ID: 1062570339

View in Genome Browser
Species Human (GRCh38)
Location 9:137182082-137182104
Sequence TGCTGGGATTGCAGGTGCGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 551
Summary {0: 1, 1: 1, 2: 6, 3: 123, 4: 420}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1062570339_1062570349 28 Left 1062570339 9:137182082-137182104 CCTGCGCACCTGCAATCCCAGCA 0: 1
1: 1
2: 6
3: 123
4: 420
Right 1062570349 9:137182133-137182155 GCCCAGGTGTCCGAGGCTGCAGG No data
1062570339_1062570351 29 Left 1062570339 9:137182082-137182104 CCTGCGCACCTGCAATCCCAGCA 0: 1
1: 1
2: 6
3: 123
4: 420
Right 1062570351 9:137182134-137182156 CCCAGGTGTCCGAGGCTGCAGGG No data
1062570339_1062570347 21 Left 1062570339 9:137182082-137182104 CCTGCGCACCTGCAATCCCAGCA 0: 1
1: 1
2: 6
3: 123
4: 420
Right 1062570347 9:137182126-137182148 GACCTAAGCCCAGGTGTCCGAGG No data
1062570339_1062570345 12 Left 1062570339 9:137182082-137182104 CCTGCGCACCTGCAATCCCAGCA 0: 1
1: 1
2: 6
3: 123
4: 420
Right 1062570345 9:137182117-137182139 AAGCCAGAAGACCTAAGCCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1062570339 Original CRISPR TGCTGGGATTGCAGGTGCGC AGG (reversed) Intronic
900417452 1:2541571-2541593 AGCTGGGATTACAGGTCGGCCGG + Intergenic
900928047 1:5718377-5718399 TGCTGGGACTACAGGTGTGGGGG - Intergenic
901068574 1:6506226-6506248 CGCAGGGAGTGCAGGGGCGCAGG + Intronic
901071260 1:6519934-6519956 TGCTGGGATTGCAGAGGCCGGGG - Intronic
901111425 1:6799383-6799405 AGCTGGGAATGCTGGTGAGCAGG + Intronic
901251637 1:7784071-7784093 TGCTGGGATTGGCCGAGCGCCGG + Intergenic
901919555 1:12526344-12526366 TGCTGGGATTCCAGGAGCCCGGG - Intergenic
903069798 1:20721568-20721590 TGCTGAGATTCCAGGAGGGCAGG - Exonic
903291930 1:22319472-22319494 TGCTGGGATTACAGGTGTGAGGG - Intergenic
904161801 1:28527507-28527529 TGCTAGGATTACAGGTGTGGTGG + Intronic
904164543 1:28545410-28545432 TGCTGGGATTACAGGTGTGTGGG - Intergenic
904973249 1:34435366-34435388 TGCTGGGATTACAGGTGTACAGG + Intergenic
905694759 1:39966354-39966376 TCCTGGGATTACAGGTGTGAGGG + Intronic
905821214 1:40992958-40992980 TGCTGGGATTACAGGTGTGAGGG + Intronic
905926064 1:41750828-41750850 AGCTGGGATTACAGGTGTGTAGG + Intronic
905933923 1:41808595-41808617 TGCTGTAATTGGAGGTGTGCAGG - Intronic
906161047 1:43649501-43649523 TGCTGGGATTACAGGCGTGAGGG + Intergenic
906195238 1:43926320-43926342 TGCTGGGATTACAGGCGTGAGGG - Intronic
906316744 1:44791414-44791436 TCCTGGGAGTGCAGGAGCTCAGG + Intergenic
906362117 1:45170693-45170715 TGCTGGGATTACAGGTGCACAGG + Intronic
908524065 1:64970487-64970509 TGCTGGGATTGCAGGATTACAGG - Intergenic
909636735 1:77825118-77825140 AGCTGAGACTGCAGGTGCGCTGG + Intronic
910394967 1:86783263-86783285 TGCTGGGATTACAGGCGTGAAGG - Intergenic
911061375 1:93751064-93751086 TGCAGGGCTTGCCGGTGTGCCGG - Intronic
911107792 1:94150616-94150638 TGCTGGGATTACAGGCGTGAAGG - Intronic
911345478 1:96691622-96691644 TGCTGGGATTACAGGTGTGACGG + Intergenic
913332275 1:117677419-117677441 AGCTGGGACTACAGGTGCCCGGG - Intergenic
913681654 1:121191596-121191618 TGCTGGGATTGGAGCAGCGAAGG + Intronic
913964537 1:143364636-143364658 ACCTGGGATTACAGGTGTGCTGG - Intergenic
913993469 1:143635948-143635970 TGCTAGGATTACAGGTGGTCAGG - Intergenic
914033489 1:143979234-143979256 TGCTGGGATTGGAGCAGCGAAGG + Intergenic
914058906 1:144190241-144190263 ACCTGGGATTACAGGTGTGCTGG - Intergenic
914120243 1:144776130-144776152 ACCTGGGATTACAGGTGTGCTGG + Intergenic
914155958 1:145088736-145088758 TGCTGGGATTGGAGCAGCGAAGG - Intronic
916036579 1:160927921-160927943 TGTTGGGACTACAGGTGCCCAGG - Intergenic
917399911 1:174636250-174636272 TGCTGGGATTACAGGTGTGAAGG - Intronic
917957258 1:180112360-180112382 TGCTGCTATTGCAGGTGATCTGG - Exonic
918109297 1:181441729-181441751 TGCTGGGTTTGCATGGGAGCTGG + Intronic
919886020 1:201935512-201935534 TGCTGGGATTACAGGTGTACAGG - Intronic
920468970 1:206210113-206210135 TGCTGGGATTGGAGCAGCGAAGG + Intronic
920920730 1:210295266-210295288 TGCTGGCTTTGCAGGAGCACTGG + Intergenic
922495903 1:226057726-226057748 TGCTGGGATTACAGGCGCAGTGG + Intergenic
922787273 1:228289237-228289259 TGGGGGGATGGCAGGTGGGCTGG + Intronic
922818955 1:228470977-228470999 TGCTGGGGCTGCAGGGGTGCCGG - Intergenic
923720144 1:236459878-236459900 TGCTGGGATTACAGGCGCACCGG + Intronic
923723279 1:236485237-236485259 TGCTGGGATTACAGGTGTGATGG - Intergenic
924072604 1:240297462-240297484 AGCTGGGATTACACGTGCCCGGG - Intronic
924605661 1:245532509-245532531 TGCTGGGATTACAGGCGTGAGGG + Intronic
924830255 1:247586892-247586914 AGCTGGGACTACAGGTGCGTGGG + Intergenic
924852827 1:247847710-247847732 TGCTAGGATTACAGGTGCTCTGG + Intergenic
1063394214 10:5671526-5671548 TGCTGGGATTACAGGCACGGTGG - Intergenic
1064127181 10:12673026-12673048 AGCTGGGATTACAGGTGCCCAGG + Intronic
1064183049 10:13135919-13135941 TACTGGGATTACAGGTGCATTGG - Intronic
1064539613 10:16392083-16392105 AGCTGGGATTACAGGCGTGCGGG - Intergenic
1065773400 10:29098236-29098258 TGCTGGGATTACAGGCGTGCTGG + Intergenic
