ID: 1062570343

View in Genome Browser
Species Human (GRCh38)
Location 9:137182098-137182120
Sequence GCTTAGTGTCCCTATGTGCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1055
Summary {0: 1, 1: 0, 2: 2, 3: 25, 4: 1027}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1062570343_1062570347 5 Left 1062570343 9:137182098-137182120 CCCAGCACATAGGGACACTAAGC 0: 1
1: 0
2: 2
3: 25
4: 1027
Right 1062570347 9:137182126-137182148 GACCTAAGCCCAGGTGTCCGAGG No data
1062570343_1062570353 20 Left 1062570343 9:137182098-137182120 CCCAGCACATAGGGACACTAAGC 0: 1
1: 0
2: 2
3: 25
4: 1027
Right 1062570353 9:137182141-137182163 GTCCGAGGCTGCAGGGAGACAGG No data
1062570343_1062570349 12 Left 1062570343 9:137182098-137182120 CCCAGCACATAGGGACACTAAGC 0: 1
1: 0
2: 2
3: 25
4: 1027
Right 1062570349 9:137182133-137182155 GCCCAGGTGTCCGAGGCTGCAGG No data
1062570343_1062570345 -4 Left 1062570343 9:137182098-137182120 CCCAGCACATAGGGACACTAAGC 0: 1
1: 0
2: 2
3: 25
4: 1027
Right 1062570345 9:137182117-137182139 AAGCCAGAAGACCTAAGCCCAGG No data
1062570343_1062570351 13 Left 1062570343 9:137182098-137182120 CCCAGCACATAGGGACACTAAGC 0: 1
1: 0
2: 2
3: 25
4: 1027
Right 1062570351 9:137182134-137182156 CCCAGGTGTCCGAGGCTGCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1062570343 Original CRISPR GCTTAGTGTCCCTATGTGCT GGG (reversed) Intronic
900194048 1:1365077-1365099 ACTCAGTGTCCCAAAGTGCTGGG - Intergenic
900232568 1:1568340-1568362 GCTTGGTCTCCCAAAGTGCTGGG - Intronic
900671098 1:3855417-3855439 CCTTAGTGTCCCAAAGTGTTGGG + Intronic
901114412 1:6830292-6830314 CCTTGGTGTCCCAAGGTGCTAGG + Intronic
901726175 1:11244040-11244062 CCTTGGTGTCCCAAAGTGCTGGG - Intronic
901746765 1:11378884-11378906 GCTTGGTCTCCCAAAGTGCTGGG - Intergenic
901891971 1:12274560-12274582 TCTTAGTCTCCCAAAGTGCTGGG + Intronic
901989767 1:13103210-13103232 CCTTAGTCTCCCAAAGTGCTAGG + Intergenic
901992045 1:13123542-13123564 CCTTAGTCTCCCAAAGTGCTAGG - Intergenic
902029298 1:13409992-13410014 CCTTAGTCTCCCAACGTGCTGGG + Intergenic
902033103 1:13436997-13437019 CCTTAGCCTCCCAATGTGCTGGG - Intergenic
902293898 1:15452886-15452908 CCTTAGTCTCCCAAAGTGCTGGG + Intergenic
902390026 1:16098181-16098203 TGGTAGTGTCCCTAAGTGCTTGG + Intergenic
902448106 1:16479973-16479995 CCTTAGTCTCCCAAAGTGCTGGG + Intergenic
902593296 1:17490402-17490424 CCTTGGTTTCCCTAAGTGCTGGG + Intergenic
902603729 1:17557090-17557112 CCTCAGTGTCCCAAAGTGCTGGG - Intronic
902610036 1:17591796-17591818 CCTTGGTGTCCCAAAGTGCTGGG + Intronic
902855465 1:19200891-19200913 GCTTAGCCTCCCAAAGTGCTGGG - Intronic
902934755 1:19757038-19757060 CCTCAGTGTCCCAAAGTGCTGGG - Intronic
903373002 1:22848913-22848935 GCTTGGTGTCCATGTGCGCTGGG + Intronic
903407265 1:23108356-23108378 CCTTAGTCTCCCAAAGTGCTGGG - Intronic
903543016 1:24107498-24107520 CCTTAGTGTCCCTATTTTATAGG + Intronic
903978191 1:27165708-27165730 CCTCAGTGTCCCAAAGTGCTGGG - Intronic
904119732 1:28189914-28189936 CCTTAGTCTCCCAAAGTGCTGGG + Intronic
904129720 1:28266806-28266828 CCTCAGTGTCCCAACGTGCTGGG + Intronic
904186349 1:28708147-28708169 GCTTAGCCTCCCAAAGTGCTGGG + Intronic
904225532 1:29014893-29014915 CCTCAGTGTCCCAAAGTGCTGGG - Intronic
904502188 1:30919991-30920013 CCTTAGTCTCCCAAAGTGCTGGG + Intergenic
904681204 1:32230587-32230609 CCTTAGCCTCCCAATGTGCTGGG - Intronic
904704981 1:32383192-32383214 GCTTGGTCTCCCAAAGTGCTAGG - Intronic
904762036 1:32812261-32812283 CCTTAGTCTCCCAAAGTGCTGGG + Intronic
904781460 1:32952490-32952512 CCTCAGTGTCCCAAAGTGCTGGG - Intronic
905130855 1:35755954-35755976 CCTTAGTCTCCCAAAGTGCTGGG + Intronic
905142552 1:35859618-35859640 CCTCAGTCTCCCTATGTGCTGGG + Intergenic
905191920 1:36242401-36242423 GCTTAGTCTCTCAAAGTGCTGGG + Intronic
905540697 1:38758120-38758142 GCTTGGCCTCCCAATGTGCTGGG - Intergenic
905551917 1:38848732-38848754 TCTTAGTCTCCCAAAGTGCTGGG - Intronic
906014983 1:42568363-42568385 GCTTAGCTTCCCAAAGTGCTGGG + Intronic
906113840 1:43342305-43342327 CCTTAGTCTCCCAAAGTGCTGGG - Intronic
906180371 1:43812713-43812735 GCTTGGTCTCCCAAAGTGCTGGG + Intronic
