATTGCACTCCAGCCTGG + Intronic
1123983730 15:25625695-25625717 CCATTCCACTCACTCCAGCCTGG + Intergenic
1124322465 15:28725491-28725513 GCCGTCATTGCACTCCAGCCTGG - Intronic
1124713462 15:32033874-32033896 GTCTTCCTATCACTCCAGTCAGG - Intronic
1126146094 15:45474211-45474233 CCCACCATTTCACTCCAGCCTGG + Intergenic
1126313834 15:47346950-47346972 GGCATCATTGCACTCCAGCCTGG - Intronic
1126632493 15:50751869-50751891 CCATTCATTGCACTCCAGCCTGG - Intronic
1127089888 15:55456868-55456890 GGCTTCCTTGGACTCCAGCTGGG - Intronic
1128137542 15:65275069-65275091 GCCATCACTGCACTCCAGCCTGG + Intronic
1129200093 15:73993524-73993546 GCCTGCCCTTCCCTCCAGCCTGG - Intronic
1129343471 15:74901545-74901567 GGCCTCCCTTCACTCCAGCATGG - Exonic
1129804533 15:78444375-78444397 AACTACCTTTCACTCCAGCCAGG - Intronic
1130241102 15:82192355-82192377 GCCCCACTTGCACTCCAGCCTGG + Intronic
1130241628 15:82198672-82198694 GCCTTCCTTTCTCTCCTGGTTGG - Intronic
1131387830 15:92021965-92021987 GCCTTCCTGCCACTCCAGGCAGG - Intronic
1131592199 15:93761846-93761868 TCCTTCCTTCCTTTCCAGCCTGG - Intergenic
1131672650 15:94636026-94636048 GGCGTCATTGCACTCCAGCCTGG + Intergenic
1132366071 15:101257900-101257922 GACTCCATTGCACTCCAGCCTGG - Intergenic
1132522072 16:396141-396163 GCCATTATTGCACTCCAGCCTGG + Intergenic
1132533355 16:464848-464870 GCACTCCATGCACTCCAGCCTGG + Intronic
1132655995 16:1041940-1041962 GGCATCATTGCACTCCAGCCTGG + Intergenic
1132693932 16:1193834-1193856 CCCCACCTGTCACTCCAGCCTGG - Intronic
1132753183 16:1468351-1468373 CCCATCCTTTCACTCCGGGCAGG - Intronic
1133015766 16:2938949-2938971 GGCTCCATTGCACTCCAGCCTGG - Intronic
1133026140 16:2989717-2989739 GCCTTCCCCTCTCCCCAGCCAGG - Intergenic
1133202169 16:4210531-4210553 GCGTTCACTGCACTCCAGCCTGG - Intronic
1133295456 16:4749766-4749788 TCGTGCCTTGCACTCCAGCCTGG + Exonic
1134037693 16:11043828-11043850 GCACTCCATGCACTCCAGCCTGG + Intronic
1134038313 16:11049048-11049070 GCACTACTTGCACTCCAGCCTGG - Intronic
1134138592 16:11697261-11697283 GCCTCCCTGTCCCTCCAGGCAGG + Intronic
1135599166 16:23767263-23767285 TCATTCCTTGCATTCCAGCCTGG + Intergenic
1136164400 16:28443343-28443365 GCTATCATTGCACTCCAGCCAGG + Intergenic
1136178260 16:28533422-28533444 GCCATGATCTCACTCCAGCCTGG - Intronic
1136198566 16:28671637-28671659 GCTATCATTGCACTCCAGCCAGG - Intergenic
1136214912 16:28785813-28785835 GCTATCATTGCACTCCAGCCAGG - Intergenic
1136251361 16:29007624-29007646 GGCATCATTGCACTCCAGCCTGG + Intergenic
1136259635 16:29065658-29065680 GCTATCATTGCACTCCAGCCAGG - Intergenic
1136486947 16:30579429-30579451 GGCTCCATTGCACTCCAGCCTGG - Intronic
1136605290 16:31329744-31329766 GCCTTCCTCCCCCACCAGCCTGG - Intronic
1137068784 16:35879439-35879461 TCCTCCCTTCCACTCCAGCCTGG - Intergenic
1137422844 16:48350761-48350783 GCCTTCATGTGACTGCAGCCTGG - Intronic
1137542933 16:49377353-49377375 GCCTTCCTGTGACTCCACACTGG + Intronic
1137603685 16:49773273-49773295 GCCACCATTGCACTCCAGCCTGG + Intronic
1137643136 16:50050694-50050716 TCATGCCTTGCACTCCAGCCTGG + Intergenic
1138683398 16:58703879-58703901 GCCATCATTGAACTCCAGCCTGG - Intergenic
1139768347 16:69251736-69251758 CCATTACTTACACTCCAGCCTGG + Intronic
1139836039 16:69839291-69839313 CCCTTCAGTTCAGTCCAGCCAGG - Intronic
1139905032 16:70358805-70358827 CCGTTCGTTGCACTCCAGCCTGG + Intronic
1139915453 16:70425672-70425694 CCGCTCCATTCACTCCAGCCTGG + Intronic
1140066995 16:71620003-71620025 CGCTCCATTTCACTCCAGCCTGG + Intergenic
1140285941 16:73602892-73602914 GGCTCCATTGCACTCCAGCCTGG + Intergenic
1140662362 16:77199533-77199555 GCACTCCTTTCTCTCCAACCAGG + Exonic
1141803060 16:86323991-86324013 CCCTTCCCTTCCCTCCATCCTGG - Intergenic
1142392792 16:89813474-89813496 CCCTCCATTGCACTCCAGCCTGG - Intronic
1142832191 17:2557613-2557635 GGCGCCATTTCACTCCAGCCTGG - Intergenic
1142966975 17:3587767-3587789 GGCACCATTTCACTCCAGCCTGG + Intronic
1143023639 17:3929088-3929110 TCCTTCCTCCCACCCCAGCCTGG + Intronic
1143647365 17:8239564-8239586 GTCTTGATTTCACTCCAGCCTGG - Intronic
1143826281 17:9610576-9610598 GGCGTCATTGCACTCCAGCCTGG - Intronic
1144000944 17:11054559-11054581 GACACCCTTTCACTCCAGCCTGG - Intergenic
1144233276 17:13230802-13230824 GTCTACTTTTAACTCCAGCCAGG + Intergenic
1144239000 17:13291041-13291063 GGCTCCATTGCACTCCAGCCTGG - Intergenic
1144750558 17:17645450-17645472 GGCATCATTGCACTCCAGCCTGG - Intergenic
1145948040 17:28792735-28792757 CACATCATTTCACTCCAGCCTGG + Intronic
1146063594 17:29619383-29619405 ACCTCCCATTCACTCCAGCAGGG + Intronic
1146810299 17:35897884-35897906 GCACTCCATGCACTCCAGCCTGG + Intergenic
1147340489 17:39750750-39750772 CCTTTACTCTCACTCCAGCCTGG - Intergenic
1147618546 17:41846166-41846188 GGCGCCATTTCACTCCAGCCCGG + Intronic
1147795675 17:43040768-43040790 GCCTGCCTCTCCCTCCAGCCTGG + Intergenic
1147931787 17:43986217-43986239 CCATTCATTGCACTCCAGCCTGG + Intronic
1148396709 17:47313964-47313986 GCGCTCACTTCACTCCAGCCTGG - Intronic
1148469956 17:47886827-47886849 GGCTTCACTGCACTCCAGCCTGG - Intergenic
1148795468 17:50194777-50194799 GCTTTCCTTCCTCTCCAGCAGGG + Exonic
1149234115 17:54570589-54570611 GCATCCCAGTCACTCCAGCCAGG - Intergenic
1149254058 17:54804772-54804794 GCCTTATTTACATTCCAGCCTGG - Intergenic
1149707548 17:58708740-58708762 CCCTGCCATGCACTCCAGCCTGG - Intronic
1149978227 17:61287680-61287702 GGCATCGTTACACTCCAGCCTGG + Intronic
1150144990 17:62761463-62761485 GGCACCATTTCACTCCAGCCTGG - Intronic
1150212869 17:63451020-63451042 GCTGTCATTGCACTCCAGCCTGG - Intergenic
1150522577 17:65884759-65884781 GGCGCCCTTGCACTCCAGCCTGG - Intronic
1150592442 17:66575534-66575556 CGCATCCTTGCACTCCAGCCTGG + Intronic
1150907313 17:69351613-69351635 GGTCACCTTTCACTCCAGCCTGG + Intergenic
1150989485 17:70239436-70239458 GCCCTCTCTTCACCCCAGCCAGG - Intergenic
1151005568 17:70432292-70432314 CCCATCATTACACTCCAGCCTGG - Intergenic