1067203761 10:44196453-44196475 TGCAGGGAGAGCAGGTGAGCGGG + Intergenic
1068224104 10:54084215-54084237 AGCTGGGATTACAGGTTCCCTGG + Intronic
1068657914 10:59593505-59593527 TGCTGGGATGGCATGTGCTCAGG - Intergenic
1068915832 10:62430444-62430466 TGCTGGGATTACAGGCGTGATGG + Intronic
1069468378 10:68662633-68662655 TGCTGGGATTACAGGTGTGAGGG - Intronic
1069559805 10:69421441-69421463 TGGTGGGATTTCAAGTGGGCAGG + Intergenic
1069874035 10:71550758-71550780 TGCTGGATTTGCAGGTGTGGGGG + Intronic
1070079385 10:73170235-73170257 TGCTAGGATTACAGGTGTGGGGG - Intronic
1070861125 10:79663174-79663196 TGCTGAGATTACAGGCGTGCAGG + Intergenic
1071016855 10:81007552-81007574 TGCTGGGATTACAGGCGTGAGGG + Intergenic
1072548611 10:96459534-96459556 AGCTGGGATTACAGGGGTGCCGG - Intronic
1072619594 10:97070949-97070971 AGCTGGGACTACAGATGCGCTGG + Intronic
1073783195 10:106861623-106861645 TGCTTGGATTACAGGTGTGAGGG - Intronic
1073883886 10:108015588-108015610 TGCTGGGATTTCAGGTGTTCCGG + Intergenic
1074449266 10:113545940-113545962 TGCTGGGATTACAGGTGTAAAGG + Intergenic
1074787637 10:116855026-116855048 TGCTGGGATTACAGGCTAGCAGG - Intronic
1074854354 10:117462366-117462388 TACAGGGATAGCAGGTGGGCAGG - Intergenic
1075199346 10:120389178-120389200 AGCTGGGATTACAGGTGCCTGGG + Intergenic
1075223011 10:120600852-120600874 TGCTGAGATGGCAGTTGTGCTGG - Intergenic
1075710739 10:124529299-124529321 TGCTGGGATTACAGGTGTTGGGG + Intronic
1076692747 10:132232124-132232146 TGCTGGGTTGGCAGGTGCTCCGG - Intronic
1076865511 10:133164460-133164482 TGCTGGGCAGACAGGTGCGCAGG + Intronic
1076991158 11:275803-275825 TGCTTGGATTACAGGTGTGAGGG + Intergenic
1080270247 11:30443516-30443538 GGCAGGGATTGCAGGTGGGAGGG + Intronic
1080473187 11:32566066-32566088 TGCTGGGATTACAGGTGTGAGGG - Intergenic
1080757449 11:35215738-35215760 AGCTGGGATTACAGGTGCGCAGG - Intronic
1081568707 11:44276376-44276398 TGCTGGGGATGAAGGTGCCCGGG - Intronic
1083141104 11:60722600-60722622 AGCTGGGATTACAGGTTAGCTGG - Intergenic
1083374950 11:62212366-62212388 TGCTGGGATTACAGGTATGAGGG - Intronic
1083896186 11:65620923-65620945 TGCAGGGCATGCAGGTGCGCCGG + Exonic
1084080360 11:66819633-66819655 TGCTGGGATTACAGGTGTGAGGG - Intronic
1084290149 11:68159310-68159332 TGTAGGGAATGCAGGTGCGCTGG - Intronic
1084851695 11:71946842-71946864 AGCTGGGATTACAGGTGCTCTGG + Intronic
1085742449 11:79088821-79088843 TGCTGGGATTGAAGGTGACAAGG + Intronic
1086054088 11:82627389-82627411 TGATGGGATAGTAGGTGCCCTGG - Intergenic
1086116289 11:83254561-83254583 AGCTGGGATTACAAGTGTGCAGG + Intronic
1086841473 11:91690134-91690156 TGCTGAGATTACAGGTGTGAGGG - Intergenic
1089630566 11:119781667-119781689 TGCTGGGATTACAGGCGTGAGGG + Intergenic
1089750421 11:120647678-120647700 TGCTGCAACTGCAGGGGCGCAGG + Intronic
1090356686 11:126145361-126145383 CACTGGGATTACAGGTGTGCCGG + Intergenic
1090858920 11:130635663-130635685 TGCTGGGATTACAGGCATGCCGG + Intergenic
1090958877 11:131538195-131538217 TGCTGGAATTGCAGGGGAACAGG - Intronic
1091223370 11:133944004-133944026 TGCAGGCAGTGCAGGTGCCCAGG - Intronic
1091804085 12:3343556-3343578 TGCTGGGAGTCCTGGTGAGCAGG + Intergenic
1091804825 12:3348280-3348302 TGCTGGGATGGCAGAGGCCCAGG - Intergenic
1092300087 12:7239600-7239622 AGCTGGGATTACAGGTGCTCGGG + Intergenic
1092875160 12:12841557-12841579 TGCTGGGATTACAGGCGTGAGGG + Intergenic
1092974510 12:13731331-13731353 TGCTGGGATTACAGGTGTGATGG - Intronic
1093094243 12:14954243-14954265 TGCTGGGATTACAGGTGCCTGGG + Intronic
1093303140 12:17478626-17478648 TGCTGGGATTACAGGTGTTTTGG - Intergenic
1094079108 12:26512983-26513005 AGCTGGGATTACAGGTGCCCGGG + Intronic
1094770049 12:33646582-33646604 TTCTTGGATGGCAGGTGGGCAGG - Intergenic
1096056293 12:48655300-48655322 TGCTGGGATTAGAGGTGTGGTGG - Intronic
1096090778 12:48899185-48899207 AGCTGGGATTACAGGTGCAATGG - Intergenic
1096683902 12:53275194-53275216 TGCTGGGATTACATGTGTGCTGG - Intronic
1096739619 12:53682994-53683016 TGCTGGGATTACAGGAGGTCAGG + Intergenic
1096816007 12:54202205-54202227 TGCTGGGATTACAGGCGTGATGG - Intergenic
1096989460 12:55787700-55787722 TGCTGGGATTACAGGCACGGTGG + Intronic
1098785084 12:74743247-74743269 TGCTGGGATTTCTGTTGCCCAGG - Intergenic
1101748924 12:107566844-107566866 TGTTGGAATTACAGGTGTGCTGG - Intronic
1102302116 12:111778565-111778587 TGCTGGGATTACAGGTGTGAGGG - Intronic
1102491582 12:113292738-113292760 TGCTGTGATGTCAGGAGCGCAGG - Intronic
1102566412 12:113800228-113800250 TGCTGGGATTACAGGCGCTGGGG + Intergenic
1102851593 12:116251424-116251446 TGCTGGGATTACAGGCGTGAGGG + Intronic
1103423331 12:120808340-120808362 TGCTGGGATTACAGGTGAGAGGG + Intronic
1103502330 12:121412854-121412876 AGCTGGGATTACAGGTGCCTGGG + Intronic
1103634696 12:122294060-122294082 TGCTGGGATTACAGGTTTGGGGG - Intronic
1103653469 12:122451878-122451900 AGCTGGGATTACAGGTATGCGGG + Intergenic
1103902306 12:124309694-124309716 TGCTGGGATAGCAGGGGGCCTGG - Intronic
1104094206 12:125541751-125541773 TGCTGGGATTACAGGCGTGAAGG - Intronic
