ID: 1062570338

View in Genome Browser
Species Human (GRCh38)
Location 9:137182078-137182100
Sequence GGGATTGCAGGTGCGCAGGC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 246
Summary {0: 1, 1: 0, 2: 1, 3: 24, 4: 220}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1062570338_1062570347 25 Left 1062570338 9:137182078-137182100 CCGGCCTGCGCACCTGCAATCCC 0: 1
1: 0
2: 1
3: 24
4: 220
Right 1062570347 9:137182126-137182148 GACCTAAGCCCAGGTGTCCGAGG No data
1062570338_1062570345 16 Left 1062570338 9:137182078-137182100 CCGGCCTGCGCACCTGCAATCCC 0: 1
1: 0
2: 1
3: 24
4: 220
Right 1062570345 9:137182117-137182139 AAGCCAGAAGACCTAAGCCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1062570338 Original CRISPR GGGATTGCAGGTGCGCAGGC CGG (reversed) Intronic
900242435 1:1623473-1623495 GGGCGTGCAGGTGGGCATGCGGG + Exonic
902086626 1:13867863-13867885 GGGGTTGCAGGAGGACAGGCAGG - Intergenic
902245616 1:15118603-15118625 GGGAGTGCAGGTGCAGATGCGGG + Intergenic
902545513 1:17187098-17187120 GAGGTTGCAGCTGCACAGGCTGG + Intergenic
903267573 1:22167146-22167168 GAAATTGAAGGTGCCCAGGCTGG - Intergenic
903779792 1:25813984-25814006 GGAACTGCAGGTGAGCGGGCAGG + Exonic
904053726 1:27656632-27656654 GGGATAGCAGGTCCCCAGTCTGG - Intergenic
904669517 1:32152878-32152900 GGGATTGCAGGTGTGCACGCAGG - Intronic
904677185 1:32205714-32205736 TGCATTGCAGGTGCGGGGGCGGG + Exonic
904842260 1:33379950-33379972 GGGATGGCAGATGCTCAGGGAGG - Intronic
906106139 1:43293783-43293805 GGTATTGCTGGGGCCCAGGCAGG - Intergenic
906192940 1:43910277-43910299 GGGATAGCAGCTGTGCTGGCTGG - Intronic
906365604 1:45206735-45206757 TGGGTTGGAGGTGCGCGGGCGGG - Intronic
907437491 1:54458953-54458975 GGGAAGGAAGGTGGGCAGGCGGG + Intergenic
912906820 1:113716372-113716394 GGGATCTCAGTTGCCCAGGCTGG + Intronic
915603376 1:156936359-156936381 GGGATTGCAGGTGCACACCATGG - Intronic
916510965 1:165472087-165472109 GGGATTGCAGGTATGAACGCAGG - Intergenic
920140254 1:203805699-203805721 GGAATTGCAGGTGCAGATGCTGG + Intronic
920192048 1:204199858-204199880 GGGCTTGGAGGTGCCAAGGCTGG + Intronic
920872121 1:209803603-209803625 GGGCTTGGAGGAGGGCAGGCTGG - Intronic
920886932 1:209938331-209938353 GGGCTCGGAGGTGCGCCGGCAGG + Intronic
1062960687 10:1571616-1571638 GAGAGTGCAGGCGAGCAGGCAGG + Intronic
1063965790 10:11344755-11344777 GGCCTTGCAGGTGCTCAGGCCGG - Intergenic
1064009132 10:11721335-11721357 GGGAGTCAAGGTGGGCAGGCAGG + Intergenic
1066656968 10:37705352-37705374 GGGATAGAAGGTGCACAGACAGG - Intergenic
1067041505 10:42955591-42955613 GGGATAGAAGGTGCACAGACAGG - Intergenic