1151347322 17:73510071-73510093 GCCTTCCTTATGCTCCAGCCTGG - Intronic
1151525862 17:74667042-74667064 CACTTCATTGCACTCCAGCCTGG - Intergenic
1151531293 17:74706818-74706840 GCCCTCCTTCCACTCCAGCCCGG + Intronic
1151806852 17:76411080-76411102 GCCATGATTGCACTCCAGCCTGG - Intronic
1151867177 17:76811719-76811741 GGCATCATTGCACTCCAGCCTGG - Intergenic
1151918821 17:77139210-77139232 ACCTGCCCTGCACTCCAGCCTGG - Intronic
1151989770 17:77566763-77566785 GCCGAGATTTCACTCCAGCCCGG - Intergenic
1152631764 17:81413710-81413732 GGCTTCCCTGCACTCCAGGCTGG + Intronic
1152665964 17:81569666-81569688 GCCTTACATTCACCCCTGCCTGG - Intronic
1152860154 17:82691828-82691850 GCCTTCCTTCTACCCCTGCCTGG + Intronic
1203183591 17_KI270729v1_random:89839-89861 GTCTTGCTTTCACTTTAGCCTGG + Intergenic
1153175113 18:2363311-2363333 CCCTCCATTGCACTCCAGCCTGG - Intergenic
1153186911 18:2496771-2496793 CCATTCATTGCACTCCAGCCTGG - Intergenic
1154274653 18:12948360-12948382 GGCTTCCGCTCAGTCCAGCCAGG - Intronic
1154944464 18:21148098-21148120 GGCTCCATTGCACTCCAGCCTGG - Intergenic
1155051371 18:22150806-22150828 GCACTCCATGCACTCCAGCCTGG - Intergenic
1155141873 18:23051224-23051246 GGCGTCATTGCACTCCAGCCTGG + Intergenic
1155275696 18:24185369-24185391 GCCGCCATTGCACTCCAGCCTGG - Intronic
1155352444 18:24919809-24919831 GCTTTGCTTTCACTGAAGCCTGG - Intergenic
1155435360 18:25807099-25807121 GCACTCCCTGCACTCCAGCCTGG - Intergenic
1156126151 18:33907278-33907300 GCCTCCACTGCACTCCAGCCTGG + Intronic
1157359879 18:46966888-46966910 GCCACCATTGCACTCCAGCCTGG - Intronic
1157360478 18:47020488-47020510 GCCACCATTGCACTCCAGCCTGG - Intronic
1157361467 18:47026403-47026425 GCCACCATTGCACTCCAGCCTGG - Intronic
1157493987 18:48142448-48142470 TCCTGCCCTGCACTCCAGCCTGG - Intronic
1158418583 18:57272308-57272330 GACTTCCTTTCAGGCCAGCTTGG - Intergenic
1158635380 18:59151616-59151638 GCCCTCCTTCCCCTCCAGCCTGG - Intronic
1159269006 18:66124387-66124409 GTCTCCATTGCACTCCAGCCTGG + Intergenic
1159604516 18:70461273-70461295 CACTGCCTTTCACTCCAGCCTGG - Intergenic
1160352946 18:78200660-78200682 TTCTTCCTTTTAATCCAGCCAGG - Intergenic
1160954843 19:1686327-1686349 GGCTCCATTGCACTCCAGCCTGG - Intergenic
1161123445 19:2542954-2542976 GGCGTCATTGCACTCCAGCCTGG - Intronic
1161131543 19:2592691-2592713 TGCATCGTTTCACTCCAGCCTGG + Intronic
1161276643 19:3421975-3421997 GCCATTATTGCACTCCAGCCTGG - Intronic
1161638274 19:5403006-5403028 ACCATCATTGCACTCCAGCCTGG + Intergenic
1161878027 19:6927013-6927035 GGCATCATTGCACTCCAGCCTGG + Intronic
1161911802 19:7199439-7199461 GGCTCCATTGCACTCCAGCCTGG - Intronic
1162257209 19:9500348-9500370 GGCTCCATTGCACTCCAGCCTGG + Intergenic
1162316556 19:9942472-9942494 CCCATCACTTCACTCCAGCCTGG - Intergenic
1162450742 19:10752900-10752922 GACTCCATTGCACTCCAGCCTGG + Intronic
1162469839 19:10866077-10866099 GACATCCCTTTACTCCAGCCTGG - Intronic
1162517371 19:11156860-11156882 GAATGCCTTGCACTCCAGCCTGG - Intergenic
1162594357 19:11615759-11615781 GGCACCCTTGCACTCCAGCCTGG - Intronic
1162855642 19:13466373-13466395 GCACTCCATGCACTCCAGCCTGG - Intronic
1163252429 19:16134005-16134027 GCATTCCTTCCACTCTATCCAGG + Exonic
1163330327 19:16632579-16632601 GGCACCATTTCACTCCAGCCTGG - Intronic
1163377696 19:16943871-16943893 GCCCTCCTATCACTCCAGTGAGG + Intronic
1163441923 19:17326459-17326481 GCACTCCATGCACTCCAGCCTGG + Intronic
1163771707 19:19195091-19195113 GCACTCCATGCACTCCAGCCTGG - Intronic
1164657629 19:29935828-29935850 GGCACCATTTCACTCCAGCCTGG - Intronic
1165033880 19:33018985-33019007 GCCGTCATTGCCCTCCAGCCTGG + Intronic
1165042095 19:33075876-33075898 GGCTGCATTGCACTCCAGCCTGG + Intergenic
1165096480 19:33412494-33412516 GGTTTCCTCTCTCTCCAGCCTGG - Intronic
1165133302 19:33646869-33646891 CGCTCCCTTGCACTCCAGCCTGG + Intronic
1165302721 19:34981261-34981283 GGCATCATTGCACTCCAGCCTGG + Intergenic
1165528078 19:36373231-36373253 GGCGTCATTGCACTCCAGCCTGG + Intronic
1165570480 19:36771357-36771379 GCCAAACTTTCACTTCAGCCTGG - Intronic
1166010107 19:39935379-39935401 TCCTTCCTTTGGCTCCTGCCAGG + Intergenic
1166101973 19:40576497-40576519 GCCCTCCTTTCAATCCTCCCGGG - Intergenic
1166164728 19:40979274-40979296 GCCTCCATTGCACTCCAGCCTGG + Intergenic
1166186190 19:41140724-41140746 GGCTCCATTGCACTCCAGCCTGG - Intergenic
1166780084 19:45337518-45337540 GGCGTCATTGCACTCCAGCCTGG - Intronic
1166927751 19:46280625-46280647 GGCATCATTGCACTCCAGCCTGG + Intergenic
1166929411 19:46292818-46292840 TCCTGCCATTTACTCCAGCCTGG - Intergenic
1166964984 19:46524087-46524109 TCGTGCCATTCACTCCAGCCTGG - Intronic
1167016612 19:46845053-46845075 GCCCCCATTGCACTCCAGCCTGG + Intronic
1167232721 19:48295634-48295656 TCCTTCCTTTCTCTCCTTCCAGG + Intergenic
1167349786 19:48967369-48967391 GGCGTCATTGCACTCCAGCCTGG + Intergenic
1167485357 19:49759602-49759624 GTCATGCTGTCACTCCAGCCTGG + Intronic
1167829707 19:52009144-52009166 GGCGTCATTGCACTCCAGCCTGG + Intergenic
1167903793 19:52641622-52641644 GCCGCCATTGCACTCCAGCCTGG - Intronic
1168084334 19:54034421-54034443 TCCATCATTGCACTCCAGCCTGG - Intergenic
1168218130 19:54941336-54941358 TCCAGCCTTACACTCCAGCCTGG + Intronic
1168519010 19:57033704-57033726 GCCTTTCTATCCCTCCAGCTGGG + Intergenic
1168715317 19:58523621-58523643 GCTGTCATTGCACTCCAGCCTGG + Intronic
925288564 2:2731317-2731339 GCCTTCCCTTCACCCCACACTGG + Intergenic
925839512 2:7978626-7978648 ACCTTCCTGTCAATCAAGCCAGG + Intergenic
925843828 2:8017984-8018006 TCCTTCCATTCACTCCATCCAGG - Intergenic
926106354 2:10154454-10154476 GGCATCATTGCACTCCAGCCTGG + Intronic
926124189 2:10261775-10261797 GGCGTCATTGCACTCCAGCCTGG - Intergenic
926433433 2:12814535-12814557 GGCTCCATTGCACTCCAGCCTGG + Intergenic
926540837 2:14179134-14179156 GTCTTCATTTCACTTCAGCATGG + Intergenic