1104098103 12:125579491-125579513 AGCTGGGATTACAGGTGTGGTGG + Intronic
1104594721 12:130113342-130113364 TGCAGGGAGTCCAGGTGCTCTGG + Intergenic
1104673100 12:130693859-130693881 TGCCTGGAATGCAGGTGTGCTGG + Intronic
1105367339 13:19777161-19777183 TGCTGGGATTACAGGTGTACAGG - Intronic
1105390121 13:19968372-19968394 AGCTGGGACTACAGGTGCACTGG + Intronic
1105446118 13:20458967-20458989 TGCTGGGATTACAGGCGTGGTGG - Intronic
1105472528 13:20705429-20705451 TGCTGGGATTCCAGGCGTGAGGG - Intronic
1106496876 13:30286464-30286486 TGCTGGGCCTGCAAGTGCACAGG + Intronic
1108408251 13:50125168-50125190 TGCTGGGGTTGCAGATTTGCTGG + Intronic
1108769402 13:53680205-53680227 TGCTGGCAGTGCAGGAGGGCTGG + Intergenic
1109373414 13:61456027-61456049 TGCTGGGATTCCAGGTGTGATGG + Intergenic
1109876505 13:68411200-68411222 AGCTGGGATTATAGGTGTGCTGG + Intergenic
1110448010 13:75609400-75609422 TGCTGGGACTACAGGTGTGCTGG - Intergenic
1110716566 13:78711347-78711369 TGCTGGGATTACAGGCGTGTTGG + Intergenic
1110953330 13:81521776-81521798 TGCTGGGACTACAGGAGCGATGG - Intergenic
1111934176 13:94542455-94542477 TGCTGGGATTACAGGTGTAAGGG + Intergenic
1112473722 13:99711979-99712001 TGCTGGGATTACAGGCGTGAGGG + Intronic
1112510902 13:100008267-100008289 TGCTGGGATTACAGGCGTGCAGG - Intergenic
1113537473 13:111079588-111079610 TGGTGTGATTGCAGCCGCGCAGG - Intergenic
1114917135 14:27282654-27282676 TGCTGGGATTACAGGAATGCAGG + Intergenic
1115562612 14:34596798-34596820 AGCTGGGATTACAGGCACGCAGG + Intronic
1115962034 14:38845927-38845949 TGCTGGGATTACAGGCGTGAAGG - Intergenic
1117961570 14:61168425-61168447 TGCTGGCATTGCAAGTACCCAGG - Intergenic
1118258652 14:64226976-64226998 GGCTGGGAATCCAGGTGCGGTGG - Intronic
1119333149 14:73810398-73810420 TGCTGGGATTGCAGGCGTGAAGG + Intergenic
1119789105 14:77333152-77333174 TACTGGGATTACAGGCGCGTTGG + Intergenic
1120147059 14:80990233-80990255 TGCTGGGTTTCCAGGTTCGCTGG - Intronic
1120989028 14:90358781-90358803 TGCTGGTAATGCAGGTGCAGTGG - Intergenic
1121544551 14:94753899-94753921 TGCTGGGATTACAGGTGTGAAGG - Intergenic
1122155309 14:99747054-99747076 AGCTGGGACTACAGGTGCCCGGG - Intronic
1122286503 14:100655541-100655563 TGCTGGGACTGGAGCTGGGCAGG + Intergenic
1123676403 15:22714510-22714532 TGCTGGGCCTGCAGGGGCGCGGG + Intergenic
1123721510 15:23065513-23065535 TGCTGGGATTACAGGAGTGATGG + Intergenic
1123804749 15:23859765-23859787 AGCTGGGATTACAGGTGCACCGG - Intergenic
1124180683 15:27470497-27470519 TGCTAGGATTACAGGTGTGAGGG + Intronic
1124253545 15:28122779-28122801 TGCTGGGGCTGCAGGAGAGCAGG - Intronic
1124328618 15:28788771-28788793 TGCTGGGCCTGCAGGGGCGCGGG + Intergenic
1124706988 15:31974515-31974537 TGGTGGAATTGCAGGGGCTCAGG + Intergenic
1124882868 15:33658550-33658572 TGAGGGGATGGCAGGTGTGCTGG - Intronic
1124907728 15:33886911-33886933 TGATGGGATAGCAGGAGCTCTGG - Intronic
1125362308 15:38877001-38877023 TGCTGGGTTTCAAGGTGGGCTGG + Intergenic
1125663073 15:41409387-41409409 AGCTGGGATTACAGGTGCCCTGG - Intronic
1125801593 15:42452950-42452972 TGCTGGGATTACAGGGGTACAGG + Intronic
1125887238 15:43238102-43238124 TGCTGGGAGTGCTGGTGAGTGGG - Intronic
1126864345 15:52921140-52921162 GGCTGGGAAGGCAGGTGCTCTGG - Intergenic
1127256940 15:57300553-57300575 TGCTGGGATTACAGGCGTGATGG + Intergenic
1127339044 15:58021869-58021891 TGCTGGAATTGGTGGTGAGCTGG + Intronic
1127586563 15:60383393-60383415 TGCTGGGATTACAGGCGTGGTGG + Intronic
1128040942 15:64572767-64572789 AGCTGGGATTACAGGTATGCAGG - Intronic
1128484937 15:68075912-68075934 AGCTGGGATTACAGGTGCCCAGG + Intronic
1128641512 15:69341676-69341698 TACTGGGATTACAGGTGCGACGG - Intronic
1129524235 15:76203995-76204017 TGCTGGGATGGCAGCGGCGGGGG - Exonic
1130557257 15:84931378-84931400 TGCTGGGATTACAGGTGTTTTGG - Intronic
1131109437 15:89755942-89755964 TGCTGGGATTCCAGTTTTGCTGG + Intergenic
1131740116 15:95380280-95380302 AGCTAGGACTGCAGGTGCGTCGG - Intergenic
1133339085 16:5025284-5025306 TGCTAGGGTTGCAGGTGCCCTGG + Exonic
1133791205 16:9010592-9010614 TGCTGGGATTGCAGGTGTGAGGG + Intergenic
1133840477 16:9403469-9403491 TGCTGGGATGACAGCTGCTCAGG - Intergenic
1134024300 16:10942405-10942427 TGCTGGGCCTGCGGGGGCGCGGG - Exonic
1135829728 16:25762599-25762621 TGCTGGGACTGCAGGTGTGCTGG - Intronic
1135970496 16:27068657-27068679 AGTTGGGATTACAGGTGCCCAGG - Intergenic
1136361407 16:29782316-29782338 TCCTGGGATTACAAGTGTGCTGG - Exonic
1137766481 16:50981413-50981435 TGCTGGGATTACAGGTGTGATGG - Intergenic
1139618957 16:68121413-68121435 TGCTGGGATTACAGGTGTGAGGG - Intronic
1139625453 16:68185117-68185139 AGCTGGGATTACAGGTACCCTGG + Intronic
1139702740 16:68718974-68718996 TGCTGGGATTACAGGCGTGAGGG - Intronic
1139870498 16:70104689-70104711 AGATGGGATTACAGGTGCGGTGG - Intergenic
1140384949 16:74527856-74527878 AGATGGGATTACAGGTGCGGTGG + Intronic
1141129557 16:81426337-81426359 AGCTGGGATTACAGGTGCCCTGG - Intergenic
1141431665 16:83973358-83973380 TGGTGGGAGGGCAGGTGCACAGG + Intronic