1068351840 10:55857624-55857646 GGGATAGCAGATGGGAAGGCAGG + Intergenic
1069908957 10:71748378-71748400 GTGACTGCTGGTGGGCAGGCTGG - Exonic
1071519077 10:86317934-86317956 GGTATTGCCGTTGCCCAGGCTGG + Intronic
1071602751 10:86966891-86966913 GGGATTTCAGGAGGGCTGGCAGG + Intronic
1073424810 10:103449961-103449983 TGGATTGCAGGAGAGGAGGCAGG + Exonic
1074468394 10:113705088-113705110 GGGAGGGCAGGTGAGCAGTCTGG - Intronic
1076770078 10:132657960-132657982 GGGACTGCAGGTGCTGGGGCCGG - Intronic
1077049141 11:558925-558947 GGGGCTGCAGGTGCGCCTGCTGG + Exonic
1077132184 11:978624-978646 AGGGGTGCAGGTGCGCAAGCTGG - Intronic
1077164955 11:1130786-1130808 GGGCTGGCAGGAGCTCAGGCAGG - Intergenic
1077459329 11:2700761-2700783 GGGATGGGAGGTGGGCAGGGCGG - Intronic
1078438278 11:11343559-11343581 GGGAATGGAGGTGCACAGCCTGG - Intronic
1079587370 11:22142431-22142453 GGGACTGCAGGTGTGCAGTCTGG - Intergenic
1080270249 11:30443520-30443542 GGGATTGCAGGTGGGAGGGTGGG + Intronic
1081787084 11:45755473-45755495 GGGAAGGCAGGAGCCCAGGCGGG - Intergenic
1084192512 11:67505349-67505371 GGGACTGCAGGGGCGCCGGCGGG - Exonic
1088325435 11:108596057-108596079 GGGACTACAGGTGCACATGCTGG - Intergenic
1088598199 11:111455346-111455368 GCGCCTGCAGGTGAGCAGGCAGG + Intronic
1089343917 11:117778048-117778070 GGGGCTGCAGGTGCACAGTCAGG - Intronic
1091140030 11:133227100-133227122 GGGTGTGCAGGGGCGAAGGCTGG - Intronic
1091719955 12:2805753-2805775 GGATTTGCAGGAGAGCAGGCTGG - Intergenic
1092177977 12:6423976-6423998 GGGATTACAGGTGCATATGCTGG - Intergenic
1094375578 12:29784270-29784292 GGTTTAGCAGGTGCGCAGTCTGG + Intronic
1094613130 12:32012686-32012708 GGGATTACAGGTGCACAGCCAGG - Intergenic
1097277123 12:57821250-57821272 GGAGTTGCAGGTGGGCAGGCAGG + Exonic
1097754468 12:63394012-63394034 GGGATTACAGGTCAGGAGGCAGG + Intergenic
1098785083 12:74743243-74743265 GGGATTTCTGTTGCCCAGGCTGG - Intergenic
1101582851 12:106058980-106059002 GCCATTGCAGGTGCTCAGGATGG + Intergenic
1101610303 12:106285074-106285096 GGAATGGCAGGTGCAAAGGCTGG - Intronic
1101724277 12:107376164-107376186 GGGATGGCTGGAGCGCAGGGTGG - Intronic
1104673102 12:130693863-130693885 TGGAATGCAGGTGTGCTGGCTGG + Intronic
1106167126 13:27257762-27257784 GGGATTACAGGTGCTCACGATGG - Intergenic
1106413427 13:29526440-29526462 TGGGGTGCAGTTGCGCAGGCTGG - Intronic
1106573794 13:30955850-30955872 GTGAGTGCAGGTGCGGTGGCTGG + Intronic
1106595348 13:31130488-31130510 GGAATTCCAGATGGGCAGGCAGG + Intergenic
1107447428 13:40481341-40481363 GGGGTGGGAGGTGCGGAGGCAGG + Intergenic