927384827 2:22520978-22521000 GCTTCCCTCTCAGTCCAGCCTGG + Intergenic
927919261 2:26959372-26959394 TCCTGCCACTCACTCCAGCCTGG + Intergenic
928326254 2:30322058-30322080 GGCATCATTGCACTCCAGCCTGG - Intronic
929160907 2:38831371-38831393 CCCTCCATTGCACTCCAGCCTGG - Intronic
929172138 2:38942969-38942991 GACGCCCTTGCACTCCAGCCTGG - Intronic
929420593 2:41785776-41785798 GCCTGCCTTTCACCCGAGCTGGG - Intergenic
929492094 2:42406261-42406283 GACTTCATTGCACTCCAGACTGG - Intronic
929493228 2:42416179-42416201 GCCTTCCTTTGTCTCCAGGCTGG - Intronic
930062650 2:47303073-47303095 GCCTTGCTTTGTCTCCAGGCTGG - Intergenic
930117595 2:47731848-47731870 GCACTCCATACACTCCAGCCTGG + Intronic
931229392 2:60361275-60361297 GCACTCCATGCACTCCAGCCTGG + Intergenic
931347870 2:61462984-61463006 CACTTCATTGCACTCCAGCCTGG + Intronic
931398464 2:61908966-61908988 CCATTACTTACACTCCAGCCTGG - Intronic
931436147 2:62248895-62248917 GGCGTCATTGCACTCCAGCCTGG + Intergenic
931693526 2:64855217-64855239 GCCTTTCTTGCCCTCCATCCAGG + Intergenic
932241281 2:70158944-70158966 GCACTCCATGCACTCCAGCCTGG - Intronic
932326260 2:70863977-70863999 GCCGCCATTGCACTCCAGCCTGG - Intergenic
932421386 2:71603439-71603461 TCCTTCCTGTCTCTCCACCCAGG - Intronic
932898503 2:75669774-75669796 GCCGCCATTGCACTCCAGCCTGG - Intronic
933363198 2:81314400-81314422 GTCGTCATTTCACTCCAGCCTGG + Intergenic
933675887 2:85057134-85057156 GCCGCCATTGCACTCCAGCCCGG + Exonic
933821935 2:86120846-86120868 GATGTCCTTGCACTCCAGCCTGG + Intronic
933867343 2:86533545-86533567 ACCAACCTTGCACTCCAGCCTGG - Intronic
934672945 2:96227878-96227900 TCCTCCGTTGCACTCCAGCCTGG - Intergenic
935225614 2:101049868-101049890 GCCGTCACTGCACTCCAGCCTGG - Intronic
935620598 2:105126291-105126313 ACCTTTTTCTCACTCCAGCCAGG + Intergenic
935757573 2:106288484-106288506 GTCTCCCTTGCATTCCAGCCTGG - Intergenic
936974154 2:118202656-118202678 GGCATCATTGCACTCCAGCCTGG + Intergenic
937127430 2:119483384-119483406 GCCTTCCCATCTCCCCAGCCTGG + Intronic
937386863 2:121442518-121442540 GCCTTCATTGCACTCCAGCCTGG - Intronic
937804482 2:126123005-126123027 GGCTTCACTGCACTCCAGCCTGG - Intergenic
937941712 2:127291297-127291319 CCATTCATTGCACTCCAGCCTGG - Intronic
938076980 2:128345240-128345262 GCACTCCATGCACTCCAGCCTGG + Intergenic
938081964 2:128374883-128374905 TCCTTCCTGGCAGTCCAGCCAGG - Intergenic
938625670 2:133106247-133106269 GCCACCATTGCACTCCAGCCTGG + Intronic
938756719 2:134387215-134387237 TGCTCCCTTGCACTCCAGCCTGG + Intronic
939222524 2:139320746-139320768 GGCGTCCCTGCACTCCAGCCTGG - Intergenic
939605501 2:144250177-144250199 GGCTCCATTCCACTCCAGCCTGG - Intronic
939631257 2:144528840-144528862 GCACTCCATGCACTCCAGCCCGG + Intergenic
940223366 2:151376918-151376940 GGCGCCCTTGCACTCCAGCCTGG - Intronic
941089073 2:161153641-161153663 TCCTGCCCTGCACTCCAGCCTGG + Intronic
941095637 2:161237745-161237767 TGCTTTCTTACACTCCAGCCTGG + Intergenic
941356540 2:164500139-164500161 TCCGTCCCCTCACTCCAGCCAGG + Intronic
941696912 2:168562759-168562781 GCCTTCCTGTATCTCCAACCTGG + Intronic
941943825 2:171072722-171072744 GACATCATTACACTCCAGCCTGG + Intronic
942030119 2:171950847-171950869 CCATTCATTGCACTCCAGCCTGG - Intronic
942030643 2:171955569-171955591 CCATTCATTGCACTCCAGCCGGG + Intronic
942063498 2:172248988-172249010 TCCTTTCTCTCACTCCATCCTGG + Intergenic
944146180 2:196509815-196509837 GGCTTCCATTCAATCCTGCCAGG + Intronic
944219913 2:197292731-197292753 GCCATCCTCTCAGTCCACCCAGG + Intronic
944549923 2:200836149-200836171 GCATGCCATGCACTCCAGCCTGG + Intergenic
944665741 2:201957548-201957570 GCGTGCCTTGCACTCCAGCCTGG - Intergenic
944701641 2:202251185-202251207 GCCGCCATTGCACTCCAGCCTGG + Intergenic
944708055 2:202310794-202310816 GGCGTCATTGCACTCCAGCCTGG - Intergenic
944730979 2:202517363-202517385 CCATGCCTTGCACTCCAGCCTGG - Intronic
944774536 2:202949297-202949319 GCACTCCATGCACTCCAGCCTGG + Intronic
946038747 2:216765930-216765952 GCCTTCCTGCCCCTCCCGCCTGG - Intergenic
947339021 2:229117503-229117525 TCCTTCCTTTCTCTGTAGCCAGG + Intronic
947534092 2:230930020-230930042 GCATTCCCTCCACTCCCGCCGGG + Intronic
947652786 2:231801474-231801496 GCACTCCATGCACTCCAGCCTGG - Intronic
947820815 2:233068239-233068261 GGCACCCTTGCACTCCAGCCTGG + Intronic
948102909 2:235389684-235389706 GCCTGCCCATCACTCCTGCCTGG - Intergenic
948960175 2:241328696-241328718 CCCATCATTGCACTCCAGCCGGG + Intronic
1170661585 20:18346203-18346225 TGCATCCCTTCACTCCAGCCTGG + Intergenic
1171143702 20:22764175-22764197 GGCGTCATTGCACTCCAGCCCGG - Intergenic
1172138208 20:32702364-32702386 GCCGCCATTGCACTCCAGCCTGG + Intergenic
1172154421 20:32813681-32813703 TCCTGCCATTGACTCCAGCCTGG + Intergenic
1172156766 20:32831570-32831592 CCATTCATTGCACTCCAGCCTGG - Intronic
1172167489 20:32907927-32907949 CCCTTGCTGCCACTCCAGCCTGG - Intronic
1172364927 20:34341995-34342017 CCATTCATTGCACTCCAGCCTGG - Intergenic
1172537255 20:35683745-35683767 GCACTCCATGCACTCCAGCCTGG + Intronic
1172584258 20:36071416-36071438 GGCGCCATTTCACTCCAGCCTGG + Intergenic
1172990324 20:39031375-39031397 GCCGTCACTGCACTCCAGCCTGG - Intronic
1173031706 20:39367166-39367188 GGCGCCATTTCACTCCAGCCTGG + Intergenic
1173487753 20:43454168-43454190 GGCTCCACTTCACTCCAGCCTGG - Intergenic
1174263282 20:49313065-49313087 GCCATCTTTTCCCTCCATCCTGG - Intergenic
1174295365 20:49541688-49541710 GCCATTATTGCACTCCAGCCTGG + Intronic
1174432513 20:50480679-50480701 GCCATCATTGCACTCCAGCCTGG + Intergenic
1174578669 20:51555548-51555570 GCCGCCATTGCACTCCAGCCTGG + Intronic
1174622911 20:51890320-51890342 TCATGCCTTGCACTCCAGCCTGG - Intergenic
1174629323 20:51942738-51942760 GACTGCATTGCACTCCAGCCTGG - Intergenic
1174867073 20:54147875-54147897 CCCTCCATTGCACTCCAGCCTGG - Intergenic
1175759947 20:61555486-61555508 GCCTCCCTCACTCTCCAGCCCGG + Intronic
1175944908 20:62554136-62554158 GCCTTCCTGCCACTGCTGCCTGG - Intronic