1141986594 16:87584360-87584382 TGCTGTGAACGCGGGTGCGCAGG - Intergenic
1142708575 17:1710881-1710903 TGCTGGAATTACAGGTTTGCCGG - Intergenic
1143142503 17:4749312-4749334 TGCTGGGATTACAGGCGTGATGG - Intergenic
1143224266 17:5287271-5287293 TGCTGGGATTACAGGCGAGGTGG + Intronic
1143475948 17:7204050-7204072 TGCTGGAGTTGCAGGTGAACGGG - Exonic
1145212766 17:21027138-21027160 TGCTGGGATTCCAGGTGTCGTGG + Intronic
1145235100 17:21202571-21202593 AGCTGGGCTTGCAGGGGGGCCGG - Intronic
1147057641 17:37846532-37846554 TGGTGGGATTGCACGAGCCCAGG - Intergenic
1147391451 17:40111852-40111874 AGCTGGAATTGCAGTTGTGCTGG + Intergenic
1147473124 17:40683119-40683141 AGCTGGGATTACAGGTGTACTGG - Intergenic
1147499471 17:40948897-40948919 AGCTGGGATTACAGGTGTGCAGG - Intergenic
1148653751 17:49268109-49268131 TGGTGGGATGGCAGGAGAGCAGG - Intergenic
1148870289 17:50655139-50655161 TGCTGGGATTACAGGCGTGACGG - Intronic
1149036579 17:52141116-52141138 TGCTGGGATGGCAGTTCGGCAGG - Intronic
1149764316 17:59262184-59262206 TGCTGGGATTACAGGCGTACAGG + Intronic
1150493657 17:65591540-65591562 TGCTGGGATTACAGGTGTGAGGG - Intronic
1150580995 17:66473666-66473688 TGCTGGGATTACAGGGGTGTTGG - Intronic
1150942148 17:69704388-69704410 TGCTGGGATTACAGGTGGCATGG + Intergenic
1151197478 17:72441800-72441822 TGTTGGGCTAGCAGGTGTGCAGG - Intergenic
1151225070 17:72641648-72641670 TGCTGGGATTACAGATGCGCCGG + Intergenic
1151244644 17:72784989-72785011 AGCTGGGATTACAGGTACGCAGG + Intronic
1151610401 17:75170043-75170065 AGCTGGGATTACAGGCGTGCAGG - Intergenic
1151639665 17:75381956-75381978 TGCTGGGATTACAGGAACCCAGG - Intronic
1151706754 17:75773325-75773347 TGCTGGCACTGCAGCTGCCCAGG + Intergenic
1152075453 17:78156877-78156899 TGCTGGGATTCCAGGCGCAGTGG + Intronic
1152145076 17:78563521-78563543 TGTTGGGATTACAGGTGTGTCGG - Intronic
1152479207 17:80538656-80538678 AGCTGGGAGAGCAGGTGCCCAGG - Intergenic
1152527493 17:80896992-80897014 TGCTGGGATTACAGGCGTGAGGG - Intronic
1154293065 18:13127418-13127440 TGCTGGGGATGCGGGTGAGCAGG - Intergenic
1155454633 18:25998041-25998063 TGCTGGGATTACAGGCGCGAGGG + Intergenic
1156097535 18:33552943-33552965 AGCTGGGATTACAGGTGTGTAGG - Intergenic
1156140153 18:34099094-34099116 TGCTGGGATTACAGGTGTGAGGG - Intronic
1157564153 18:48668475-48668497 TGCTGGGGCTACAGGTGAGCAGG - Intronic
1157660485 18:49437927-49437949 TGCTGGGATTACAGGTGTACAGG - Intronic
1157708423 18:49829208-49829230 AGCTGGGATTACAGGTGTGTGGG + Intronic
1159692768 18:71510561-71510583 TGCTGGGAGTGCTGGAGTGCTGG + Intergenic
1159990893 18:74906077-74906099 TGCTGGGAATGCAGGTATGGTGG - Intronic
1160908427 19:1463007-1463029 TGCTGGGATTCCAGGTGTGAGGG - Intronic
1160913122 19:1483867-1483889 TCCTCGGCCTGCAGGTGCGCCGG + Exonic
1160992390 19:1865011-1865033 AGCTGGGGTTGCAGGTGGGCGGG - Intergenic
1161439962 19:4285354-4285376 TGCTGGGGTGGCACGTGAGCCGG + Intronic
1161828388 19:6585116-6585138 AGCTGGGATTACAGGCGCCCTGG + Intronic
1162179128 19:8855309-8855331 TGCTGGGATTACAGGCAGGCAGG - Intronic
1162356790 19:10190844-10190866 TGCTGGGATTACAGGTATGATGG - Intronic
1162489062 19:10981016-10981038 TGCTGGGATTACAGGCGTGCTGG + Intronic
1162617187 19:11811618-11811640 TGCTGGGATTACAGGTTCTGAGG - Intergenic
1162899867 19:13788356-13788378 TGCTGGGATTACAGGTGTGAGGG - Intergenic
1163463969 19:17455565-17455587 TGCTGGGATTACAGGCGTGCGGG + Exonic
1163516616 19:17768198-17768220 AGTTGGGATTACAGGTGTGCTGG + Intronic
1163676272 19:18656782-18656804 TGCTGGGAGGGCAGGCGTGCTGG - Intronic
1164062173 19:21684971-21684993 AGCTGGGATTACAGGTGTGTGGG + Intergenic
1164893406 19:31845625-31845647 AGCTAGGATTACAGGTGCACAGG - Intergenic
1165385320 19:35507072-35507094 TGCTGGGATTACAGTTATGCTGG + Intronic
1165492507 19:36132817-36132839 TGCTGGGATTACAGGCGTGAGGG - Intergenic
1165579150 19:36847481-36847503 TGCTGGGATTACAGGCGTGAAGG - Intronic
1165947617 19:39453829-39453851 TGCTGGGATTACAGGCGTGAAGG + Intronic
1166684949 19:44790841-44790863 TGCTGGGATTATGGGTGCGGTGG - Intronic
1167201003 19:48065347-48065369 TGCTGGGATTATAGGTGCACAGG - Intronic
1167341977 19:48921765-48921787 TGCTGGCATTGCAAGTGCTCAGG - Intronic
1167784165 19:51623908-51623930 TGCTGGGATTATAGGTGTGACGG - Intronic
1168099882 19:54135520-54135542 TGCTGGGATTACAGGTGCAATGG + Intergenic
1168244745 19:55106550-55106572 TGCTGGAATTCCAAGTGAGCTGG + Intronic
1202698309 1_KI270712v1_random:142126-142148 ACCTGGGATTACAGGTGTGCTGG - Intergenic
925748006 2:7060800-7060822 TGCAGGGGTTGCAGGGGCGATGG - Intronic
926187339 2:10701313-10701335 TGCTGTGATTGCAGTTACCCCGG + Intergenic
927577305 2:24210342-24210364 TGCTGGGATTGCAGGCATGAAGG - Intronic
927723093 2:25399608-25399630 TGCTGTGATTACAGGAGTGCTGG + Intronic
927873968 2:26642123-26642145 AGCTGGGACTACAGGTGTGCTGG - Intergenic
928018807 2:27684294-27684316 AGCTGGGGTTATAGGTGCGCAGG - Intronic
928090491 2:28370845-28370867 TGCTGGCATTGGAGGTGAGGTGG - Intergenic
928137679 2:28700530-28700552 TGCTGGGATTTCAGGTGACGTGG - Intergenic