906371385 1:45256890-45256912 CCTTGGTGTCCCAAAGTGCTGGG + Intronic
906634903 1:47402907-47402929 GCTTATTTTCCCTTTGGGCTAGG + Intergenic
906765550 1:48428202-48428224 GCTCAGTCTCCCAAAGTGCTGGG - Intronic
907007370 1:50928844-50928866 GCTTAGCCTCCCAAAGTGCTGGG - Intronic
907129021 1:52078311-52078333 CCTCAGTTTCCCTAAGTGCTGGG + Intronic
907371680 1:54007695-54007717 CCTCAGTGTCCCAAAGTGCTGGG + Intronic
907871941 1:58451341-58451363 CCTTAGTCTCCCAAAGTGCTGGG + Intronic
907882062 1:58559521-58559543 CCTTAGCCTCCCAATGTGCTGGG + Intergenic
908239559 1:62177279-62177301 GCTTAGCCTCCCGAAGTGCTGGG - Intergenic
908531999 1:65042789-65042811 GCTTTTAGTCCCTATCTGCTAGG + Intergenic
908762914 1:67528392-67528414 CCTTGGTGTCCCAAAGTGCTGGG + Intergenic
909156839 1:72088923-72088945 TCTCAGTGTCCCAAAGTGCTGGG + Intronic
909555302 1:76947483-76947505 GCTCAGTCTCCCAAAGTGCTGGG - Intronic
910093658 1:83495201-83495223 TATTTGTGTCCTTATGTGCTAGG - Intergenic
910176787 1:84439572-84439594 GCTTAGCCTCCCAAAGTGCTGGG - Intergenic
910238325 1:85059292-85059314 CCTTGGTGTCCCAAAGTGCTGGG - Intronic
910487239 1:87728814-87728836 TCTCAGTGTCCCAAAGTGCTGGG + Intergenic
911594780 1:99787578-99787600 ACTTGGTGTCCCAAAGTGCTGGG + Intergenic
912229474 1:107775328-107775350 CCTTGGTGTCCCAACGTGCTGGG - Intronic
912372154 1:109182079-109182101 CCTTAGCGTCCCAAAGTGCTAGG - Intronic
914692417 1:150042422-150042444 GCTCAGCCTCCCTAAGTGCTGGG + Intergenic
914742699 1:150478690-150478712 CCTTAGCCTCCCTAAGTGCTGGG - Intergenic
914745956 1:150501188-150501210 GCTCAGCCTCCCTAAGTGCTGGG - Intronic
914749828 1:150527189-150527211 GCTCAGCCTCCCAATGTGCTGGG + Intergenic
915372617 1:155364041-155364063 GCTCAGTCTCCCAAAGTGCTGGG - Intronic
915382291 1:155452805-155452827 CCTTGGTCTCCCAATGTGCTGGG + Intronic
915449916 1:155997633-155997655 CCTTAGTCTCCCTAAGTGTTGGG - Intronic
915985719 1:160462259-160462281 CCTTGGCGTCCCAATGTGCTGGG + Intergenic
917216140 1:172680037-172680059 GCTAAGCTTCCCTTTGTGCTTGG + Intergenic
917553725 1:176062250-176062272 CCTCAGTCTCCCAATGTGCTGGG + Intronic
917811342 1:178661316-178661338 GCTTAGCCTCCCAAAGTGCTGGG - Intergenic
917839832 1:178969030-178969052 CCTTGGTCTCCCTAAGTGCTGGG - Intergenic
917889664 1:179423012-179423034 CCTTAGTCTCCCAAAGTGCTGGG + Intronic
918232948 1:182552362-182552384 CCTCAGTGTCCCAAAGTGCTGGG + Intronic
918319627 1:183352311-183352333 CCTTAGCCTCCCTAAGTGCTGGG - Intronic
919304294 1:195810317-195810339 ACTTAGTCTCCCAAAGTGCTAGG - Intergenic
919477642 1:198048962-198048984 GCTTAGCCTCCCAAAGTGCTGGG + Intergenic
919651696 1:200155921-200155943 GCTTAGTCTCCCCAAGTGCTGGG + Intronic
919707943 1:200696700-200696722 CCTTAGTCTCCCAAAGTGCTGGG + Intergenic
919909774 1:202103703-202103725 CCTTAGCCTCCCAATGTGCTGGG + Intergenic
920248679 1:204607580-204607602 CCTTGGTGTCCCAAAGTGCTGGG + Intergenic
920404050 1:205695950-205695972 CCTTAGCCTCCCTAAGTGCTGGG + Intergenic
921038865 1:211409852-211409874 CCTTAGTCTCCCAAAGTGCTGGG - Intergenic
921561760 1:216667433-216667455 CCTTGGTCTCCCGATGTGCTGGG - Intronic
921885839 1:220304416-220304438 GCTTAGTTTCACTATGTATTAGG - Intergenic
923126476 1:231039187-231039209 GCTCAGTGTTTCTCTGTGCTTGG - Intronic
923669561 1:236028924-236028946 GCTCAGCCTCCCTAAGTGCTGGG - Intronic
924035598 1:239933422-239933444 TCTTAGTCTCCCAAAGTGCTGGG - Intergenic
924084940 1:240441241-240441263 CCTGAGTCTCCCAATGTGCTGGG + Intronic
924119598 1:240782670-240782692 GCTCAGTCTCCCAAAGTGCTAGG + Intronic
924574329 1:245265856-245265878 CCTTAGTCTCCCAAAGTGCTAGG + Intronic
1063033787 10:2264210-2264232 GCTGTGTGTGCCTATGTGTTGGG + Intergenic
1063284469 10:4670001-4670023 CCTTAGTCTCCCAAAGTGCTGGG + Intergenic
1063304283 10:4882542-4882564 CCTCAGTCTCCCTAAGTGCTGGG + Intergenic
1063356162 10:5400379-5400401 CCTTAGTCTCCCAAAGTGCTGGG - Intronic
1063427643 10:5962339-5962361 CCTTAGTCTCCCAAAGTGCTGGG - Intronic
1063462722 10:6224735-6224757 CCTTAGTCTCCCAAAGTGCTAGG + Intronic
1063506775 10:6606867-6606889 CCTTAGTCTCCCAAAGTGCTGGG + Intergenic