1107932559 13:45318390-45318412 GGAATTTCAGGTGTGCAAGCAGG + Intergenic
1108233281 13:48372513-48372535 GGGATTACAGGTGCCCAGCTGGG - Intronic
1108486311 13:50930008-50930030 GGGGGAGCAGGTGGGCAGGCAGG - Intronic
1113537472 13:111079584-111079606 GTGATTGCAGCCGCGCAGGCCGG - Intergenic
1115852209 14:37597688-37597710 GGGATCCCAGGTTCGCAGCCGGG + Intronic
1115985825 14:39103019-39103041 GGGACCGCAGGTGCGCAGCGGGG - Exonic
1117302164 14:54440912-54440934 GGGAATGCAGGGCCGCGGGCCGG + Intronic
1122347686 14:101070735-101070757 GGCAGTGCAGCTGCACAGGCAGG - Intergenic
1122997136 14:105271416-105271438 GCGACGGCAGGGGCGCAGGCTGG + Intronic
1123716691 15:23039114-23039136 GGGGTTGCAGGCGCGCGCGCCGG + Intronic
1124002136 15:25768415-25768437 GGGAGTCCAGGTGCCCAGCCAGG - Intronic
1124798055 15:32801743-32801765 TGGATTGCAGTGGCGCAGTCTGG - Intronic
1127964629 15:63914473-63914495 GGGCTTGCAGGTGCACAGAGTGG - Intronic
1132035964 15:98484959-98484981 GGGATGGCAGGTGTGAAGGCAGG - Intronic
1133279915 16:4659433-4659455 GGGTTTGCAGGTGAGGTGGCCGG + Intronic
1133339086 16:5025288-5025310 AGGGTTGCAGGTGCCCTGGCAGG + Exonic
1133444795 16:5850904-5850926 GGGACAGCAGGTGCGCAGCCTGG + Intergenic
1133808058 16:9140204-9140226 TGGATTGCAGGTGCAATGGCTGG + Intergenic
1134687478 16:16168936-16168958 GGGATTACAAGTGTGCAGCCTGG - Intronic
1135221800 16:20620862-20620884 GGGATTGCAGTTGAGGAGGGAGG + Intronic
1136243574 16:28959707-28959729 GGGATTACAGGTGCACGTGCTGG + Intronic
1136248124 16:28986578-28986600 GGGATCCGAGGTGCCCAGGCTGG + Intronic
1140956412 16:79870545-79870567 GGAATTGCATGTGCAAAGGCGGG + Intergenic
1141636059 16:85314478-85314500 GGGCTTGGAGGTGGCCAGGCTGG + Intergenic
1141641107 16:85342029-85342051 GGACTTGCAGGTGAGCAGGTGGG + Intergenic
1143078035 17:4361910-4361932 TGGATTGCAGTGGCCCAGGCTGG - Intronic
1144944234 17:18961639-18961661 GGGAATGGAGGTGCAGAGGCCGG + Intronic
1145390620 17:22453244-22453266 GGGATCGCGGGTGGGCAGGTAGG + Intergenic
1146852542 17:36235604-36235626 GGGAGTGCAGGTTCACAGTCTGG - Intronic
1146868455 17:36359476-36359498 GGGAGTGCAGGTTCACAGTCTGG - Intronic
1147071327 17:37960100-37960122 GGGAGTGCAGGTTCACAGTCTGG - Intergenic
1147082854 17:38039626-38039648 GGGAGTGCAGGTTCACAGTCTGG - Intronic
1147098797 17:38163597-38163619 GGGAGTGCAGGTTCACAGTCTGG - Intergenic
1147598480 17:41731907-41731929 GGACTTGCAGGTGCAAAGGCAGG + Intronic
1147652774 17:42071773-42071795 GGGAGAGCAGGAGAGCAGGCAGG - Intergenic
1149838835 17:59939780-59939802 GGGAGTGCAGGTTCACAGTCTGG + Intronic
1150080330 17:62232639-62232661 GGGAGTGCAGGTTCACAGTCTGG - Intergenic