1176055757 20:63147475-63147497 GGTTTCATTTCACTGCAGCCTGG + Intergenic
1176194124 20:63829397-63829419 GCCTTGCCTTCAGGCCAGCCTGG - Intronic
1176419898 21:6505712-6505734 CCATCCCTTACACTCCAGCCTGG - Intergenic
1177001337 21:15617369-15617391 GGCATCATTGCACTCCAGCCAGG - Intergenic
1177623934 21:23634517-23634539 GGCGCCCTTGCACTCCAGCCTGG - Intergenic
1177692048 21:24523115-24523137 GCCCTCCTTTCACTCTTTCCTGG - Intergenic
1178089269 21:29144189-29144211 CCCCTGCTTGCACTCCAGCCTGG - Intronic
1178218980 21:30633680-30633702 GCACTCCATGCACTCCAGCCTGG + Intergenic
1178557625 21:33606969-33606991 CCATTCATTGCACTCCAGCCTGG + Intronic
1178850249 21:36207226-36207248 GCCGTCACTGCACTCCAGCCTGG - Intronic
1178863897 21:36311950-36311972 ACATTCATTGCACTCCAGCCTGG - Intergenic
1179646649 21:42780120-42780142 TTCTTTCTTGCACTCCAGCCTGG + Intergenic
1180678863 22:17609202-17609224 CCCGTCATTGCACTCCAGCCTGG - Intronic
1180873628 22:19163042-19163064 GCACCACTTTCACTCCAGCCTGG - Intergenic
1180892573 22:19300726-19300748 GGCGTCATTGCACTCCAGCCTGG + Intergenic
1180976291 22:19850656-19850678 GCCTTCCTCACATTCCAGCTGGG + Exonic
1181626006 22:24122662-24122684 CACGTCATTTCACTCCAGCCTGG + Intronic
1181693020 22:24576292-24576314 GGCACCATTTCACTCCAGCCTGG - Intronic
1181893396 22:26084721-26084743 CCCTTGCATTCACTCCAGTCAGG - Intergenic
1182776483 22:32834945-32834967 GCCTCCCCTTCTCTTCAGCCAGG + Intronic
1182898089 22:33875249-33875271 GCCTGCCTTTCTCTCCAGAATGG - Intronic
1182974376 22:34609420-34609442 CGCTTCATTGCACTCCAGCCTGG - Intergenic
1183211681 22:36455174-36455196 GCCCGCCTTTCACCGCAGCCAGG - Intergenic
1183231412 22:36584395-36584417 GCATTACTTGCACTCCAGCCTGG + Intronic
1183336320 22:37249084-37249106 GCCATGATTGCACTCCAGCCTGG - Intergenic
1183435801 22:37794186-37794208 GCCATAATTGCACTCCAGCCTGG + Intergenic
1183461561 22:37953978-37954000 GCCCTCCTGTGCCTCCAGCCGGG - Intronic
1183480253 22:38060174-38060196 GCATTCCGTGCATTCCAGCCTGG + Intronic
1183626276 22:39004291-39004313 GCCATCACTGCACTCCAGCCTGG + Intergenic
1183678497 22:39313118-39313140 GCCTGCCTTTGGCTCCAGCCGGG - Intronic
1183879604 22:40816152-40816174 GCACTCCATGCACTCCAGCCTGG + Intronic
1183962511 22:41420175-41420197 GGCATCATTGCACTCCAGCCTGG + Intergenic
1184205091 22:42997112-42997134 GCCTTCCCTCCACACCAGGCTGG + Intronic
1185200247 22:49498024-49498046 CCATTCATTGCACTCCAGCCTGG + Intronic
949524401 3:4888955-4888977 GCCTTCAGTTGACTGCAGCCAGG + Intergenic
950064391 3:10100134-10100156 GCCATCATCACACTCCAGCCTGG + Intronic
950265417 3:11569491-11569513 GCCTTCATTCTACTCCTGCCAGG - Intronic
950352784 3:12373716-12373738 GCTGTCCTTTTACTCCAGACTGG + Intronic
950699750 3:14733730-14733752 GGCTCCATTGCACTCCAGCCTGG - Intronic
951420103 3:22473808-22473830 GGCTCCATTGCACTCCAGCCTGG + Intergenic
951563217 3:23988437-23988459 GCCACCATTGCACTCCAGCCCGG - Intergenic
951585664 3:24212352-24212374 CGCTCCCTTGCACTCCAGCCTGG + Intronic
951918134 3:27823391-27823413 GCCATTATTGCACTCCAGCCTGG - Intergenic
951929839 3:27952803-27952825 GAGTTCATTGCACTCCAGCCTGG + Intergenic
952396499 3:32925448-32925470 GCCCCCATTGCACTCCAGCCTGG - Intergenic
953498818 3:43413006-43413028 GCCCCACTTGCACTCCAGCCTGG + Intronic
954052431 3:47991706-47991728 GCCATTGTTGCACTCCAGCCTGG - Intronic
954088420 3:48265327-48265349 CCCATCATTGCACTCCAGCCTGG - Intronic
954283343 3:49600355-49600377 GCCTTCCTTTCCAGCCAGGCTGG - Intronic
954395448 3:50291054-50291076 GGCGTCATTGCACTCCAGCCTGG - Intronic
954659435 3:52219100-52219122 GACTTCCCTAGACTCCAGCCAGG + Intergenic
954901265 3:54022003-54022025 GGCACCATTTCACTCCAGCCTGG + Intergenic
954974631 3:54681511-54681533 GCATTCACTGCACTCCAGCCTGG + Intronic
955396546 3:58561825-58561847 GCATTCTTTCCACTACAGCCAGG - Intergenic
955824770 3:62934307-62934329 GGCATCATTGCACTCCAGCCTGG + Intergenic
956370781 3:68558100-68558122 GGCTCCATTGCACTCCAGCCTGG + Intergenic
956594158 3:70948282-70948304 GACTCCGTATCACTCCAGCCTGG - Intergenic
956613549 3:71148335-71148357 CCATTCATTGCACTCCAGCCTGG + Intronic
956688829 3:71857492-71857514 GCGCTCCCTGCACTCCAGCCTGG - Intergenic
956820452 3:72949355-72949377 TCCTTACTTTTCCTCCAGCCTGG + Intronic
957063560 3:75502071-75502093 TCCTGCCATTCATTCCAGCCAGG - Intergenic
957327089 3:78710111-78710133 CCCTGCCTTGCACTCCAACCTGG - Intronic
957337521 3:78850848-78850870 AGCTTCATTGCACTCCAGCCTGG - Intronic
957690111 3:83556020-83556042 GCACTCCATGCACTCCAGCCTGG + Intergenic
957962856 3:87280893-87280915 GGCGCCCTTGCACTCCAGCCTGG + Intergenic
958138759 3:89532565-89532587 GGCATCATTGCACTCCAGCCTGG + Intergenic
959225789 3:103582597-103582619 GCGATTCTTGCACTCCAGCCTGG + Intergenic
961289833 3:125837500-125837522 TCCTGCCATTCATTCCAGCCAGG + Intergenic
961747723 3:129075983-129076005 CCATTCATTGCACTCCAGCCTGG + Intergenic
961868029 3:129968211-129968233 GTCTTTCCTTCACACCAGCCAGG - Intergenic
961981791 3:131087281-131087303 CCATTCATTGCACTCCAGCCTGG - Intronic
962586496 3:136847537-136847559 GGCTTCATTGCACTCCAGCCTGG + Intronic
963139901 3:141938425-141938447 CCCGCCCTTGCACTCCAGCCTGG - Intergenic
963790630 3:149578837-149578859 GCCATTATTGCACTCCAGCCTGG + Intronic
963792758 3:149601232-149601254 GGCTCCATTGCACTCCAGCCTGG - Intronic
964855521 3:161141632-161141654 GCCACCATTGCACTCCAGCCTGG - Intronic
966655135 3:182347739-182347761 TCCATCATTACACTCCAGCCTGG + Intergenic
966681798 3:182649728-182649750 CCATTCATTGCACTCCAGCCTGG - Intergenic
966859727 3:184223612-184223634 GGCTCCATTGCACTCCAGCCTGG + Intronic
967375284 3:188793910-188793932 GCCTTAGTTTCCCTCCAGCCAGG + Intronic
967554633 3:190840515-190840537 GGCATCATTGCACTCCAGCCTGG + Intergenic
967640022 3:191851262-191851284 GCCATCACTGCACTCCAGCCTGG + Intergenic
967731433 3:192910432-192910454 GGCATCATTGCACTCCAGCCTGG + Intronic