1063921912 10:10941741-10941763 CCTCAGTCTCCCAATGTGCTGGG - Intergenic
1064371973 10:14759960-14759982 CCTTGGTCTCCCTAAGTGCTGGG + Intronic
1064625927 10:17261171-17261193 CCTTAGTCTCCCAAAGTGCTGGG + Intergenic
1065110181 10:22433114-22433136 CCTTAGTTTCCCAAAGTGCTGGG + Intronic
1065181651 10:23132150-23132172 CCTTAGTCTCCCAAAGTGCTGGG - Intergenic
1065191506 10:23214770-23214792 ACTTAGCCTCCCTAAGTGCTGGG - Intronic
1065661706 10:28010279-28010301 CCTTAGCCTCCCTAAGTGCTGGG - Intergenic
1066401972 10:35085492-35085514 CCTCAGTGTCCCAAAGTGCTGGG - Intronic
1067510411 10:46890546-46890568 GCTTAGTGGCCCTATTTGCAAGG + Intergenic
1067651842 10:48161316-48161338 GCTTAGTGGCCCTATTTGCAAGG - Intronic
1067722024 10:48735039-48735061 CCTCAGTCTCCCAATGTGCTAGG + Intronic
1068249386 10:54417138-54417160 CCTTAGTCTCCCAAGGTGCTGGG + Intronic
1069452007 10:68525384-68525406 CCTTAGTCTCCCAAAGTGCTGGG + Intronic
1069585523 10:69598448-69598470 GCTTAGCCTCCCAAAGTGCTGGG - Intergenic
1069925755 10:71849757-71849779 CCTCGGTGTCCCAATGTGCTGGG + Intronic
1070262555 10:74871579-74871601 TCTTAGCCTCCCTAAGTGCTGGG - Intronic
1070573054 10:77656051-77656073 GCTGAGTGCCACTATGTGCCAGG + Intergenic
1071015093 10:80987611-80987633 CCTTGGTGTCCCAAAGTGCTGGG + Intergenic
1071924136 10:90385898-90385920 GCCTGGTGTCCCAAAGTGCTGGG + Intergenic
1072096682 10:92188469-92188491 GCTTAGCCTCCCAAAGTGCTGGG - Intronic
1072259791 10:93658559-93658581 CCTTAGTCTCCCAAAGTGCTGGG + Intronic
1072346936 10:94517125-94517147 CCTCAGTGTCCCAAAGTGCTAGG - Intronic
1072703024 10:97658080-97658102 TCTCAGTGTCCCAAAGTGCTGGG + Intronic
1072966106 10:99974036-99974058 CCTTAGTCTCCCGAAGTGCTAGG - Intronic
1073022835 10:100460872-100460894 CCTTGGTCTCCCAATGTGCTGGG - Intergenic
1073103166 10:101017529-101017551 CCTTAGTCTCCCAAAGTGCTAGG - Exonic
1073350656 10:102817403-102817425 GCTTGGTTTCCCAAAGTGCTGGG + Intergenic
1073419480 10:103412846-103412868 CCTTGGTGTCCCAAAGTGCTGGG + Intronic
1073658698 10:105447703-105447725 CCTTGGTGTCCCAAAGTGCTGGG + Intergenic
1075090306 10:119440799-119440821 CCTTGGCCTCCCTATGTGCTGGG + Intronic
1075156222 10:119978113-119978135 GCTCAGCCTCCCAATGTGCTGGG - Intergenic
1076351814 10:129820967-129820989 CCTTAGTTTCCCAAAGTGCTAGG + Intergenic
1076692304 10:132230103-132230125 GCTTAGTCTCCGTCTGTTCTCGG - Intronic
1077008639 11:370373-370395 CCTCAGTTTCCCTGTGTGCTGGG + Intronic
1077022720 11:426247-426269 CCTTGGTGTCCCCACGTGCTGGG - Intronic
1077039577 11:513407-513429 CCTCAGTGTCCCGAGGTGCTGGG + Intergenic
1077337324 11:2011219-2011241 GCTGGGTGCCCCTATGTGCTGGG - Intergenic
1077658533 11:4045700-4045722 TCTCAGCCTCCCTATGTGCTGGG + Intronic
1078226048 11:9392416-9392438 CCTTGGTCTCCCTAAGTGCTGGG + Intronic
1078535270 11:12168049-12168071 GCTTAGCCTCCCAAAGTGCTGGG - Intronic
1078810899 11:14762054-14762076 GCTCAGTTTCCCAAAGTGCTGGG - Intronic
1080188775 11:29521638-29521660 GCATAGTGGCCTTATGGGCTAGG - Intergenic
1080354887 11:31431559-31431581 CCTTAGTCTCCCAAAGTGCTGGG - Exonic
1081358064 11:42138179-42138201 CCTTAGCGTCCCAAAGTGCTAGG + Intergenic
1081629101 11:44675821-44675843 GCTCAGTTTCCCAAAGTGCTAGG - Intergenic
1081674639 11:44961609-44961631 ACTTACTGTTCCTATGAGCTAGG - Intergenic
1081983334 11:47283956-47283978 CCTTAGCGTCCCAAAGTGCTTGG + Intronic
1082019159 11:47516851-47516873 CCTCAGTGTCCCCAAGTGCTGGG + Intronic
1082021494 11:47537495-47537517 ACTCAGTCTCCCAATGTGCTGGG + Intronic
1082100005 11:48164814-48164836 CCTCAGTGTCCCGAAGTGCTGGG + Intronic
1083349886 11:62020056-62020078 CCTTAGTCTCCCAAAGTGCTGGG + Intergenic
1083550755 11:63588318-63588340 CCTTAGTCTCCCAAAGTGCTGGG + Intronic
1083586176 11:63861183-63861205 CCTTAGCCTCCCTAAGTGCTGGG - Intronic
1083858613 11:65406687-65406709 CCTTGGTCTCCCAATGTGCTAGG - Intronic
1084082401 11:66836947-66836969 GCTCAGTCTCCCAAAGTGCTGGG + Intronic
1084388146 11:68857029-68857051 CCTTGGTGTCCCAAAGTGCTGGG - Intergenic
1084735149 11:71100616-71100638 CCTTGGCGTCCCAATGTGCTGGG - Intronic
1085094760 11:73751053-73751075 CCTTAGTGTCCCAAAGTGCTGGG + Intronic