928551162 2:32372069-32372091 TGCTGGGATTACAGGTGTGAAGG + Intronic
929296419 2:40252598-40252620 TGCTGGGATGACAGGTGCACAGG + Intronic
931340069 2:61392355-61392377 TGCTGGGATTACAGGCTTGCAGG - Intronic
934031165 2:88048346-88048368 TGCTGGGATTACAGGTGTATTGG + Intronic
934279559 2:91599908-91599930 ACCTGGGATTACAGGTGTGCTGG - Intergenic
934711981 2:96522375-96522397 TGCTGGGTGTGCAGGAGCTCAGG + Intergenic
937121043 2:119440125-119440147 TGCTGGTCCTGCAGGTGCCCTGG + Exonic
937182657 2:120010531-120010553 TGCTGGGATTACAGGTGTCCAGG + Intergenic
937237822 2:120441481-120441503 TGCTGGGACTGCGGGAGCCCCGG + Intergenic
937294153 2:120799612-120799634 GGATGGGATGGGAGGTGCGCTGG + Intronic
937566420 2:123295262-123295284 TGCTGGGATTACAGGTGTGAGGG - Intergenic
940462101 2:153978190-153978212 TGCTAGGATTGCAGGTCCTCAGG + Intronic
944439891 2:199731620-199731642 TGCTGGGATTACAGGCGTGAGGG - Intergenic
944567211 2:201003442-201003464 TGCTGGGATTACAAGTGCAGTGG - Intronic
944762889 2:202835470-202835492 TGCTGGGATTACAGGCGTGAGGG + Intronic
945048977 2:205805831-205805853 TGCTGGGCTTGGAGCTGCTCTGG + Intergenic
946672670 2:222122966-222122988 TGCTGGGATTACAGGTAGGAGGG - Intergenic
946920951 2:224581775-224581797 TGCTAGGATTACAGGTGTGAAGG + Intronic
947630557 2:231649891-231649913 TGCTGGGATGACAGGTGTGAGGG + Intergenic
948084351 2:235234315-235234337 TGCTGGGGTTACAGGTAAGCAGG - Intergenic
1170222209 20:13952762-13952784 TGCTGGGATTACAGGCGTCCAGG - Intronic
1170437869 20:16349250-16349272 TGGTGGGCTAGCAGGTGGGCCGG - Intronic
1170671556 20:18439096-18439118 AGCTGGGACTTTAGGTGCGCAGG - Intronic
1170929367 20:20755014-20755036 TGCTGGGATTACAGGCGTGATGG - Intergenic
1171471330 20:25374190-25374212 TGCTAGGATTACAGGTGTGCTGG + Intronic
1171472049 20:25379954-25379976 TGCTAGGATTACAGGTATGCTGG + Intronic
1172248771 20:33464326-33464348 TGCAGGGATTACAGGTATGCGGG - Intergenic
1172424041 20:34842994-34843016 TGCTGGGATTACAGGCGTGAAGG + Intergenic
1172952357 20:38730251-38730273 AGCTGGGAGTGCAAGTCCGCTGG + Intergenic
1173060676 20:39657099-39657121 TGCTGGGATTACAGATGTGTGGG + Intergenic
1173256518 20:41397731-41397753 TGCTGGGATTACAGGTGTGAGGG + Intergenic
1173516436 20:43667934-43667956 AGCTGGGGTTGAAGGTGCGGGGG + Intronic
1174251118 20:49220377-49220399 TGTTTGGACTGCAGGTGTGCTGG - Intronic
1174290721 20:49506642-49506664 TGCTGGGATTACAGGCAAGCCGG + Exonic
1174679401 20:52390695-52390717 TGCTGGGATTACAGGTGTGAAGG + Intergenic
1175206570 20:57316151-57316173 TGCGGGAACAGCAGGTGCGCAGG + Intergenic
1176008149 20:62877281-62877303 TGCTGAGGATGCAGGTGGGCAGG - Intergenic
1176026126 20:62986482-62986504 TGCAGGGGGTGCAGGTGGGCGGG + Intergenic
1176072289 20:63233687-63233709 TGCTGGGTTTGGAGGTGCACAGG + Intergenic
1176137442 20:63530416-63530438 CCCTGGGATTGCAGGTGTGTGGG + Intronic
1176905355 21:14493876-14493898 TGCTGGGATTGCAGAACCCCAGG + Intronic
1177015430 21:15781891-15781913 TGCTTGGATTGCAGGGGTGCAGG - Intronic
1177574106 21:22928528-22928550 TGCTGGGATTACAGGCGTGAAGG - Intergenic
1177842734 21:26252719-26252741 TGCTGGGATTACAGGTGTAAAGG - Intergenic
1178335527 21:31739380-31739402 AGCTGGGATTACAGGTGCACAGG - Intergenic
1178459527 21:32790085-32790107 TGCTGGGAATGCAGGCCAGCAGG + Intergenic
1179006512 21:37520009-37520031 TGCTGGGATTACAGGTGTGAGGG + Intergenic
1179586949 21:42379427-42379449 TGCTGGGACTACAGGTGTGAGGG + Intronic
1179980186 21:44891582-44891604 GGCTGGCATTGCTGGTGCCCTGG + Intronic
1180014851 21:45075085-45075107 CGCGGGGAGGGCAGGTGCGCCGG + Intronic
1181527314 22:23497409-23497431 TGCTGGGACTGCAAGAGCCCCGG - Intergenic
1181597527 22:23926260-23926282 TGCTAGGATGACAGGTGCGGTGG - Intergenic
1181754027 22:25010118-25010140 TGATGGGATTGCAGGCGGGCAGG - Intronic
1183287990 22:36979829-36979851 TGCTGGGATTACAGGTGTGAGGG - Intergenic
1183311594 22:37112708-37112730 TGCTGGGATTACAGGTGTGGGGG - Intergenic
1183429721 22:37758177-37758199 TGCAGGGACTGGAGGGGCGCTGG - Intronic
1183715936 22:39533650-39533672 TGCTGGGATTACAGGAGTGAGGG + Intergenic
1183907692 22:41054679-41054701 AGCTGGGATTGCAGGCCAGCAGG + Intergenic
1184628204 22:45754584-45754606 TGCTGGGATTACAGGCTTGCGGG - Intronic
1184888806 22:47367182-47367204 TGGTGGGATTGAAGCTGCCCTGG - Intergenic
1185093649 22:48792594-48792616 TGCTGGGATTACAGGCGTGATGG + Intronic
1185394270 22:50578713-50578735 TTCTGGGATCGCTGGTGCTCCGG + Intronic
949553346 3:5130984-5131006 TGCTGGGAGTGCAGTGGCACGGG + Intronic
949856233 3:8463845-8463867 TGCTGGGATTACAGGTGTGAGGG + Intergenic
950069947 3:10143711-10143733 TGCTGGGATTACAGGCGTGCTGG + Intronic
950070845 3:10151144-10151166 TGGTGGGATTACAGGTGTGTGGG + Exonic
950766189 3:15274810-15274832 TGCTGGGATTACAGGGTTGCAGG + Intronic
952660554 3:35841403-35841425 TATTGGGATTCCAGGTGGGCAGG + Intergenic
953282479 3:41572492-41572514 TGCTGGGATTACAGGCGTGTGGG - Intronic
953334866 3:42086099-42086121 TGATGTGTGTGCAGGTGCGCTGG + Intronic
953665527 3:44923340-44923362 TGCTGGGATTACAGGCGTGAGGG + Intronic