1151569940 17:74921176-74921198 GGGCTTGCATGTCAGCAGGCAGG + Intronic
1151680459 17:75620169-75620191 GGGGGAGCAGGTGGGCAGGCAGG + Intergenic
1153620505 18:6973249-6973271 GGGATTGTATGTGCGCTGACTGG - Intronic
1153665112 18:7361013-7361035 GGGATTGCAGGCACGCAGCATGG + Intergenic
1158060147 18:53330651-53330673 GGCAGTGCAGGTAGGCAGGCAGG - Intronic
1159128753 18:64255932-64255954 GGGGTAGCTGGTGAGCAGGCTGG + Intergenic
1159948631 18:74462224-74462246 GGGAATGCAAGTGAGCAGGAGGG - Intergenic
1160151099 18:76394837-76394859 GGGAGGGCAGGTGGGAAGGCAGG + Intronic
1160233322 18:77065807-77065829 GGGATTGCAGGAGGGGAGGAAGG + Intronic
1160625401 18:80201053-80201075 GGGATGGCAGGGGCACAGCCAGG + Intronic
1161517305 19:4703629-4703651 GGGAGTGCAGTTGCCCAGGCGGG - Intronic
1162523235 19:11194009-11194031 GGGAAGGCAGGTGGGGAGGCTGG + Exonic
1162925003 19:13926489-13926511 GGGTGGGCAGGTGGGCAGGCAGG - Intronic
1163441405 19:17324170-17324192 GGGGTTGCTGGAGCCCAGGCTGG + Intronic
1164121222 19:22266763-22266785 GGGATTACAGGTGCCCAGCATGG - Intergenic
1167278876 19:48554619-48554641 TGGAATGCAGGTGAGGAGGCTGG - Intronic
1168249631 19:55134413-55134435 GGGATTACAGGTGCCGAGCCTGG - Intronic
924978521 2:199027-199049 GGGAATGCAGGGGGCCAGGCTGG - Intergenic
925285037 2:2710184-2710206 GGGTGTGCAGGTGTGCAGGCTGG - Intergenic
926798883 2:16641350-16641372 GGGCATGCAGGTGGGAAGGCTGG - Intronic
926814472 2:16786611-16786633 TGGTCTGCAGGTGTGCAGGCTGG - Intergenic
927845049 2:26467056-26467078 GGGCTGGCGGGTGCTCAGGCTGG + Intronic
927920841 2:26970895-26970917 GGGAGTGCGGGTGGGGAGGCAGG - Intronic
929218183 2:39437354-39437376 GGGATCGCGGCTGCGCAGTCGGG - Intergenic
929981418 2:46683746-46683768 GAGATGGCAGGTGCAGAGGCGGG - Intergenic
930401892 2:50900515-50900537 GGCATTTCAGGTGGGAAGGCGGG + Intronic
930706731 2:54511757-54511779 GGGATTGCAGAGGCTGAGGCAGG + Intronic
931348861 2:61470903-61470925 GCGAGGGGAGGTGCGCAGGCCGG + Intergenic
931414175 2:62065063-62065085 GGGATTACAGGTGCTGAGGCAGG + Intronic
931788138 2:65639842-65639864 GGGATTGAAGGTGAGAAGTCTGG + Intergenic
932430962 2:71673288-71673310 GGGACTGCACATGCGGAGGCCGG - Intronic
936937889 2:117855908-117855930 GGGATTACAGGTGCTCTGCCTGG - Intergenic
938048044 2:128140724-128140746 TGGATTGCAGCAGCGCAGTCAGG + Intronic
938756268 2:134382223-134382245 GGTATTGCTGTTGCCCAGGCTGG - Intronic
940720987 2:157281333-157281355 GGGATTACAGGTGCCCAGCCAGG + Intronic
941171699 2:162145905-162145927 GGGATTGCAGATGGGTATGCTGG - Intronic
943658042 2:190529838-190529860 GGGATGGCAGTGGCACAGGCTGG - Intronic