1085331696 11:75657359-75657381 CCTTGGTGTCCCAAAGTGCTGGG + Intronic
1085502026 11:77033197-77033219 CCTTGGTCTCCCTAAGTGCTGGG - Intergenic
1085594975 11:77801175-77801197 CCTTGGTGTCCCAAAGTGCTGGG - Intronic
1085673356 11:78490564-78490586 CCTCAGTGTCCCAAAGTGCTGGG - Intronic
1086019464 11:82209271-82209293 TCTTGGTGTTCCTAAGTGCTGGG - Intergenic
1087003975 11:93450619-93450641 CCTTGGTGTCCCCAAGTGCTAGG - Intergenic
1087085439 11:94213530-94213552 CCTTAGTTTCCCAAAGTGCTGGG + Intergenic
1087893645 11:103563711-103563733 CCTCAGTGTCCCAAAGTGCTGGG - Intergenic
1088263867 11:107971314-107971336 CCTTGGTGTCCCAAAGTGCTGGG - Intergenic
1088304372 11:108392290-108392312 GCTTGGTCTCCCAAAGTGCTGGG + Intronic
1088780102 11:113125903-113125925 ACTTAGTCTCCCAAAGTGCTAGG - Intronic
1088844743 11:113655523-113655545 GCTCAGTCTCCCAAAGTGCTGGG - Intergenic
1088877814 11:113950466-113950488 GAATAGTGTCCCTCTGTGGTGGG + Intergenic
1089249511 11:117147446-117147468 CCTTAGTGTCCCAAAGTGCTGGG + Intronic
1089506564 11:118966719-118966741 GCTTAGCCTCCCAAAGTGCTGGG - Intergenic
1089510821 11:118995988-118996010 GCTTAGCCTCCCAAAGTGCTGGG + Intergenic
1089622816 11:119731481-119731503 CCTTGGTGTCCCAAAGTGCTGGG + Intergenic
1090336305 11:125969246-125969268 CCTTAGTCTCCCAAAGTGCTGGG + Intronic
1090356618 11:126144914-126144936 CCTCAGTGTCCCAAAGTGCTGGG + Intergenic
1202820308 11_KI270721v1_random:66401-66423 GCTGGGTGCCCCTATGTGCTGGG - Intergenic
1091425645 12:386594-386616 CCTCAGTCTCCCAATGTGCTGGG - Intronic
1091466738 12:691455-691477 GCTTAGCCTCCCAAAGTGCTGGG - Intergenic
1091516445 12:1187515-1187537 GCTTAGCCTCCCAAAGTGCTGGG + Intronic
1092130252 12:6106621-6106643 GCTTAGCCTCCCAAAGTGCTGGG - Intronic
1092215656 12:6680213-6680235 CCTTAGTCTCCCAAAGTGCTGGG + Intronic
1092357024 12:7804475-7804497 GCTTAGCCTCCCAAAGTGCTGGG - Intergenic
1092498255 12:9019834-9019856 CCTTCGTGTCCCAAAGTGCTGGG + Intergenic
1092842475 12:12556305-12556327 CCTTAGTCTCCCAAAGTGCTAGG - Intronic
1093591581 12:20907757-20907779 CCTCAGTCTCCCAATGTGCTGGG + Intronic
1093624610 12:21330240-21330262 CCTTAGTCTCCCAAAGTGCTAGG - Intronic
1093712297 12:22340664-22340686 GTTTAGTGGCCCTGTGTCCTTGG - Intronic
1093733969 12:22597697-22597719 CCTTAGTCTCCCAAAGTGCTGGG + Intergenic
1093933668 12:24979005-24979027 GCTTAGCCTCCCAAAGTGCTGGG - Intergenic
1094560220 12:31545701-31545723 GCTTAGCCTCCCAAAGTGCTGGG - Intronic
1094576005 12:31686193-31686215 GCTCAGTCTCCCAAAGTGCTGGG - Intronic
1095827877 12:46549232-46549254 GCTTGGGCTCCCTAAGTGCTGGG - Intergenic
1095907237 12:47390921-47390943 CCTTGGTGTCCCAAAGTGCTGGG + Intergenic
1096065580 12:48737199-48737221 CCTTAGTCTCCCAAAGTGCTAGG + Intergenic
1096132903 12:49174674-49174696 CCTTAGTCTCCCAAAGTGCTGGG - Intergenic
1096151952 12:49319763-49319785 CCTTGGTGTCCCAAAGTGCTGGG + Intergenic
1096327805 12:50681178-50681200 CCTCAGTGTCCCAAAGTGCTGGG - Intronic
1096492420 12:52020019-52020041 CTTCTGTGTCCCTATGTGCTGGG + Intergenic
1096527345 12:52218786-52218808 CCTTGGTGTCCCAAAGTGCTGGG + Intergenic
1096724106 12:53547232-53547254 CCTCAGTGTCCCAAAGTGCTGGG + Intronic
1097116158 12:56698854-56698876 CCTTGGTGTCCCAAAGTGCTGGG + Intergenic
1097138951 12:56883264-56883286 CCTCAGTGTCCCAAAGTGCTTGG + Intergenic
1097694751 12:62765308-62765330 GCTAAATGCCTCTATGTGCTGGG + Intronic
1097709440 12:62902110-62902132 CCTCAGTGTCCCAAAGTGCTGGG - Intronic
1097813536 12:64045682-64045704 GCTTAGCTTCCCAAAGTGCTGGG + Intronic
1097829517 12:64209332-64209354 GCTTAGCATCCCAAAGTGCTGGG - Intronic
1097869836 12:64592149-64592171 CCTTAGTTTCCCAAAGTGCTGGG + Intergenic
1098252587 12:68585532-68585554 CCTTAGCCTCCCTAAGTGCTGGG + Intergenic
1098303703 12:69080360-69080382 GCTTAGCCTCCCAAAGTGCTGGG - Intergenic
1098329229 12:69335424-69335446 TCTCAGTGTCCCAAAGTGCTGGG - Intergenic
1099184666 12:79504177-79504199 CCTTGGTCTCCCAATGTGCTGGG + Intergenic
1099227935 12:79992077-79992099 TCTTGGTGTCCCAAAGTGCTGGG - Intergenic
1100350763 12:93779837-93779859 CCTTAGTCTCCCAAAGTGCTGGG + Intronic
