ID: 1062569239

View in Genome Browser
Species Human (GRCh38)
Location 9:137177212-137177234
Sequence GAGCAGAGCCGCCGAGGCCA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1062569230_1062569239 24 Left 1062569230 9:137177165-137177187 CCCGCAGAAGTGCTGCCAGGCTG 0: 1
1: 0
2: 4
3: 27
4: 269
Right 1062569239 9:137177212-137177234 GAGCAGAGCCGCCGAGGCCAAGG No data
1062569231_1062569239 23 Left 1062569231 9:137177166-137177188 CCGCAGAAGTGCTGCCAGGCTGG 0: 1
1: 0
2: 1
3: 24
4: 264
Right 1062569239 9:137177212-137177234 GAGCAGAGCCGCCGAGGCCAAGG No data
1062569235_1062569239 9 Left 1062569235 9:137177180-137177202 CCAGGCTGGAGTGAAAGGAAGGC 0: 1
1: 0
2: 2
3: 64
4: 887
Right 1062569239 9:137177212-137177234 GAGCAGAGCCGCCGAGGCCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1062569239 Original CRISPR GAGCAGAGCCGCCGAGGCCA AGG Intronic
No off target data available for this crispr