947286875 2:228526915-228526937 GGGACTGCAGGTGGACAAGCAGG + Intergenic
948175402 2:235938983-235939005 GGGGTTTCAGATGCGCAGCCAGG + Intronic
948783110 2:240337081-240337103 AGGTTTGCAGGTTTGCAGGCAGG + Intergenic
1168948901 20:1783145-1783167 GGGATGGCTGGGGAGCAGGCTGG - Intergenic
1169207583 20:3748945-3748967 GGGTTTGGAGGAGCGGAGGCAGG - Intronic
1170300638 20:14880905-14880927 GTGATTGCAGCTGCCCACGCTGG - Intronic
1171437368 20:25133804-25133826 GGGCTTCCAGGAGGGCAGGCTGG - Intergenic
1172127279 20:32632191-32632213 GGGAGTGCAGGGGCACAGACGGG - Intergenic
1172556133 20:35843042-35843064 GGGATTACAGGTGCCCACCCTGG + Intronic
1173495307 20:43514113-43514135 GGGCTTGCAGGCCCGGAGGCTGG + Intronic
1174487524 20:50870781-50870803 GGGAACTCAGGTGCGCAGGGTGG + Intronic
1175184700 20:57172248-57172270 GGGATTGAAGGTCCTTAGGCTGG - Intronic
1176138442 20:63535124-63535146 GGGGTTCCAGGCGGGCAGGCTGG - Intronic
1179893766 21:44350476-44350498 TGGGGTGCAGGGGCGCAGGCGGG + Intronic
1180837291 22:18936243-18936265 GGGAATGCAGGGGCGCAGCGCGG + Exonic
1181305789 22:21916561-21916583 GGGACTGAGGGTGCACAGGCAGG - Intergenic
1183988630 22:41583515-41583537 GGCATTGCTGGAGAGCAGGCTGG + Intronic
1203287384 22_KI270734v1_random:161542-161564 GGGAATGCAGGGGCGCAGCGCGG + Intergenic
949710119 3:6862344-6862366 GGGAGTGCAGGTTGGCAGGCTGG - Intronic
949751962 3:7362838-7362860 GGGATTGCAGCTGGGCATGATGG + Intronic
954107205 3:48415778-48415800 ATGAATGCAGGGGCGCAGGCAGG + Intronic
954752834 3:52823337-52823359 GTGCTTGCAGGTGCACAGACCGG + Intronic
957062970 3:75497129-75497151 GGGATTACAGGTGCGCAAGACGG - Intergenic
960313226 3:116142438-116142460 GGAATTGCACCTGCACAGGCTGG - Intronic
961700725 3:128742911-128742933 AGGAGTGCAGGTGCGCAGCATGG - Intronic
961779160 3:129311416-129311438 GGGATTGGGGGTGCAGAGGCTGG + Intergenic
962814954 3:138989157-138989179 GGGATTACAGGCGCCCAGTCTGG + Intergenic
963073614 3:141326402-141326424 GGGGTTGCAGGGGAGCAGGGTGG + Intronic
963582769 3:147147490-147147512 GGGAGTGCTGGTGGGCAGGTAGG - Intergenic
966801293 3:183766756-183766778 GGGATTGCTGGAGCCCAGGGAGG - Intronic
966905054 3:184516552-184516574 TGGAGTGCAGTGGCGCAGGCTGG + Intronic
967214489 3:187198971-187198993 GGGATTACAGGTCCCCAGCCAGG - Intronic
967974742 3:195027392-195027414 GGGGTTGCAGCTGAGCTGGCAGG + Intergenic
968914894 4:3493134-3493156 GGGCAGGCAGGTGCACAGGCTGG - Exonic
969006865 4:4027240-4027262 GGGATTATAGGTGCGCAAGACGG - Intergenic
982285229 4:153726862-153726884 GGGCTTGGAGTTGTGCAGGCAGG + Intronic
984261741 4:177451226-177451248 GGGATTCCAGCTGCTCAGGAGGG - Intergenic