1100403405 12:94251738-94251760 CCTCAGTGTCCCAAAGTGCTGGG - Intronic
1100452804 12:94723576-94723598 CCTTAGTCTCCCAAAGTGCTGGG + Intergenic
1100604062 12:96136568-96136590 GCTTGGTTTCCCTTTGGGCTTGG + Intergenic
1100672408 12:96830924-96830946 CCTTGGTTTCCCAATGTGCTGGG + Intronic
1101129030 12:101669684-101669706 CCTTAGTCTCCCAAAGTGCTGGG - Intronic
1101359399 12:104011919-104011941 CCTTAGTGTCCCAAAGTGCTGGG - Intronic
1101981722 12:109413223-109413245 CCTCAGTGTCCCAAAGTGCTGGG + Intronic
1101982966 12:109423410-109423432 CCTTGGTCTCCCAATGTGCTGGG + Intronic
1102017785 12:109659444-109659466 TCTTAGTCTCCCAAAGTGCTGGG - Intergenic
1102103239 12:110297863-110297885 CCTTAGCGTCCCAAAGTGCTGGG + Intronic
1102115201 12:110397645-110397667 CCTTGGTGTCCCAAAGTGCTGGG - Intronic
1102257307 12:111423730-111423752 CCTTGGTCTCCCTAAGTGCTGGG - Intronic
1102306455 12:111808452-111808474 CCTCAGTGTCCCAAAGTGCTGGG - Intronic
1102390615 12:112545975-112545997 GCTTAGCCTCCCAAAGTGCTGGG - Intergenic
1102508369 12:113398184-113398206 CCTTAGTCTCCCTAGGAGCTGGG + Intronic
1102632902 12:114297657-114297679 TCTCAGTGTCCCAAAGTGCTTGG - Intergenic
1102837034 12:116074142-116074164 CCTTGGTGTCCCAAAGTGCTGGG - Intronic
1103105108 12:118217434-118217456 GCTTAGTCTCCCAAAGTTCTGGG - Intronic
1103142073 12:118557295-118557317 CCTCAGTGTCCCAAAGTGCTGGG - Intergenic
1103577043 12:121885710-121885732 CCTTAGCCTCCCAATGTGCTGGG - Intergenic
1103592024 12:121998636-121998658 CCTTGGTCTCCCAATGTGCTGGG - Intronic
1103616557 12:122156790-122156812 CCTTAGTGTCCCAAAGTGTTGGG - Intergenic
1103788704 12:123453803-123453825 CCTTGGTTTCCCAATGTGCTGGG + Intergenic
1103861980 12:124022849-124022871 CCTCAGTGTCCCAAAGTGCTGGG + Intronic
1104317978 12:127721817-127721839 CCTTAGTCTCCCAAAGTGCTGGG - Intergenic
1104624918 12:130343875-130343897 GCTTAGCCTCCCAAAGTGCTGGG + Intronic
1105055764 12:133097767-133097789 CCTCAGTCTCCCAATGTGCTGGG + Intronic
1105384829 13:19920057-19920079 CCTTGGTCTCCCAATGTGCTGGG + Intergenic
1105461072 13:20587506-20587528 CCTCAGTGTCCCAAAGTGCTGGG + Intronic
1105909251 13:24845975-24845997 CCTTAGTGTCCCAAAGTGCTGGG - Intronic
1105933486 13:25075138-25075160 GCTCAGCGTCCCAAAGTGCTGGG - Intergenic
1105939574 13:25135391-25135413 CCTTAGTCTCCCAAAGTGCTAGG - Intergenic
1106145056 13:27042779-27042801 CCTTAGTCTCCCAAAGTGCTGGG + Intergenic
1106979347 13:35258412-35258434 CCTCAGCGTCCCTAAGTGCTGGG + Intronic
1106984868 13:35334518-35334540 CCTTGGTGTCCCAAAGTGCTGGG + Intronic
1107205560 13:37781826-37781848 GCTGAGTGTCCCTGTCTGCTGGG - Intronic
1107379530 13:39841009-39841031 CCTCAGTCTCCCAATGTGCTGGG + Intergenic
1107502214 13:40991525-40991547 CCTTAGTCTCCCAAAGTGCTGGG + Intronic
1107688237 13:42925499-42925521 GCTTAGTATCCCTAGGCCCTGGG - Intronic
1107909955 13:45096316-45096338 CCTTAGTCTCCCAAAGTGCTGGG + Intergenic
1108001038 13:45906139-45906161 ACTTGGTGTCCCAAAGTGCTGGG + Intergenic
1108538231 13:51408393-51408415 CCTTGGTGTCCCAAAGTGCTGGG + Intronic
1108645592 13:52424108-52424130 CCTTAGTCTCCCAAAGTGCTGGG + Intronic
1109092920 13:58071362-58071384 CCTTAGTCTCCTTAAGTGCTGGG + Intergenic
1109466741 13:62744419-62744441 GCTTAGCCTCCCAAAGTGCTGGG + Intergenic
1109668631 13:65573240-65573262 CCTTAGTCTCCCGAAGTGCTGGG + Intergenic
1110004209 13:70245865-70245887 GCTCAGTCTCCCAAAGTGCTAGG + Intergenic
1110715469 13:78698276-78698298 GCTCAGCCTCCCTAAGTGCTAGG - Intergenic
1110725067 13:78812878-78812900 GCTTAGCCTCCCAAAGTGCTAGG + Intergenic
1110998321 13:82142348-82142370 CCTCAGTCTCCCAATGTGCTGGG - Intergenic
1111352525 13:87050035-87050057 CCTTAGTCTCCCAAAGTGCTGGG + Intergenic
1111784421 13:92769476-92769498 CCTTAGTCTCCCAAAGTGCTGGG - Intronic
1112621765 13:101060539-101060561 CCTCAGTTTCCCAATGTGCTGGG + Intronic
1113306273 13:109082582-109082604 CCTTAGTCTCCCAAAGTGCTGGG - Intronic
1113490584 13:110688657-110688679 CCTTAGTCTCCCAAAGTGCTGGG - Intronic
1114187930 14:20417259-20417281 GCTTAGCCTCCCAAAGTGCTGGG - Intergenic
1115234175 14:31192075-31192097 TCTCAGTGTCCCAAAGTGCTGGG - Intronic
