ID: 1062569235

View in Genome Browser
Species Human (GRCh38)
Location 9:137177180-137177202
Sequence GCCTTCCTTTCACTCCAGCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1062569235_1062569244 23 Left 1062569235 9:137177180-137177202 CCAGGCTGGAGTGAAAGGAAGGC No data
Right 1062569244 9:137177226-137177248 AGGCCAAGGCTGACGGAGCAGGG No data
1062569235_1062569240 16 Left 1062569235 9:137177180-137177202 CCAGGCTGGAGTGAAAGGAAGGC No data
Right 1062569240 9:137177219-137177241 GCCGCCGAGGCCAAGGCTGACGG No data
1062569235_1062569245 24 Left 1062569235 9:137177180-137177202 CCAGGCTGGAGTGAAAGGAAGGC No data
Right 1062569245 9:137177227-137177249 GGCCAAGGCTGACGGAGCAGGGG No data
1062569235_1062569243 22 Left 1062569235 9:137177180-137177202 CCAGGCTGGAGTGAAAGGAAGGC No data
Right 1062569243 9:137177225-137177247 GAGGCCAAGGCTGACGGAGCAGG No data
1062569235_1062569246 25 Left 1062569235 9:137177180-137177202 CCAGGCTGGAGTGAAAGGAAGGC No data
Right 1062569246 9:137177228-137177250 GCCAAGGCTGACGGAGCAGGGGG No data
1062569235_1062569237 3 Left 1062569235 9:137177180-137177202 CCAGGCTGGAGTGAAAGGAAGGC No data
Right 1062569237 9:137177206-137177228 CTCCAAGAGCAGAGCCGCCGAGG No data
1062569235_1062569239 9 Left 1062569235 9:137177180-137177202 CCAGGCTGGAGTGAAAGGAAGGC No data
Right 1062569239 9:137177212-137177234 GAGCAGAGCCGCCGAGGCCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1062569235 Original CRISPR GCCTTCCTTTCACTCCAGCC TGG (reversed) Intronic