954664179 3:52242658-52242680 TGCTAGGATTACAGGCGTGCTGG - Intergenic
954664184 3:52242692-52242714 TGCTGGGATTACAGGCGTGCTGG - Intergenic
954708607 3:52494043-52494065 TGATGGGAGTGGAGGTGTGCTGG + Intergenic
954820552 3:53322937-53322959 AGCTGGGATTACAGGCGCCCGGG + Intronic
955187730 3:56731262-56731284 TGCTGGGATTACAGGCCCCCGGG - Intronic
956236299 3:67075493-67075515 TGCTGGGGATCCAGGTGTGCAGG - Intergenic
956318907 3:67973053-67973075 TGCTAGGATTACAGGTTCACAGG + Intergenic
956679758 3:71767670-71767692 AGCTGGGATTACAGGTGTGCTGG - Intergenic
956796383 3:72722287-72722309 TGCTGGGATTACAGGTGGCATGG - Intergenic
961851099 3:129819347-129819369 TGCTGGGATTACAGGTGTGAAGG + Intronic
961858650 3:129896401-129896423 TGCTGGGATTACAGGGTCCCTGG - Intergenic
961933102 3:130554615-130554637 TGCTGGCATTGGAGGTGTGGTGG + Intergenic
966890423 3:184403708-184403730 AGCTGGGACTACAGGTGCACAGG + Intronic
967657933 3:192073525-192073547 TGCTGGGATGACAGGTGCAAAGG + Intergenic
967918130 3:194594293-194594315 AGCTGGGATTACAGGCGCCCAGG + Intronic
968236131 3:197030745-197030767 TGCTGGAAATGCAAGTGCTCAGG + Intergenic
968410839 4:388259-388281 TGCTGGGACTACAGGCGCCCAGG + Intergenic
968482800 4:844067-844089 TGCTGGGATTACAGGATTGCAGG - Intergenic
968737365 4:2304362-2304384 GGCTGGGGTTGCAGGTCAGCAGG - Exonic
968822594 4:2866802-2866824 TATTGGGATTACAGGTGTGCTGG - Intronic
969084492 4:4645814-4645836 TGCTGGCATAGAAGGTGCTCAGG - Intergenic
969375099 4:6758035-6758057 TGCTGGGATTACAGGCATGCTGG - Intergenic
969487524 4:7480631-7480653 AACTGGGATGGCAGGTGCCCCGG + Intronic
969941741 4:10739045-10739067 TGTTTGGATTGTAGGTGCTCTGG + Intergenic
971643578 4:29166659-29166681 TGCTGGGATAGCTGCTGGGCTGG - Intergenic
972264377 4:37444907-37444929 TGCTGGGGTTACAGGTAGGCAGG - Exonic
972422980 4:38906799-38906821 TGCTGAGATTACAGGTGTGAAGG + Intronic
972617688 4:40715816-40715838 TGCAGGGATTACAGGCGTGCAGG + Intergenic
973896461 4:55418778-55418800 TGCTGGGATTACAGGCGTGAGGG - Intronic
974573328 4:63684334-63684356 AGCTGGGACTGCAGGCGCCCGGG - Intergenic
974974554 4:68874141-68874163 TGCTGGGATGGCATGTGCCCTGG - Intergenic
975779098 4:77820060-77820082 TGCGGGGGTTGCCGCTGCGCCGG + Intergenic
976452182 4:85203134-85203156 TGCTGGGATTACAGGTGTGAGGG - Intergenic
976919036 4:90413687-90413709 TGCTGGGATTACAGGCGTGAGGG - Intronic
977568519 4:98607039-98607061 TGCTGGGATGGCAGGTCCCCCGG - Intronic
977769902 4:100846096-100846118 TGCTGGGATTACAGGCGTGAGGG - Intronic
978471226 4:109069988-109070010 TGCTGGGATTACAGGTGAGAGGG - Intronic
978866852 4:113523504-113523526 TGCTGGGATTGAAAGTGTGTGGG - Intronic
979644371 4:123050999-123051021 TGCTGGGATTACAGGTGTGAGGG + Intronic
981240548 4:142471754-142471776 GGCTTGGATTGCGGGTGCTCAGG - Intronic
981240552 4:142471775-142471797 GGCTTGGATTGCGGGTGCTCAGG - Intronic
981891909 4:149748200-149748222 TGCTGGGGTTGAAGGTGGGTGGG - Intergenic
982008532 4:151085298-151085320 AGCTGGGATTACAGGTGCATGGG + Intergenic
982239296 4:153282711-153282733 TGCTGGGATTACAGGTGTTAAGG + Intronic
983045761 4:162984813-162984835 TGCTGTGGTTGCAGGAGCGTGGG - Intergenic
983143895 4:164188623-164188645 TCTTGGGATTGGAGGTGAGCTGG - Intronic
983331604 4:166335788-166335810 TTCTGGGATTGCAGATGTGCTGG - Intergenic
983622193 4:169773406-169773428 TGCTGGGATCACAGGTGTGAGGG + Intergenic
984969092 4:185170526-185170548 AGCTGGGATTACAGGAGCCCTGG + Intronic
985182683 4:187282107-187282129 TGCTGGGATTAGAGGTGTGAGGG - Intergenic
985313835 4:188632721-188632743 AGCTGGGATTACAGGTGCCCAGG - Intergenic
985595445 5:785611-785633 TGCTGGGACTTCAGGGGCACAGG + Intergenic
985681960 5:1260465-1260487 TTCTGGATTTGCAGGTGAGCAGG - Exonic
985879932 5:2630826-2630848 ACCTGGGACTGCAGGTGCACTGG + Intergenic
986624101 5:9707286-9707308 TCCTGGGGTTGGAGGTGTGCTGG - Intronic
987863896 5:23516870-23516892 TGCTAGGATTACAGGTGTGGTGG - Intronic
989366958 5:40666751-40666773 TGTTGGGATTACAGGTGTACAGG + Intergenic
989443017 5:41494225-41494247 AGCTGGGACTGCAGGTGTGGAGG + Intronic
990319620 5:54616953-54616975 TGATGTGATTGCAGGGGCCCTGG - Intergenic
991056952 5:62331433-62331455 TTCTGGGATTGCAGGCACGGTGG + Intronic
992665962 5:79009624-79009646 TGCTGGGATTACAGGTTTACAGG + Intronic
992753348 5:79881537-79881559 TGCTGGGATTACAGGTGTGAGGG - Intergenic
993114162 5:83699927-83699949 TGCTGAGATTACAGGTGTGAAGG - Intronic
993486668 5:88495494-88495516 TGCTGGGATCACAGGTGTGAGGG + Intergenic
994664697 5:102693183-102693205 TGCTGGGATTACAGGCGTGGTGG + Intergenic
996043365 5:118842664-118842686 TGCTGGGATTACAGATGTGGGGG - Intronic
996193987 5:120580719-120580741 TGCTGGGATTACAGGAGTGAGGG + Intronic
996231687 5:121071376-121071398 AGCTGGGACTTCAGGTGGGCAGG - Intergenic
997022365 5:130016541-130016563 AGCTGAGATTACAGGTGCCCGGG + Intronic
997051526 5:130386805-130386827 TGCTGGGATTACAGGCGTACAGG - Intergenic
997914397 5:137909956-137909978 TGCTGGGATTATAGGTGCCATGG - Intronic
998220520 5:140274859-140274881 AGCTGGGATTACAGGTGCCTGGG - Intronic