968017649 3:195353034-195353056 TCATGCCATTCACTCCAGCCTGG + Intronic
968121059 3:196126321-196126343 CACTCCCTTGCACTCCAGCCTGG - Intergenic
968195816 3:196705477-196705499 GCCATTATTGCACTCCAGCCTGG - Intronic
968521451 4:1036395-1036417 CCCTGCCTTCCACTGCAGCCAGG - Intergenic
968687686 4:1972517-1972539 GCATTCCTGTGACTCCAGCGGGG + Intronic
968775682 4:2538240-2538262 GCCATTATTGCACTCCAGCCTGG - Intronic
969007447 4:4032066-4032088 TCCTGCCATTCATTCCAGCCAGG - Intergenic
969132732 4:5003641-5003663 GCCTCTCTTGCACTGCAGCCTGG - Intergenic
969369579 4:6723240-6723262 GTCTCCCTTCCCCTCCAGCCAGG + Intergenic
969451211 4:7274512-7274534 CTCTTCCTCCCACTCCAGCCAGG - Intronic
969701135 4:8768472-8768494 GCCATCATTTCAGGCCAGCCAGG + Intergenic
969921153 4:10540866-10540888 GCCTTCCATTCATCCCAGACTGG + Intronic
970852105 4:20614732-20614754 GCGTTCATGGCACTCCAGCCTGG + Intronic
971360767 4:25936461-25936483 TCATGCCTTGCACTCCAGCCTGG + Intergenic
971594306 4:28509185-28509207 CCCACCATTTCACTCCAGCCTGG + Intergenic
972565816 4:40268157-40268179 GCCAGCCCTTCACCCCAGCCAGG + Intergenic
972576612 4:40357651-40357673 GGCGTCATTGCACTCCAGCCTGG + Intergenic
972709343 4:41578764-41578786 GACTTCATTTCACTCTAGCCTGG - Intronic
973301830 4:48593692-48593714 ACCATTATTTCACTCCAGCCTGG + Intronic
973686310 4:53373617-53373639 CCCATCATTGCACTCCAGCCTGG - Intergenic
973697690 4:53506813-53506835 GCCGCCGTTGCACTCCAGCCTGG + Intronic
973855724 4:55008512-55008534 GCCTTCCTCTCTCCCCAGCGAGG + Intergenic
973919869 4:55673928-55673950 GCCTTCCTTTCACTCGAGGAGGG - Intergenic
974035780 4:56816832-56816854 GGCTCCACTTCACTCCAGCCTGG + Intronic
974168212 4:58231221-58231243 GCCATCCTTGTAATCCAGCCAGG + Intergenic
974707140 4:65533887-65533909 TCCCTCATTGCACTCCAGCCTGG + Intronic
975611597 4:76209410-76209432 GGCTCCCTTGAACTCCAGCCTGG - Intronic
975798876 4:78037710-78037732 CCCATCATTGCACTCCAGCCTGG - Intergenic
976414180 4:84752484-84752506 GCCACCATTGCACTCCAGCCGGG + Intronic
977608820 4:99011894-99011916 CGCTCCATTTCACTCCAGCCTGG + Intronic
978134085 4:105235626-105235648 GCCTTCAATTCAATCCATCCTGG - Exonic
978525212 4:109658339-109658361 CCCATCATTGCACTCCAGCCTGG - Intronic
978600268 4:110419956-110419978 TCGTGCCTTGCACTCCAGCCTGG - Intronic
978604165 4:110460954-110460976 GCATTCCCTGCACTCCAGCCTGG + Intronic
978879657 4:113686017-113686039 TCATGCCTTGCACTCCAGCCTGG + Intronic
978903490 4:113979947-113979969 GCCGTCCTTTCCCTCTAGCGGGG - Intergenic
979252835 4:118583084-118583106 CGCTTCATTTCACTCCAGCCTGG + Intergenic
979485923 4:121270320-121270342 GGTTTCATTGCACTCCAGCCTGG + Intergenic
980158023 4:129130329-129130351 TCACGCCTTTCACTCCAGCCTGG - Intergenic
980227503 4:130005562-130005584 TCCTGCCATTCACTCCAGCTTGG + Intergenic
980521370 4:133940248-133940270 GCATTCCTTTCCTTCCAGTCAGG - Intergenic
981522780 4:145681039-145681061 GCCTGCCTTTCAAACCAGCTTGG - Intronic
983865997 4:172767707-172767729 TCATTCATTGCACTCCAGCCTGG - Intronic
984123203 4:175771506-175771528 GGCTGCATTGCACTCCAGCCTGG + Intronic
984706297 4:182849572-182849594 CCATTCATTGCACTCCAGCCTGG - Intergenic
985010096 4:185573546-185573568 CCCTTCCTCCCTCTCCAGCCAGG - Intergenic
985142824 4:186860411-186860433 GGCACCATTTCACTCCAGCCTGG - Intergenic
985251403 4:188027946-188027968 CCCGTCATTGCACTCCAGCCTGG - Intergenic
985255044 4:188061749-188061771 TCGTTCCATTCACTCCAGCCTGG - Intergenic
985746235 5:1649886-1649908 GCCTCCACTGCACTCCAGCCTGG - Intergenic
986186380 5:5445030-5445052 ATCTTCCTGTCATTCCAGCCTGG + Intronic
986215559 5:5715995-5716017 GCCATCTTTTCCCTCAAGCCAGG - Intergenic
986951182 5:13086773-13086795 TGCCTCCTTGCACTCCAGCCTGG + Intergenic
987014012 5:13798816-13798838 GCCAACATTGCACTCCAGCCTGG - Intronic
987114946 5:14718773-14718795 GCACTCCATGCACTCCAGCCTGG + Intronic
987155899 5:15089501-15089523 GGCATCATTGCACTCCAGCCTGG - Intergenic
987483484 5:18491459-18491481 GTACTCCTTTCACACCAGCCTGG + Intergenic
987733896 5:21813434-21813456 CCCTCCATTGCACTCCAGCCTGG + Intronic
988503874 5:31805152-31805174 GCCGCCATTGCACTCCAGCCTGG + Intronic
988784046 5:34549640-34549662 GGCTCCATTGCACTCCAGCCTGG - Intergenic
989048847 5:37298192-37298214 GGCATCATTCCACTCCAGCCTGG + Intronic
989205334 5:38804256-38804278 GCCTGCCTTTCAGCCCAGCATGG + Intergenic
989303142 5:39917877-39917899 CACTTCATTGCACTCCAGCCTGG + Intergenic
989366422 5:40660887-40660909 GCCATGATTACACTCCAGCCTGG - Intergenic
989385565 5:40851770-40851792 GGCTCCATTGCACTCCAGCCTGG + Intronic
989440241 5:41462739-41462761 CGCATCATTTCACTCCAGCCTGG + Intronic
989800660 5:45534359-45534381 GCATTCCATGCATTCCAGCCTGG + Intronic
990120122 5:52441254-52441276 CGCTTCATTGCACTCCAGCCTGG + Intergenic
990445018 5:55886316-55886338 TCATGCCATTCACTCCAGCCTGG - Intronic
990700548 5:58470652-58470674 GGGGTCCTTGCACTCCAGCCTGG - Intergenic
990917742 5:60929541-60929563 CACTTCATTGCACTCCAGCCTGG + Intronic
991186931 5:63819376-63819398 TCATTCCATTCACTCCAGCCTGG + Intergenic
991374103 5:65947964-65947986 GCCACCATTCCACTCCAGCCTGG + Intronic
991374739 5:65955020-65955042 GCCCCACTTGCACTCCAGCCTGG + Intronic
991698562 5:69296505-69296527 TCATGCCTTGCACTCCAGCCTGG + Intronic
991728331 5:69559347-69559369 GCCAACCTTGCACTCCAGCCTGG - Intergenic
991770752 5:70038573-70038595 GCACTCCATGCACTCCAGCCTGG + Intronic
991804760 5:70414494-70414516 GCCAACCTTGCACTCCAGCCTGG - Intergenic
991850046 5:70913990-70914012 GCACTCCATGCACTCCAGCCTGG + Intronic
991866624 5:71068528-71068550 GCCAACCTTGCACTCCAGCCTGG + Intergenic
992801283 5:80298250-80298272 TCATGCCATTCACTCCAGCCTGG + Intergenic
993612250 5:90069482-90069504 TCACTCCTTGCACTCCAGCCTGG + Intergenic
994081025 5:95709155-95709177 CCCTGCCATTCATTCCAGCCAGG - Intergenic
994791250 5:104229219-104229241 GCACTCCATGCACTCCAGCCTGG - Intergenic
