ID: 1062570342

View in Genome Browser
Species Human (GRCh38)
Location 9:137182090-137182112
Sequence TCCCTATGTGCTGGGATTGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 590457
Summary {0: 2, 1: 82, 2: 8827, 3: 308303, 4: 273243}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1062570342_1062570345 4 Left 1062570342 9:137182090-137182112 CCTGCAATCCCAGCACATAGGGA 0: 2
1: 82
2: 8827
3: 308303
4: 273243
Right 1062570345 9:137182117-137182139 AAGCCAGAAGACCTAAGCCCAGG No data
1062570342_1062570353 28 Left 1062570342 9:137182090-137182112 CCTGCAATCCCAGCACATAGGGA 0: 2
1: 82
2: 8827
3: 308303
4: 273243
Right 1062570353 9:137182141-137182163 GTCCGAGGCTGCAGGGAGACAGG No data
1062570342_1062570347 13 Left 1062570342 9:137182090-137182112 CCTGCAATCCCAGCACATAGGGA 0: 2
1: 82
2: 8827
3: 308303
4: 273243
Right 1062570347 9:137182126-137182148 GACCTAAGCCCAGGTGTCCGAGG No data
1062570342_1062570349 20 Left 1062570342 9:137182090-137182112 CCTGCAATCCCAGCACATAGGGA 0: 2
1: 82
2: 8827
3: 308303
4: 273243
Right 1062570349 9:137182133-137182155 GCCCAGGTGTCCGAGGCTGCAGG No data
1062570342_1062570351 21 Left 1062570342 9:137182090-137182112 CCTGCAATCCCAGCACATAGGGA 0: 2
1: 82
2: 8827
3: 308303
4: 273243
Right 1062570351 9:137182134-137182156 CCCAGGTGTCCGAGGCTGCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1062570342 Original CRISPR TCCCTATGTGCTGGGATTGC AGG (reversed) Intronic
Too many off-targets to display for this crispr