998318193 5:141202876-141202898 TGCTGGGATTACAGGCGGCCAGG + Exonic
999057055 5:148588804-148588826 TGCTGGGATTACAGGCGTGAGGG + Intronic
999758571 5:154683016-154683038 TGCTGGGAGAGCAGGCGAGCAGG + Intergenic
999770887 5:154774649-154774671 TGCTGGGCTTGTAGTTGCTCTGG + Intronic
1000900197 5:166903550-166903572 TGCTGGGATTACAGGTGTGACGG - Intergenic
1001333722 5:170781026-170781048 AGCTGGGATTGCAGGTGAGAAGG + Intronic
1001519433 5:172380325-172380347 TGCTGGGATTACAGGCGTGAGGG + Intronic
1001632651 5:173187497-173187519 AGCTTGCATTGCAGGTGCCCAGG + Intergenic
1001952739 5:175827486-175827508 TGCTGGGATTACAGGCGTGAGGG - Intronic
1004179291 6:13366760-13366782 TGCTGGGATTACAGGTGTCCTGG + Intronic
1005919985 6:30392708-30392730 TGCTGGGATTACAGGGGTGAGGG + Intergenic
1006763386 6:36483476-36483498 TGCTGGGATTGCAGGCACCATGG + Intronic
1007055491 6:38879974-38879996 GGCTGGGATTACAGGTGTGAAGG - Intronic
1007111000 6:39313569-39313591 AGCTGGGACGGCAGGGGCGCCGG - Intronic
1007475771 6:42118964-42118986 TGCTGGGATTACAGGAGCTCAGG - Intronic
1007687050 6:43673252-43673274 TGCTGGGATTACAGGTGTGAGGG + Intronic
1007796080 6:44348862-44348884 TGCTGGGATTACAGGCGCAGTGG - Intronic
1007870241 6:45027255-45027277 TGCTGGGATTACAGGCACGTAGG + Intronic
1009605111 6:65857418-65857440 TGTTGAGCTTGCAGGTGTGCAGG - Intergenic
1009980979 6:70725380-70725402 TGCTGGGATTACAGGCGTGAGGG + Intronic
1010744419 6:79544576-79544598 TGCTGGATTTGGAGGTGTGCTGG - Intergenic
1013270015 6:108536648-108536670 TGCTGGGATTACAGGGAGGCAGG + Intergenic
1016104952 6:140149903-140149925 TGCTGGGATTACAGGCGTTCAGG + Intergenic
1016276453 6:142358937-142358959 TGCTGGGATTACAGGCATGCAGG - Intronic
1016282868 6:142439056-142439078 TGGTGGGATTGCTTGTGCCCTGG + Intronic
1016796097 6:148119124-148119146 TGCTGGGATTACAGGCGTGAGGG + Intergenic
1017520823 6:155200636-155200658 TGCTGGGATTACAGGCGTGAGGG - Intronic
1017664395 6:156705496-156705518 TGTTGGGATTGCAGGCGTACAGG + Intergenic
1018812735 6:167309092-167309114 AGCTGGGATTACAGGTGCAACGG - Intronic
1019500748 7:1363554-1363576 TGCTGGGATTACAGGTATGAGGG - Intergenic
1020005181 7:4780045-4780067 TGCTGGGATTACAGGTGGCCTGG + Intronic
1021590725 7:22258490-22258512 AGCTGGGATTGCAGGCATGCAGG - Intronic
1021696805 7:23283876-23283898 TGCTGGGATTACAGGCACCCAGG + Intergenic
1021719107 7:23489384-23489406 TGCTGGGATTACAGGAGCCACGG - Intergenic
1021749382 7:23779856-23779878 TGCTGGCATTCCAGGTGCAAGGG + Intronic
1022079930 7:27009568-27009590 TGCTAGGATTACAGGTGAGATGG + Intergenic
1022531697 7:31070826-31070848 TGCTGGAAATGCAGATGCTCAGG - Intronic
1023950009 7:44836465-44836487 TGCTGGGATTACAGGTGTACTGG + Intronic
1024612040 7:51074458-51074480 TGCTGGGATTACAGGCGTGAAGG + Intronic
1024646031 7:51371138-51371160 TGCTGGGATTACAGGCGTGATGG + Intergenic
1024685180 7:51736929-51736951 TGCTGGGATGGCAGAGGCACTGG - Intergenic
1025036881 7:55598991-55599013 TGCTGGGATTACAGGTGTGATGG + Intergenic
1025998372 7:66542851-66542873 GGCTGGGATTGCAGGAAGGCTGG - Intergenic
1026149879 7:67778842-67778864 TGCTGGGATTACAGGCGTGAAGG + Intergenic
1026203875 7:68238657-68238679 TGCTGGGATTGCAGGCCAGGCGG - Intergenic
1026767013 7:73166541-73166563 TGCTGGGATTACAGGCGTGCTGG - Intergenic
1026904156 7:74053281-74053303 TGCTGGGATCCCAGGTGCTGCGG + Exonic
1026904160 7:74053296-74053318 TGCTGCGGTTCCAGGTGAGCTGG + Exonic
1027043498 7:74976277-74976299 TGCTGGGATTACAGGCGTGCTGG - Intronic
1027080148 7:75226082-75226104 TGCTGGGATTACAGGCGTGCTGG + Intergenic
1028114916 7:86986161-86986183 TGCTGGGATTACAGGCGTGAGGG - Intronic
1028753926 7:94413115-94413137 TGCTGGTCTTGCTGGTGCTCGGG + Exonic
1028856150 7:95596390-95596412 GGCGAGGACTGCAGGTGCGCTGG + Exonic
1029300444 7:99578795-99578817 TGCTGGGATTACAGGTGTGAGGG + Intronic
1029389353 7:100264672-100264694 TGCTGGGATTACAGGCTTGCTGG + Intronic
1029474283 7:100773798-100773820 GGTTGGGTTTGCAGGTGCTCTGG - Exonic
1030437148 7:109537031-109537053 TGCTGGGATTACAGATGTGGTGG + Intergenic
1031398794 7:121306030-121306052 TGCTGAGATTACAGGTGTGTGGG + Intergenic
1031462153 7:122064666-122064688 AGCTGGGACAACAGGTGCGCGGG + Intergenic
1033195050 7:139320568-139320590 TGCTGGGATTGTAGTTGCAGTGG + Intergenic
1033286157 7:140042350-140042372 AGCTGGGCTTTCAGGTGGGCAGG + Intronic
1033305835 7:140224768-140224790 TGCTGGAATTACAGGTGTGCTGG - Intergenic
1033401036 7:141025697-141025719 TGCTGGGATTACAGGTGTGAAGG + Intergenic
1034090737 7:148361941-148361963 TGCTGGGATTACAGGCGTGCTGG - Intronic
1034250598 7:149687512-149687534 TCCTGGGATTGCAGCTCAGCAGG + Intergenic
1035086188 7:156260338-156260360 TGCAGGGAGTGCAGGGGCCCAGG - Intergenic
1035545431 8:478740-478762 TGCTGGGATTACAGGTGTGAGGG - Intergenic
1035640564 8:1181877-1181899 TCCTGGGATTGCAGGGACGATGG - Intergenic
1036138288 8:6182015-6182037 TGCTGGGATTACAGGCGTGAAGG + Intergenic
1036432110 8:8701618-8701640 CCCGGGGATTGGAGGTGCGCTGG - Intergenic
1036825623 8:11973670-11973692 TGTTGGGATTACAGGCGGGCAGG + Intergenic