994892945 5:105661474-105661496 GGCGCCATTTCACTCCAGCCTGG + Intergenic
995659122 5:114461487-114461509 GGGTTCCACTCACTCCAGCCCGG + Intronic
995864416 5:116676252-116676274 TGCTCCATTTCACTCCAGCCTGG - Intergenic
997409439 5:133679874-133679896 ACCTCCCTTTCCCTCCAACCAGG + Intergenic
997925671 5:138028974-138028996 GCCGCCATTGCACTCCAGCCAGG + Intronic
998072413 5:139208434-139208456 CACTCCATTTCACTCCAGCCTGG - Intronic
998896111 5:146801920-146801942 TCCTCCCTTTCATTCCAGCATGG - Intronic
998955654 5:147435671-147435693 TCCTTCCTTTATCTCCAGCATGG - Intronic
999165841 5:149548807-149548829 CCATTCATTGCACTCCAGCCTGG + Intronic
999256633 5:150213258-150213280 GCCTACCCCACACTCCAGCCAGG - Intronic
999521610 5:152356745-152356767 GCCAGCCTTTCCCTCCAGCCTGG - Intergenic
1000323542 5:160154593-160154615 CCATTCATTGCACTCCAGCCTGG - Intergenic
1001039334 5:168321576-168321598 GTCATCATTGCACTCCAGCCTGG - Intronic
1001221450 5:169904046-169904068 TCGTTCCATTGACTCCAGCCTGG + Intronic
1001400206 5:171441927-171441949 CCCTTCCTTTCTATCCGGCCAGG + Intronic
1001802930 5:174559028-174559050 TCCTTCCTTCCACTCCATCATGG + Intergenic
1001900661 5:175425513-175425535 CTCTTCATTGCACTCCAGCCTGG - Intergenic
1002127900 5:177060459-177060481 GCCTCCACTGCACTCCAGCCTGG + Intronic
1002325987 5:178406471-178406493 GTCGCCATTTCACTCCAGCCTGG - Intronic
1002389555 5:178899040-178899062 TCCTCCCCTTCACTCCAGCTTGG - Intronic
1002540324 5:179902470-179902492 GCCTCCCTTTCCTGCCAGCCAGG - Intronic
1002720167 5:181254416-181254438 GCCGTCACTGCACTCCAGCCTGG - Intronic
1002836190 6:867245-867267 GCCGCCATTGCACTCCAGCCTGG - Intergenic
1003865720 6:10360808-10360830 CCATTCATTGCACTCCAGCCTGG - Intergenic
1003889110 6:10548188-10548210 GCACTCCATGCACTCCAGCCTGG + Intronic
1004042118 6:11990038-11990060 GGCGTCATTGCACTCCAGCCTGG - Intergenic
1004069397 6:12284458-12284480 GCCGTGATTGCACTCCAGCCTGG + Intergenic
1004220199 6:13740324-13740346 GCACTCATTGCACTCCAGCCTGG + Intergenic
1004361864 6:14978369-14978391 GCCGCCGTTGCACTCCAGCCTGG - Intergenic
1004597805 6:17117110-17117132 GGCATCATTGCACTCCAGCCTGG - Intronic
1005011241 6:21337604-21337626 GCCATGATTGCACTCCAGCCTGG - Intergenic
1005649620 6:27874601-27874623 GCACTCCATGCACTCCAGCCTGG + Intergenic
1005681352 6:28211908-28211930 GCCGCCATTGCACTCCAGCCTGG - Intergenic
1006319317 6:33310790-33310812 GCCTGCACTGCACTCCAGCCTGG + Intronic
1006534706 6:34688915-34688937 CACGTCATTTCACTCCAGCCTGG + Intronic
1006592329 6:35167513-35167535 GCTTTCCTTTCACCCAATCCAGG + Intergenic
1006650338 6:35545885-35545907 TGCTTCATTGCACTCCAGCCTGG - Intergenic
1006850104 6:37092333-37092355 GGCATCATTGCACTCCAGCCTGG + Intergenic
1007009617 6:38403019-38403041 GCTATCATTGCACTCCAGCCTGG + Intronic
1007481643 6:42154118-42154140 GCCTTCCTGCCACACCAGCTTGG - Intergenic
1007499876 6:42288522-42288544 GGCTCCATTGCACTCCAGCCTGG + Intronic
1007690085 6:43695296-43695318 GCCTTCCTTCCACCTCACCCAGG + Intergenic
1007755797 6:44098604-44098626 ACATTCCCTGCACTCCAGCCTGG - Intergenic
1008848978 6:56001478-56001500 TCCTGCCACTCACTCCAGCCTGG - Intergenic
1009604793 6:65853274-65853296 CACTCCCTTACACTCCAGCCTGG + Intergenic
1009961054 6:70521958-70521980 GGCGCCCTTGCACTCCAGCCTGG - Intronic
1010022884 6:71181687-71181709 GCATTCCTATCTCTCCAGGCTGG - Intergenic
1010678986 6:78777134-78777156 GCCTTCCTTTCACTTAAGAGTGG - Intergenic
1010687593 6:78870752-78870774 GCCTCCATTGTACTCCAGCCTGG - Intronic
1011057862 6:83225160-83225182 CCATTCATTGCACTCCAGCCTGG + Intronic
1011084522 6:83524179-83524201 GCCTTCCTTTCAGTGGACCCGGG + Exonic
1011356714 6:86479027-86479049 CCCTGCCATTCATTCCAGCCAGG + Intergenic
1012253766 6:97008758-97008780 AGCATCCTTTCCCTCCAGCCTGG + Intronic
1012801266 6:103832200-103832222 GCCTTCCCTCCACTCCCACCAGG - Intergenic
1013336972 6:109173465-109173487 GCATTCACTCCACTCCAGCCTGG - Intergenic
1013858477 6:114604770-114604792 GACTTTCTGTCATTCCAGCCTGG - Intergenic
1014210467 6:118702950-118702972 GGCTCCATTGCACTCCAGCCTGG + Intronic
1014428819 6:121341831-121341853 GGCTCCACTTCACTCCAGCCTGG - Intergenic
1014720461 6:124911576-124911598 GCCTCCACTGCACTCCAGCCTGG + Intergenic
1016551362 6:145283649-145283671 GCCACCATTGCACTCCAGCCTGG + Intergenic
1017126829 6:151072762-151072784 GCCTCCTCTGCACTCCAGCCTGG + Intronic
1017255813 6:152332012-152332034 GCATTCATTGCACTCCAGCCTGG - Intronic
1017644395 6:156525989-156526011 GGCTTCCTTTCTGTCCAGTCTGG + Intergenic
1017886026 6:158599996-158600018 GCCTTCATCACACTCCATCCGGG - Intronic
1017907804 6:158768853-158768875 GCCCAGCTCTCACTCCAGCCTGG + Intronic
1018189207 6:161293804-161293826 GCCTGCTTTTCAAGCCAGCCTGG + Intergenic
1018268548 6:162051707-162051729 GCCTTCCTTCCTCTCCATCCTGG + Intronic
1018575104 6:165251696-165251718 GCCACCATTGCACTCCAGCCTGG + Intergenic
1018748785 6:166783130-166783152 GCCTCCACTGCACTCCAGCCTGG - Intronic
1019601003 7:1883755-1883777 GCCTTCCTTTTAATACGGCCTGG - Intronic
1019719751 7:2560999-2561021 GGCATCATTGCACTCCAGCCTGG - Intronic
1019983842 7:4641330-4641352 GCCACCATTGCACTCCAGCCTGG + Intergenic
1020196666 7:6045149-6045171 GGCATCACTTCACTCCAGCCTGG - Intronic
1020223872 7:6264201-6264223 GGCTCCATTGCACTCCAGCCTGG + Intronic
1020257884 7:6512272-6512294 GCCTTGATTGCACTCCAGCCTGG - Intronic
1021466707 7:20952491-20952513 ACCTTCCTTCCACTCCTGGCAGG - Intergenic
1022279779 7:28895925-28895947 GGCTCCATTGCACTCCAGCCTGG - Intergenic
1022733723 7:33056626-33056648 CGCTTCATTGCACTCCAGCCTGG + Intronic
1023960909 7:44925197-44925219 GCACCCCTTGCACTCCAGCCTGG + Intergenic
1024471261 7:49770668-49770690 TCCTGCCTTGCACTCTAGCCTGG + Intergenic
1024819677 7:53312630-53312652 GCACTCCCTGCACTCCAGCCTGG + Intergenic
1024918071 7:54525728-54525750 GCCCTCCTTTCCCTCGACCCAGG - Intergenic
1025899685 7:65733768-65733790 CCATTCATTGCACTCCAGCCTGG - Intergenic