1115252291 14:31362217-31362239 TCTTAGCCTCCCAATGTGCTGGG + Intronic
1115818285 14:37186706-37186728 CCTTAGTCTCCCAAGGTGCTGGG - Intergenic
1115864246 14:37725598-37725620 GCTTGGTCTCCCAAAGTGCTGGG + Intronic
1116709065 14:48341738-48341760 GCTAAATTTCTCTATGTGCTGGG + Intergenic
1116878026 14:50133448-50133470 CCTTGGTCTCCCAATGTGCTGGG + Intronic
1117277815 14:54207279-54207301 CCTCAGTCTCCCAATGTGCTGGG + Intergenic
1117300465 14:54421126-54421148 CCTTGGTCTCCCAATGTGCTGGG - Intergenic
1117784848 14:59272326-59272348 CCTTAGTCTCCCAAAGTGCTGGG - Intronic
1118185604 14:63534868-63534890 ACTCTGTCTCCCTATGTGCTGGG + Intronic
1118341648 14:64898697-64898719 GCTTAGCCTCCCAAAGTGCTGGG - Intergenic
1118396427 14:65340928-65340950 CCTTGGTGTCCCAAAGTGCTGGG + Intergenic
1118448443 14:65873742-65873764 CCTTAGTCTCCCAAAGTGCTGGG + Intergenic
1118630945 14:67702217-67702239 CCTTAGGGTCCCAAAGTGCTAGG + Intronic
1119414573 14:74460898-74460920 CCTTGGTGTCCCAAAGTGCTGGG + Intergenic
1119534530 14:75392172-75392194 GCTGGGTGTCCCCAAGTGCTGGG - Intergenic
1119821913 14:77623831-77623853 CCTTGGTGTCCCAAAGTGCTGGG - Intergenic
1119848702 14:77849700-77849722 GCTCAGCCTCCCTAAGTGCTAGG + Intronic
1120789298 14:88564051-88564073 CCTTAGCCTCCCTAGGTGCTGGG + Intronic
1120899388 14:89562508-89562530 CCTCAGTGTCCCCAAGTGCTGGG + Intronic
1121753713 14:96383157-96383179 GCTTGGCCTCCCTAAGTGCTGGG - Intronic
1121780762 14:96620590-96620612 CCTTAGTCTCCCAAAGTGCTGGG + Intergenic
1122788373 14:104174237-104174259 GCTGAGTGTCTCTGCGTGCTGGG - Exonic
1123712969 15:23003901-23003923 CCTCAGTTTCCCAATGTGCTGGG + Intronic
1123902807 15:24893364-24893386 CCTTAGGTTCCCAATGTGCTGGG - Intronic
1123910620 15:24963364-24963386 GCTTAGCCTCCCAAAGTGCTGGG - Intronic
1123989911 15:25675693-25675715 CCTTAGCGTCCCAAAGTGCTGGG - Intergenic
1124021231 15:25925875-25925897 CCTTAGTCTCCCAAAGTGCTAGG - Intergenic
1125299208 15:38236536-38236558 GTTTAGTTTCCATATCTGCTAGG + Intergenic
1125607126 15:40946174-40946196 GCTGAGTGTTCCTATGTGACGGG + Intergenic
1125630471 15:41143029-41143051 CCTTAGCCTCCCAATGTGCTAGG - Intergenic
1125634616 15:41176817-41176839 CCTTGGTGTCCCAAAGTGCTAGG + Intergenic
1126019891 15:44389928-44389950 CCTCAGTGTCCCAAAGTGCTGGG + Intronic
1126042027 15:44600901-44600923 CCTTAGTCTCCCAAAGTGCTGGG - Intronic
1126078681 15:44937793-44937815 CCTCAGTCTCCCAATGTGCTGGG - Intergenic
1126115540 15:45204073-45204095 CCTTAGTCTCCCAAAGTGCTGGG - Intergenic
1126171358 15:45697866-45697888 CCTCAGTGTCCCAAAGTGCTGGG - Intergenic
1126451731 15:48815966-48815988 GCTTAGCCTCCCAAAGTGCTGGG - Intergenic
1126728248 15:51655038-51655060 CCTTAGTCTCCCAAAGTGCTGGG + Intergenic
1126759130 15:51953370-51953392 CCTTGGTGTCCCAAAGTGCTGGG - Intronic
1127086423 15:55428202-55428224 CCTCAGTGTCCCAAAGTGCTGGG + Intronic
1127414150 15:58740653-58740675 GCTTAGCTTCCCAAAGTGCTGGG + Intronic
1127434804 15:58946572-58946594 CCTTGGTGTCCCAAAGTGCTGGG - Intronic
1127781150 15:62317559-62317581 GCTCAGTCTCCCAAAGTGCTGGG - Intergenic
1127926178 15:63545717-63545739 CCTTAGCCTCCCAATGTGCTGGG - Intronic
1128013399 15:64320140-64320162 GCTTGGCCTCCCTAAGTGCTGGG + Intronic
1128069193 15:64783446-64783468 CCTTAGCCTCCCTAAGTGCTAGG - Intergenic
1128247679 15:66144103-66144125 GCTTAGTGTCCGTGTGTGCTGGG - Intronic
1128284768 15:66427763-66427785 GCTCAGCGTCCCAAAGTGCTGGG - Intronic
1128295656 15:66516754-66516776 CCTTAGCCTCCCAATGTGCTGGG + Intronic
1128370946 15:67038873-67038895 GCAAAGTGTCACTTTGTGCTTGG + Intergenic
1128435853 15:67647494-67647516 CCTTAGTCTCCCAAAGTGCTGGG - Intronic
1128462009 15:67877341-67877363 GCTTGGTCTCCCAAAGTGCTGGG - Intergenic
1129315646 15:74742004-74742026 CCTTGGTGTCCCAAAGTGCTGGG - Intergenic
1129375861 15:75130923-75130945 GCTTGGTCTCCCAAAGTGCTGGG + Intergenic
1129754592 15:78089780-78089802 CCTTGGTGTCCCAAAGTGCTGGG + Intronic
1130104141 15:80916731-80916753 CCTAAGTGTCCCTGTGTGATGGG - Intronic
1130667653 15:85883487-85883509 CCTTAGCCTCCCAATGTGCTGGG + Intergenic
1131011398 15:89021101-89021123 CCTTAGCCTCCCAATGTGCTGGG + Intergenic