985515778 5:343916-343938 GGGAGTGCACGTACGCGGGCCGG + Exonic
986141569 5:5035672-5035694 GGGATGGCAGGTGTGGAGGTTGG + Intergenic
988547635 5:32173695-32173717 GCGAGGGCAGGTGCGCGGGCCGG + Intronic
988572054 5:32377366-32377388 GGGATTACAGGTGTGCATGTTGG + Intronic
992320879 5:75611969-75611991 GGGAGTGCAGCGGTGCAGGCTGG - Intronic
992611156 5:78509771-78509793 GGAATTGCAGGTAAGAAGGCAGG - Exonic
992678966 5:79134115-79134137 GGGACTGCAGGAGAGCAGGCAGG + Intronic
997209403 5:132068636-132068658 GGGGATGCAGGTGCGCGAGCCGG + Intergenic
997409001 5:133675827-133675849 GGGATTGCAGAAGGGCAGGAAGG + Intergenic
998072424 5:139208526-139208548 GGGATTACAGGTGCGCACCACGG + Intronic
998132294 5:139657532-139657554 GGGGTTGCTGGTGAACAGGCTGG + Intronic
998975793 5:147645318-147645340 GGGATTGCAGCTGAGCACGGTGG - Intronic
1001732856 5:173973089-173973111 GGGCTTGGGGGTGCGCAGCCTGG - Intergenic
1005283872 6:24303386-24303408 GGGAATGGAGGGGAGCAGGCTGG - Intronic
1005650169 6:27878724-27878746 GGAGTTGCAGGTGGGCAGGCAGG + Intergenic
1006359896 6:33581495-33581517 GGTATTGCTGTTGCCCAGGCTGG - Intergenic
1006630581 6:35427328-35427350 GGGCCTGCAGGTGAGCAGGCAGG + Exonic
1006801958 6:36765322-36765344 GGGACGGCAGGTAAGCAGGCAGG - Exonic
1006845036 6:37056082-37056104 AGGAATGCAGGTGGGCAGCCAGG - Intergenic
1008210313 6:48714931-48714953 GGGACTGCAGATGTGCAAGCTGG - Intergenic
1008365833 6:50678792-50678814 GGGATTACAGGTGCTCTGCCTGG - Intergenic
1010066085 6:71684191-71684213 GGGATCCCAAGTGCGCAGGCTGG - Intergenic
1013796842 6:113897607-113897629 GGTTTTGCATGTGCCCAGGCTGG + Intergenic
1015366177 6:132400863-132400885 TGTATTGCAGGTGTGTAGGCGGG + Intronic
1019182865 6:170202784-170202806 GGAGTTGGAGGTGCTCAGGCAGG + Intergenic
1021608709 7:22435214-22435236 GTGGGTGCAGGTGGGCAGGCAGG - Intronic
1023229724 7:38013607-38013629 GAGATGGGAGGTGCACAGGCTGG + Intronic
1024532004 7:50401080-50401102 GGGTCTGCAGGTGAGCAGACAGG + Exonic
1024675665 7:51636026-51636048 GGGGTTGCAGGAGCACTGGCAGG + Intergenic
1028856151 7:95596394-95596416 AGGACTGCAGGTGCGCTGGCTGG + Exonic
1029055133 7:97733153-97733175 GGGATTGGAGGGCCGGAGGCTGG + Intronic
1029630094 7:101744668-101744690 GGGGTGGCAGGAGGGCAGGCTGG + Intergenic
1030461220 7:109839282-109839304 GGATTTGCAGGTGGGCAGGCAGG - Intergenic
1031148933 7:118030183-118030205 GGGATTACAGTTGCTCAGGCAGG + Intergenic
1032277384 7:130471018-130471040 GGTATTGCTGTTGCCCAGGCTGG + Intergenic
1032698062 7:134354961-134354983 GGGAGTGCAACTGCCCAGGCTGG + Intergenic
1033284912 7:140033086-140033108 GGGACTACAGGCGCACAGGCTGG + Intronic