1025900860 7:65743551-65743573 AGCTTCATTGCACTCCAGCCTGG + Intergenic
1026117012 7:67504112-67504134 GGCATCATTTCACTCCAGCCTGG + Intergenic
1026127438 7:67591712-67591734 GGCGTCATTGCACTCCAGCCTGG - Intergenic
1027370426 7:77503757-77503779 CCCATCATTTCACTCCAGCCTGG + Intergenic
1027371915 7:77515263-77515285 GCCTTCATATGACTGCAGCCAGG - Intergenic
1027764365 7:82321353-82321375 GGCACCATTTCACTCCAGCCTGG + Intronic
1028496479 7:91466563-91466585 CCATTCATTGCACTCCAGCCTGG + Intergenic
1029035947 7:97521630-97521652 GGCATCATTGCACTCCAGCCTGG + Intergenic
1029046425 7:97634118-97634140 CATTTCATTTCACTCCAGCCTGG + Intergenic
1029523517 7:101079979-101080001 GCATTCATTGCACTCTAGCCTGG - Intergenic
1029527811 7:101105888-101105910 GGCATCCCTGCACTCCAGCCTGG + Intergenic
1029604056 7:101587952-101587974 CACTTCATTGCACTCCAGCCTGG + Intergenic
1029798475 7:102921106-102921128 CACTTCATTGCACTCCAGCCTGG + Intronic
1030035194 7:105403023-105403045 GGCGTCCCTGCACTCCAGCCTGG - Intergenic
1030087488 7:105829406-105829428 GCACTCATTGCACTCCAGCCTGG + Intronic
1030284767 7:107814561-107814583 GGCTCCATTGCACTCCAGCCTGG - Intergenic
1030562444 7:111106551-111106573 GCAAGCCTTTCACTCAAGCCTGG - Intronic
1031052656 7:116960231-116960253 CCCGTCCCTGCACTCCAGCCTGG - Intronic
1031078074 7:117231850-117231872 GCCCTGATTACACTCCAGCCTGG + Intergenic
1031340137 7:120590056-120590078 GCCGCCATTGCACTCCAGCCTGG - Intronic
1031425325 7:121598586-121598608 CCCGCCCTTGCACTCCAGCCTGG - Intergenic
1031943392 7:127813599-127813621 CCATTGCTTGCACTCCAGCCTGG - Intronic
1032088558 7:128896845-128896867 GGCGCCATTTCACTCCAGCCTGG + Intronic
1032153823 7:129452315-129452337 GGCTTATTTTCACTCCAGCTAGG - Intronic
1032511495 7:132476003-132476025 GCCTTCTCTGCACTCAAGCCTGG - Intronic
1033128495 7:138725553-138725575 GCCGCCATTGCACTCCAGCCTGG - Intronic
1033264262 7:139871035-139871057 GCCTCCACTGCACTCCAGCCTGG + Intronic
1033282552 7:140016464-140016486 GTCTTCCATTCATTCAAGCCAGG + Intronic
1033363073 7:140651562-140651584 GCCTCCACTGCACTCCAGCCTGG - Intronic
1033427177 7:141254675-141254697 GGCGCCATTTCACTCCAGCCTGG + Intronic
1033642359 7:143273730-143273752 GCATTGCATGCACTCCAGCCTGG + Intergenic
1034110294 7:148530491-148530513 CCCGTCCCTGCACTCCAGCCTGG + Intergenic
1034124302 7:148657140-148657162 GCCTTCACTGCACTCCAGCCTGG + Intergenic
1034298469 7:149994555-149994577 CCATTCATTGCACTCCAGCCTGG + Intergenic
1034789338 7:153953902-153953924 GCCTGCATTTCCCTCCTGCCAGG - Intronic
1034807546 7:154102227-154102249 CCATTCATTGCACTCCAGCCTGG - Intronic
1034835321 7:154346344-154346366 CCATTCATTGCACTCCAGCCTGG - Intronic
1035071576 7:156148778-156148800 GCCCTCCTCCCTCTCCAGCCAGG + Intergenic
1035789975 8:2295888-2295910 GCCGTCCTCTCATTCCACCCTGG + Intergenic
1035802830 8:2425817-2425839 GCCGTCCTCTCATTCCACCCTGG - Intergenic
1035812150 8:2501375-2501397 GCCTTCCTTTCACTGCAGTGTGG + Intergenic
1035849427 8:2900536-2900558 TCCTTCCTATCAGTCCACCCCGG - Intergenic
1035868701 8:3113112-3113134 GCCTTCCTTTCCCTGAAGGCGGG + Intronic
1035918351 8:3650232-3650254 TGCTTCATTGCACTCCAGCCTGG + Intronic
1036199950 8:6762086-6762108 GGCGTCATTGCACTCCAGCCTGG + Intergenic
1036797618 8:11767748-11767770 GCCTGGGTTGCACTCCAGCCTGG + Intergenic
1037610737 8:20473971-20473993 GCACTCCATGCACTCCAGCCTGG + Intergenic
1037846487 8:22287201-22287223 GGCTTCACTGCACTCCAGCCTGG + Intronic
1038276348 8:26124359-26124381 CCATTCATTGCACTCCAGCCTGG + Intergenic
1038408093 8:27337178-27337200 CCATGCCATTCACTCCAGCCTGG - Intronic
1038531532 8:28321754-28321776 GCGTTCATTTCTCTCCAGCCTGG + Intronic
1038630936 8:29243303-29243325 GCCACCATTTCACTTCAGCCTGG + Intronic
1038788409 8:30643614-30643636 TCATTCATTGCACTCCAGCCTGG + Intronic
1039066763 8:33615485-33615507 GCCTCCACTGCACTCCAGCCTGG + Intergenic
1039471004 8:37813905-37813927 CCCTCCCTTCCAGTCCAGCCTGG + Intronic
1039585704 8:38705311-38705333 CACATCATTTCACTCCAGCCTGG - Intergenic
1040121977 8:43693772-43693794 GCCATCACTGCACTCCAGCCTGG + Intergenic
1040723399 8:50352432-50352454 TGCTTCATTGCACTCCAGCCTGG - Intronic
1040761784 8:50855146-50855168 GGCGTCATTGCACTCCAGCCTGG - Intergenic
1041065506 8:54079027-54079049 GCCATCCCTGCACTCCAGCCTGG - Intronic
1041092569 8:54316610-54316632 GGCGCCTTTTCACTCCAGCCTGG - Intergenic
1041340266 8:56838383-56838405 GCCGCCATTGCACTCCAGCCTGG - Intergenic
1041737523 8:61127256-61127278 CACATCATTTCACTCCAGCCTGG - Intronic
1042253362 8:66778335-66778357 GCCACCACTTCACTCCAGCCTGG - Intronic
1042538887 8:69887618-69887640 GGCATCATTGCACTCCAGCCTGG + Intergenic
1042769656 8:72365922-72365944 GCCTCCACTGCACTCCAGCCAGG + Intergenic
1042947398 8:74169029-74169051 GGCATCATTGCACTCCAGCCTGG - Intergenic
1044442193 8:92236119-92236141 GCCGTGATTGCACTCCAGCCTGG - Intergenic
1044443363 8:92245804-92245826 TGCTCCATTTCACTCCAGCCTGG + Intergenic
1044622277 8:94202211-94202233 GGCGTCATTGCACTCCAGCCTGG - Intronic
1045866016 8:106866269-106866291 CCATTCATTGCACTCCAGCCTGG + Intergenic
1046578338 8:116059820-116059842 GCACTCATTGCACTCCAGCCTGG + Intergenic
1046952046 8:120028501-120028523 TCGTGCCTTGCACTCCAGCCTGG - Intronic
1047277832 8:123419140-123419162 GGCATCATTGCACTCCAGCCTGG - Intronic
1047591546 8:126332220-126332242 GCCTTCCTTTGAGTCCAGGAGGG - Intergenic
1047604979 8:126465809-126465831 CCCATCATTGCACTCCAGCCTGG + Intergenic
1047868878 8:129060450-129060472 GGCATCCCTGCACTCCAGCCTGG - Intergenic
1047912155 8:129542048-129542070 GCTTTCCTTTTACTCTAGACTGG - Intergenic
1048027974 8:130604233-130604255 ACCATCATTGCACTCCAGCCTGG + Intergenic
1048524688 8:135191305-135191327 GCCTCACCCTCACTCCAGCCTGG - Intergenic
1049023255 8:139971871-139971893 GCCATCACTGCACTCCAGCCTGG - Intronic
1049111060 8:140643734-140643756 GCCCCCATTGCACTCCAGCCTGG + Intergenic