1037079167 8:14761789-14761811 TGCTGGGATTACAGGTGTGAAGG + Intronic
1037355834 8:18018544-18018566 TGCTGGGATTAAAGGTGTGATGG - Intronic
1037492856 8:19412203-19412225 TGCTGGGATCTCAGGTGGGGAGG - Intronic
1037550183 8:19963167-19963189 TGCTGGGATTGCAGGCATGAAGG - Intronic
1037724034 8:21468342-21468364 GGCTGGGCTGGCAGGTGAGCAGG - Intergenic
1038620779 8:29141065-29141087 TGCTGGGATTATAGGTGTGAGGG - Intronic
1038797786 8:30725120-30725142 TGCTGGGATTGGGGGTGGGTAGG - Intronic
1039304247 8:36243896-36243918 TGCTGGGATTACAGGTGTACAGG - Intergenic
1039750481 8:40473917-40473939 TGCTGGCATAGCTGGTGCGTAGG - Intergenic
1039841871 8:41299532-41299554 TGCTGGGATTGCAGGCATGATGG - Intronic
1040072128 8:43196808-43196830 TGCTGGGATTACAGGGAGGCGGG - Intronic
1040464825 8:47684950-47684972 TGCTGGGATTACAGGTGTAATGG - Intronic
1040558669 8:48504246-48504268 AGCCGGGCTTGCAGGTGCGCCGG - Intergenic
1041914924 8:63129243-63129265 TGCTGGGATTACAGGTGTGAGGG - Intergenic
1042033085 8:64499051-64499073 TGCTGGGATTACAGGCGTGAGGG - Intergenic
1042333996 8:67611348-67611370 TGCTGGGATTACAGGTGTGAGGG + Intronic
1042839282 8:73107622-73107644 GGCTGGGACTACAGATGCGCAGG + Intronic
1044476539 8:92633220-92633242 TGCTGGGATGGTAGGTGGGGTGG - Intergenic
1045165926 8:99604754-99604776 TGCTGGGATTACAGGTTCCTTGG + Intronic
1045484886 8:102623066-102623088 TGCTGGGATTACAGGTGTTGTGG + Intergenic
1046526899 8:115392287-115392309 TGCTGGGATTGCAGGCATGAAGG + Intergenic
1047686366 8:127308662-127308684 TGCTGGGATTACAGGTGCTACGG - Intergenic
1048378084 8:133839806-133839828 TGCTAGGATTACAGGTGTGAAGG + Intergenic
1048980047 8:139698342-139698364 TGCTGGCCCTGCAGGTGCACGGG + Intronic
1049312007 8:141938302-141938324 TGGTGGGATTTCACGTGCACAGG - Intergenic
1049677447 8:143897740-143897762 TGCTGGGATTACAGGCGTGGTGG + Intergenic
1049980247 9:897380-897402 TGCTGGGATTACAGGCGTGAGGG + Intronic
1049982129 9:913976-913998 TGCTGATATTGCTGGTGCCCAGG - Intronic
1050565054 9:6873250-6873272 GCCTGGGATTACAGGTGTGCTGG + Intronic
1051234021 9:14979732-14979754 TGCTGGGATTACGGGTGTGAGGG - Intergenic
1051646997 9:19279062-19279084 TGCTGGGATTACAGGTTAGCTGG - Intronic
1052304211 9:26987233-26987255 AGCTGGGATTACAGGTGCCTGGG + Intronic
1052588307 9:30457445-30457467 TGCTGGGATTACAGGCGTGAGGG + Intergenic
1053142867 9:35691796-35691818 AGCTGGGATTACAGGCGTGCGGG + Intergenic
1054902954 9:70388871-70388893 TGCTGGGATTACAGGCGTGAGGG - Intronic
1056279712 9:85029288-85029310 TGCTGGGATTACAGGTGTGATGG + Intergenic
1056505044 9:87250513-87250535 TCCTGGGCTTGCATGTGGGCAGG - Intergenic
1056663126 9:88559210-88559232 TGTTGGGATGGCATGTGCTCAGG + Intronic
1057165638 9:92923301-92923323 TGCTGGGATTGCAGGAATGTTGG + Intergenic
1057247736 9:93471991-93472013 TGCTGGGATTACAGGCGTGGGGG - Intronic
1057879132 9:98780060-98780082 TGCAGGGGTGGCAGGTGAGCTGG - Intronic
1058027758 9:100161107-100161129 TGCTGGGATTACAGGCGTGCTGG - Intronic
1059851668 9:118347844-118347866 TGCTGGGATTACAGGTGAGATGG + Intergenic
1060273854 9:122167310-122167332 TGCTGGGATTACAGGTGCGCAGG + Intronic
1060540652 9:124428070-124428092 TGCTGGGATTACAGGTGTGCTGG - Intergenic
1060997547 9:127883698-127883720 TGCTGGGATTTCAGGTGTGAAGG - Intergenic
1061941545 9:133886845-133886867 TGCTGGGCTTACAGGTCCCCTGG + Intronic
1062046300 9:134426015-134426037 TGCTGGGGTTGCAGGACCCCTGG - Intronic
1062322020 9:135994694-135994716 AGCTGGGCTTGCACGTGAGCAGG - Intergenic
1062570339 9:137182082-137182104 TGCTGGGATTGCAGGTGCGCAGG - Intronic
1185482576 X:458824-458846 TGCTAGGATTGCAGGATTGCAGG - Intergenic
1185568817 X:1116808-1116830 TGCTGGGATGACAGGTGCGACGG + Intergenic
1185799925 X:3001307-3001329 TGCTGGGATTACAGGTGGGAGGG - Intergenic
1186095505 X:6097454-6097476 TGCTGTGGTTGCAGGAGGGCAGG + Intronic
1187055831 X:15740795-15740817 TGCTGGGATTACAGGCGTACAGG - Intronic
1187441700 X:19326608-19326630 TGCTGGGATTACAGGTGGCATGG + Intergenic
1188049480 X:25466964-25466986 TGCTGGGATTACAGGCGTGAGGG + Intergenic
1188612704 X:32119200-32119222 AGCTGGGATTACAGGTGCTCTGG - Intronic
1189356823 X:40316204-40316226 TGCTAGGAGTGGAGGTGAGCTGG + Intergenic
1189829522 X:44956657-44956679 TGCTGGGATTATAGGCGTGCTGG + Intronic
1190085911 X:47395087-47395109 TGCTGGGGTTACAGGTGTGGAGG + Intronic
1191609924 X:63101673-63101695 TGCTGGGATTCCAGGGGCCTAGG - Intergenic
1192471432 X:71402372-71402394 TGCTGGGATTACAGGCGTGCTGG + Intronic
1192774067 X:74223549-74223571 TGCTGGGATTACAGGCCAGCTGG + Intergenic
1192966936 X:76187091-76187113 TGCTGGGATTACAGGTGTGATGG + Intergenic
1193461951 X:81801466-81801488 TTCTGGGATTGGAGGTGAGCAGG + Intergenic
1195042298 X:101025690-101025712 TGCTGGAATTACAGGTGGGAGGG - Intronic
1195261737 X:103138751-103138773 AGCTGGGACTACAGGTGCGTGGG + Intergenic
1195690870 X:107623901-107623923 TGCTGGGATTACAGGCGAGATGG + Intergenic
1197205003 X:123782094-123782116 AGCTGGGACTGCAGGTGTGCTGG - Intergenic
1201503073 Y:14666905-14666927 TGCTGTGGTTGCAGGAGGGCAGG - Intronic