1131273721 15:90962639-90962661 GCTTAGCCTCCCAAAGTGCTGGG - Exonic
1131448602 15:92520177-92520199 CCTTGGTCTCCCAATGTGCTGGG - Intergenic
1131755350 15:95554722-95554744 GCTAATTGTCCCTATGTGTCAGG + Intergenic
1131969168 15:97875168-97875190 GCTTTGTGGCCATCTGTGCTGGG + Intergenic
1132195646 15:99912801-99912823 CCTTAGTCTCCCAAAGTGCTGGG + Intergenic
1132290284 15:100695858-100695880 GCCTTGTTTCCTTATGTGCTTGG + Intergenic
1132488095 16:207468-207490 CCTTGGTGTCCCAAAGTGCTGGG + Intronic
1132759996 16:1504182-1504204 GCTTAGCCTCCCAAAGTGCTGGG - Intronic
1132944746 16:2526685-2526707 CCTTAGTCTCCCAAAGTGCTGGG - Intronic
1133104550 16:3498556-3498578 CCTGAGTGTCCCAAAGTGCTGGG - Intergenic
1133509782 16:6446251-6446273 GCTTAGCTTCCCAAAGTGCTGGG + Intronic
1133567158 16:7006696-7006718 CCTTGGTCTCCCAATGTGCTGGG + Intronic
1133602873 16:7356978-7357000 GCTGAGGGCCCCTCTGTGCTTGG + Intronic
1133935713 16:10267615-10267637 CCTTGGTGTCCCAAAGTGCTGGG - Intergenic
1133990057 16:10699489-10699511 GCTTAGCCTCCCAAAGTGCTGGG - Intergenic
1134030322 16:10987104-10987126 TCTTAGCCTCCCAATGTGCTGGG + Intronic
1134087587 16:11368849-11368871 CCTCAGTCTCCCTAAGTGCTAGG - Intronic
1134150695 16:11802447-11802469 CCTTAGCGTCCCAAAGTGCTGGG - Intergenic
1134181694 16:12053038-12053060 CCTTGGTGTCCCAAAGTGCTGGG - Intronic
1134418665 16:14066919-14066941 CCTTAGTCTCCCAAAGTGCTGGG + Intergenic
1134780667 16:16892325-16892347 GCTTGGTTTCCCAAAGTGCTGGG + Intergenic
1135308423 16:21386792-21386814 ACTTGGTGTCCCAAAGTGCTGGG - Intergenic
1135399875 16:22159295-22159317 CCTTGGTCTCCCTAAGTGCTGGG - Intergenic
1135611905 16:23875287-23875309 GCTCAGTCTCCCAAAGTGCTGGG + Intronic
1135624965 16:23986500-23986522 CCTTGGTGTCCCAAAGTGCTGGG + Intronic
1135747449 16:25029314-25029336 CCTTAGTCTCCCAAAGTGCTGGG + Intergenic
1135780460 16:25295359-25295381 CCTTGGTCTCCCAATGTGCTGGG - Intergenic
1135983843 16:27169196-27169218 TCTCAGTGTCCCAAAGTGCTGGG - Intergenic
1135990888 16:27218061-27218083 GCTTGGTCTCCCAAAGTGCTGGG - Intronic
1136003941 16:27315537-27315559 GCTCAGGGTCCCTGGGTGCTGGG - Intronic
1136154419 16:28373683-28373705 CCTCAGTGTCCCAAAGTGCTGGG + Intergenic
1136208671 16:28741581-28741603 CCTCAGTGTCCCAAAGTGCTGGG - Intergenic
1136305167 16:29365927-29365949 ACTTGGTGTCCCAAAGTGCTGGG - Intergenic
1136383429 16:29907885-29907907 CCTTAGCCTCCCAATGTGCTGGG - Intronic
1136471083 16:30480746-30480768 GCTAAGCCTCCCAATGTGCTGGG - Intronic
1136537179 16:30906844-30906866 CCTTAGCCTCCCAATGTGCTGGG - Intergenic
1136587703 16:31198275-31198297 GCTCGGCGTCCCTAAGTGCTAGG + Intergenic
1137033296 16:35544649-35544671 CCTTGGTGTCCCAAAGTGCTGGG - Intergenic
1137367754 16:47875469-47875491 CCTTAGCCTCCCAATGTGCTGGG + Intergenic
1137550890 16:49436865-49436887 GCTTCCTCTCCCTTTGTGCTAGG + Intergenic
1137653930 16:50143910-50143932 CCTTAGTCTCCCAAAGTGCTGGG - Intergenic
1138018604 16:53455917-53455939 CCTCAGTCTCCCAATGTGCTAGG - Intronic
1138131703 16:54485414-54485436 CCTTAGTCTCCCAAAGTGCTAGG - Intergenic
1138171863 16:54858905-54858927 GCTCAGTTTCCCAAAGTGCTGGG + Intergenic
1138441599 16:57038371-57038393 TCTTAGTCTCCCAAAGTGCTGGG + Intronic
1138455724 16:57119607-57119629 CCTTGGTGTCCCTGTGTGATGGG + Exonic
1138638433 16:58362606-58362628 GGTCAGTGTTACTATGTGCTGGG - Intronic
1139390295 16:66603249-66603271 TCTTTGTGTCCTTATGTGGTTGG + Intergenic
1139716003 16:68813710-68813732 CCTCAGCGTCCCTAAGTGCTGGG - Intronic
1139823153 16:69736605-69736627 CCTTAGCCTCCCAATGTGCTGGG - Intergenic
1140057140 16:71535421-71535443 GCTCAGTCTCCCAAAGTGCTGGG + Intronic
1140338043 16:74130363-74130385 CCTTAGCGTCCCAAAGTGCTGGG - Intergenic
1140375003 16:74438188-74438210 GCTTAGCCTCCCAAAGTGCTGGG - Intergenic
1140479514 16:75254842-75254864 ACTTAGTGTCCTGGTGTGCTGGG - Intronic
1140562390 16:75998444-75998466 CCTCAGTGTCCCAAAGTGCTGGG - Intergenic
1140737884 16:77914873-77914895 CCTTAGTCTCCCAAAGTGCTGGG - Intronic
1140817294 16:78633010-78633032 CCTCAGTGTCCCAAAGTGCTAGG - Intronic
1141536280 16:84682646-84682668 CCTTGGTCTCCCAATGTGCTGGG + Intergenic