1049378579 8:142301118-142301140 GCCTTCCTTCACCTCCCGCCAGG + Intronic
1049378601 8:142301185-142301207 GCCTTCCTTCCCCTCCCGTCAGG + Intronic
1049378626 8:142301252-142301274 GCCTTCCTTCCCCTCCCGTCAGG + Intronic
1049378648 8:142301314-142301336 GCCTTCCTTCCCCTCCCGTCAGG + Intronic
1049378669 8:142301376-142301398 GCCTTCCTTCCCCTCCCGTCAGG + Intronic
1049378694 8:142301443-142301465 GCCTTCCTTCCCCTCCCGTCAGG + Intronic
1049378716 8:142301505-142301527 GCCTTCCTTCCCCTCCCGTCAGG + Intronic
1049763338 8:144340865-144340887 CCCTCCATTGCACTCCAGCCTGG + Intergenic
1049970301 9:816329-816351 GCCGCCATTGCACTCCAGCCTGG - Intergenic
1050069315 9:1793689-1793711 TGCATCCTTGCACTCCAGCCTGG - Intergenic
1050344861 9:4676321-4676343 GCAGTCCATGCACTCCAGCCTGG + Intergenic
1050476668 9:6047764-6047786 TCGTGCCATTCACTCCAGCCTGG + Intergenic
1050922559 9:11223533-11223555 GCCGCCATTGCACTCCAGCCTGG + Intergenic
1050957371 9:11681812-11681834 CCATTCATTGCACTCCAGCCTGG + Intergenic
1051623762 9:19078751-19078773 GCACTCCATGCACTCCAGCCTGG + Intronic
1052153802 9:25155641-25155663 CCATTCATTGCACTCCAGCCTGG + Intergenic
1052806886 9:33021083-33021105 GGCTCCATTGCACTCCAGCCTGG + Intronic
1053557844 9:39156589-39156611 TGCTTCATTGCACTCCAGCCTGG + Intronic
1054139270 9:61462362-61462384 TGCTTCATTGCACTCCAGCCTGG - Intergenic
1055144133 9:72912474-72912496 TCCCTCCTTTCATTTCAGCCGGG - Intronic
1055293508 9:74809933-74809955 CCCATCATTGCACTCCAGCCTGG + Intronic
1055451326 9:76433633-76433655 GCCTGGCTTGCACTCCAGCATGG - Intronic
1055871001 9:80879690-80879712 GCCCCCATTGCACTCCAGCCTGG + Intergenic
1055889450 9:81107340-81107362 GACATCATTGCACTCCAGCCTGG + Intergenic
1056289997 9:85133578-85133600 GGCATCATTGCACTCCAGCCTGG + Intergenic
1056580536 9:87885995-87886017 CCCAACATTTCACTCCAGCCTGG + Exonic
1056629813 9:88283982-88284004 GGCACCATTTCACTCCAGCCTGG - Intergenic
1056846993 9:90047275-90047297 GGCGTCATTGCACTCCAGCCTGG - Intergenic
1057171742 9:92967003-92967025 GGCTCCATTGCACTCCAGCCTGG - Intronic
1058303711 9:103409501-103409523 CCCTCCATTGCACTCCAGCCTGG - Intergenic
1058964415 9:110023356-110023378 GGCGTCATTGCACTCCAGCCTGG - Intronic
1059206714 9:112474295-112474317 GCCTTCCTTTCACTTCCGCAAGG + Intronic
1060077138 9:120602051-120602073 GGCGCCATTTCACTCCAGCCTGG - Exonic
1060483704 9:124033669-124033691 GCCTTCTTTCCAGCCCAGCCAGG - Intergenic
1060612739 9:124983115-124983137 GCACTCCATGCACTCCAGCCTGG + Intronic
1060912485 9:127362113-127362135 TCGTGCCTTGCACTCCAGCCTGG - Intronic
1060929197 9:127478006-127478028 GCCATTATTGCACTCCAGCCTGG + Intronic
1060963311 9:127696820-127696842 CCATTCATTGCACTCCAGCCTGG + Intronic
1061050971 9:128194772-128194794 CCCATCGTTGCACTCCAGCCTGG + Intronic
1061079138 9:128359759-128359781 GGCATCACTTCACTCCAGCCTGG + Intronic
1061225339 9:129278083-129278105 GCCGTCAGTGCACTCCAGCCTGG + Intergenic
1061314991 9:129789668-129789690 GCCATCACTGCACTCCAGCCTGG + Intergenic
1061452170 9:130673713-130673735 GGCATCATTGCACTCCAGCCTGG - Intronic
1061596581 9:131634209-131634231 GCCGTTGTTGCACTCCAGCCTGG + Intronic
1061620453 9:131808161-131808183 CACTCCATTTCACTCCAGCCTGG - Intergenic
1062502427 9:136857257-136857279 GCCACCCTTTCCCACCAGCCTGG + Exonic
1062569235 9:137177180-137177202 GCCTTCCTTTCACTCCAGCCTGG - Intronic
1185803503 X:3034921-3034943 GCCTCCACTGCACTCCAGCCTGG - Intergenic
1187890573 X:23930558-23930580 GCCATGATTGCACTCCAGCCTGG + Intronic
1188706758 X:33343092-33343114 CCCGTCATTGCACTCCAGCCTGG + Intergenic
1188907015 X:35801609-35801631 GCCTTACTTTGAATCCAGGCTGG - Intronic
1189259216 X:39666262-39666284 GCCTTCCTTTCATTCCTGGGTGG + Intergenic
1189898247 X:45678744-45678766 GCACTCCATGCACTCCAGCCTGG + Intergenic
1190281114 X:48930916-48930938 GGCGCCCTTACACTCCAGCCTGG + Intronic
1190761382 X:53440859-53440881 GGCTTCCTAGCTCTCCAGCCCGG + Intergenic
1190906158 X:54730441-54730463 GCCTTACTGTCACTCTACCCAGG - Intergenic
1192295215 X:69840365-69840387 ACCTTGCTTTCACTCCAGTGGGG - Intronic
1192465602 X:71353499-71353521 GGCGTCATTGCACTCCAGCCTGG - Intergenic
1192474341 X:71426669-71426691 GCCGCCATTGCACTCCAGCCTGG + Intronic
1192587986 X:72335352-72335374 CCCTTCCTTTCACTGAAGCCCGG + Intronic
1193078847 X:77383907-77383929 ACCACCATTTCACTCCAGCCTGG + Intergenic
1194638757 X:96377107-96377129 CACTTCTTTGCACTCCAGCCTGG - Intergenic
1194739180 X:97551547-97551569 GCCGCCATTACACTCCAGCCAGG + Intronic
1194885642 X:99313149-99313171 GCCTTTCCTGCACTGCAGCCTGG - Intergenic
1195939874 X:110159262-110159284 GCCTTTCTTCCACACCAGCTTGG - Intronic
1196100434 X:111842179-111842201 GGCTCCATTTCACTCCAGCCTGG - Intronic
1196706922 X:118724920-118724942 GCCTTTCTTTCACTTTGGCCCGG - Intergenic
1197523269 X:127526285-127526307 GGCTCCATTGCACTCCAGCCTGG + Intergenic
1198064315 X:133081324-133081346 GTCTTTCTGTCACTCCAGGCTGG + Intronic
1198257760 X:134939885-134939907 GCCACCATTGCACTCCAGCCTGG - Intergenic
1198746201 X:139893079-139893101 GCCCCACTTGCACTCCAGCCTGG - Intronic
1199109696 X:143916231-143916253 GCATTCCTTACACACCAGCAAGG + Intergenic
1199310076 X:146311592-146311614 GCATTCCAGTCACTCAAGCCAGG - Intergenic
1199968695 X:152842540-152842562 GCCGCCATTGCACTCCAGCCTGG - Intronic
1200158497 X:153991721-153991743 GCGTGCATTGCACTCCAGCCTGG - Intergenic
1200407274 Y:2825385-2825407 TCATGCCATTCACTCCAGCCTGG + Intergenic
1200636794 Y:5664644-5664666 GGCTCCATTGCACTCCAGCCTGG - Intronic
1200954052 Y:8927700-8927722 GCCTTGCTTCCAATCCACCCAGG + Intergenic
1201071837 Y:10154072-10154094 GGCTCCATTGCACTCCAGCCTGG - Intergenic
1201272830 Y:12272078-12272100 ACCATCATTGCACTCCAGCCTGG - Intergenic
1201726698 Y:17159814-17159836 GGCTCCATTGCACTCCAGCCTGG + Intergenic
1201964299 Y:19715183-19715205 GGCATCATTGCACTCCAGCCTGG - Intronic
1202581605 Y:26387592-26387614 CCCACCCTTGCACTCCAGCCTGG - Intergenic