1033286159 7:140042354-140042376 GGGCTTTCAGGTGGGCAGGTGGG + Intronic
1036369249 8:8148686-8148708 GGGATTACAGGTGCACAAGACGG + Intergenic
1036881641 8:12516954-12516976 GGGATTACAGGTGCACAAGACGG - Intergenic
1037936554 8:22918778-22918800 GGGATGGGAGGTGCAGAGGCCGG - Intronic
1038112264 8:24512610-24512632 GGGATTGCAGGAATGCTGGCTGG + Intronic
1038331102 8:26610048-26610070 GGGATACCAGGAGCCCAGGCTGG - Intronic
1039995894 8:42532834-42532856 GAAGTGGCAGGTGCGCAGGCGGG + Intronic
1040291987 8:46130193-46130215 GGGAAACCAGGTGCGCAGGGTGG - Intergenic
1041687020 8:60653187-60653209 GGGAGGGCTGGAGCGCAGGCCGG + Intergenic
1044242498 8:89902853-89902875 GGGATGGGAGGGGAGCAGGCGGG + Intronic
1046891198 8:119422903-119422925 GGGCTTGTAGGTGTGCAGGCTGG - Exonic
1049179250 8:141212688-141212710 GGGATTGAGGGTGCTCAGGCAGG - Intronic
1049422806 8:142524388-142524410 GGGACAGCAGGTGCACAGCCTGG - Intronic
1049442183 8:142614586-142614608 GGGCCTGCAGGGGCGCGGGCGGG - Intergenic
1053065554 9:35066395-35066417 GGGATTACAGGTGCCCACGATGG + Intronic
1054892698 9:70269442-70269464 AGGACTACAGGTGCGCAGCCAGG - Intronic
1056451168 9:86718099-86718121 GGGATTGCAGGTGTGCTGCATGG + Intergenic
1056958919 9:91104663-91104685 GGGATTGGAGGTGGGGAGGGAGG + Intergenic
1059435148 9:114271599-114271621 TGAATTGCAGGTGGGCAGGCGGG + Intronic
1060828794 9:126701138-126701160 GGGACAGCAGGTCCGGAGGCGGG + Intergenic
1061653838 9:132072557-132072579 GGGTTTGCAGGTGGGGAGGGAGG + Intronic
1061895236 9:133643621-133643643 GGGATGCCAGGGGCCCAGGCAGG - Intronic
1062236933 9:135514838-135514860 GGGAGGGCAGGTGTGCAGGTGGG + Intergenic
1062322018 9:135994690-135994712 GGGCTTGCACGTGAGCAGGTGGG - Intergenic
1062553664 9:137103500-137103522 GCTATTGCAGGCGTGCAGGCCGG + Intronic
1062570338 9:137182078-137182100 GGGATTGCAGGTGCGCAGGCCGG - Intronic
1203740188 Un_GL000216v2:171539-171561 GGGAGTGCAGGTGAGCACCCCGG - Intergenic
1185476217 X:417112-417134 GGGATTACAGGTGTGCAGTACGG + Intergenic
1186200204 X:7148535-7148557 GGGATTGAAGATGCTCAGGGTGG + Intergenic
1186825039 X:13330767-13330789 GGGATTGCAGGTAACCAGCCAGG + Intergenic
1189309512 X:40009650-40009672 GGGAGTGCGGAAGCGCAGGCCGG - Intergenic
1189499366 X:41541254-41541276 GGTATTGCTGTTGCCCAGGCTGG + Intronic
1192198716 X:69049859-69049881 GAGGTTGCAGGTGCCCAGGTAGG + Intergenic
1197127602 X:122965870-122965892 GGGATTTCAAGTGCCAAGGCAGG - Intergenic
1199186817 X:144924915-144924937 GGAAGTGGAGGTGAGCAGGCTGG + Intergenic
1201983798 Y:19939065-19939087 GGGAGTGCAGTGGCTCAGGCGGG - Intergenic