1142041792 16:87898983-87899005 CCTCAGTCTCCCTAAGTGCTGGG + Intronic
1142370927 16:89681343-89681365 GCTTGGTCTCCCAAAGTGCTGGG + Intronic
1143076949 17:4352343-4352365 TCTTAGTCTCCCAAAGTGCTGGG + Intronic
1143192545 17:5050806-5050828 CCTTAGCGTCCCAAAGTGCTGGG - Intronic
1143624233 17:8099817-8099839 CCTTAGCCTCCCAATGTGCTGGG - Intronic
1143796706 17:9342770-9342792 CCTCAGTGTCCCAAAGTGCTGGG - Intronic
1144186078 17:12796511-12796533 CCTCAGTCTCCCTAAGTGCTGGG + Intronic
1144369270 17:14574607-14574629 GCTTAGCCTCCCAAAGTGCTGGG + Intergenic
1144532350 17:16051659-16051681 CCTTAGCGTCCCCACGTGCTGGG - Intronic
1145877084 17:28327219-28327241 CCTCAGTCTCCCTAAGTGCTGGG + Exonic
1146304535 17:31720917-31720939 CCTTAGTCTCCCAAAGTGCTGGG - Intergenic
1146407234 17:32549344-32549366 GCTCAGTCTCCCAAAGTGCTGGG + Intronic
1146475567 17:33159956-33159978 CCTTAGTCTCCCAAAGTGCTGGG - Intronic
1146724017 17:35142791-35142813 CCTCAGTGTCCCAAAGTGCTGGG + Intergenic
1146858346 17:36274085-36274107 GCTTAGCCTCCCAAAGTGCTGGG + Intronic
1147088665 17:38078148-38078170 GCTTAGCCTCCCAAAGTGCTGGG + Intergenic
1147108545 17:38242377-38242399 GCTTAGCCTCCCAAAGTGCTGGG - Intergenic
1147273430 17:39294223-39294245 CCTCAGTCTCCCAATGTGCTGGG + Intronic
1147786799 17:42984224-42984246 CCTTAGCCTCCCTAAGTGCTGGG + Intronic
1147972853 17:44229102-44229124 GCTTGGTCTCCCAAAGTGCTGGG + Intergenic
1148187007 17:45651421-45651443 GCGGAGTGCCACTATGTGCTCGG - Intergenic
1149188757 17:54032561-54032583 CCTCAGTCTCCCAATGTGCTGGG - Intergenic
1149391547 17:56196481-56196503 CCTTGGTGTCCCAAAGTGCTAGG - Intronic
1149460510 17:56826202-56826224 CCTTAGTCTCCCAAAGTGCTGGG + Intronic
1149828516 17:59850936-59850958 TCTTGGTCTCCCAATGTGCTGGG - Intergenic
1149891809 17:60396325-60396347 CCTTAGTCTCCCAAAGTGCTGGG + Intronic
1149901987 17:60488970-60488992 GCTCAGTCTCCCAAAGTGCTGGG - Intronic
1149903483 17:60503634-60503656 CCTTAGCCTCCCAATGTGCTGGG + Intronic
1149915371 17:60603510-60603532 CCTTTGTGTCCCAAAGTGCTGGG - Intronic
1149945193 17:60917841-60917863 CCTTGGTGTCCCAAAGTGCTGGG + Intronic
1150301631 17:64052113-64052135 GCTTAGCCTCCCAAAGTGCTGGG - Intronic
1150513877 17:65786834-65786856 CCTTCGTCTCCCTAAGTGCTGGG + Intronic
1150610110 17:66726972-66726994 CCTTGGTGTCCCAAAGTGCTGGG + Intronic
1150758198 17:67935171-67935193 CCTTAGTCTCCCAAAGTGCTGGG - Intronic
1150977347 17:70103415-70103437 CCTTAGTCTCCCAAAGTGCTAGG + Intronic
1151079101 17:71307994-71308016 GCTTAGCCTCCCGAAGTGCTGGG - Intergenic
1151115163 17:71727391-71727413 GTTTAGTGTCTCTGTGAGCTGGG - Intergenic
1151465351 17:74281506-74281528 GCTTGGCCTCCCAATGTGCTGGG + Exonic
1151542044 17:74769592-74769614 GGTCAGTGTGCCTGTGTGCTGGG + Intergenic
1151609978 17:75166536-75166558 CCTTAGCCTCCCAATGTGCTGGG - Intronic
1151737119 17:75950201-75950223 GCTTGGCGTCCCAAAGTGCTGGG + Intronic
1152175697 17:78785775-78785797 CCTTAGTCTCCCAAAGTGCTAGG + Intergenic
1152987542 18:334375-334397 CCTTAGTCTCCCAAAGTGCTGGG - Intronic
1153050099 18:893919-893941 CCTTGGTGTCCCAAAGTGCTGGG + Intergenic
1154160323 18:11976601-11976623 GCTCAGTCTCCCAAAGTGCTGGG + Intergenic
1154345659 18:13541800-13541822 GCTTGGTCTCCCAAAGTGCTGGG - Intronic
1155059151 18:22213183-22213205 CCTCAGTGTCCCAAAGTGCTGGG + Intergenic
1155473841 18:26218087-26218109 GTTTAGTGTTCCTAAGTGCAAGG - Intergenic
1157264647 18:46207636-46207658 CCTTGGTGTCCCAAAGTGCTGGG + Intronic
1157841843 18:50966514-50966536 CCTCAGTGTCCCAAAGTGCTGGG - Intergenic
1158140751 18:54253040-54253062 GCTTACTGTTCCTAAGTTCTTGG - Intergenic
1158564615 18:58544086-58544108 TATTTGAGTCCCTATGTGCTAGG - Intronic
1159500753 18:69266129-69266151 GCTTAGCCTCCCAAAGTGCTGGG - Intergenic
1159595740 18:70381286-70381308 CCTTAGTCTCCCAAAGTGCTGGG - Intergenic
1160084819 18:75766776-75766798 CCTCAGTCTCCCAATGTGCTGGG - Intergenic
1160359386 18:78258608-78258630 GCTCAGTCTCCCAAAGTGCTGGG - Intergenic
1160487987 18:79310898-79310920 GCTTAGCCTCCCAAAGTGCTGGG - Intronic
1161352064 19:3799053-3799075 CCTTAGTCTCCCAAAGTGCTGGG + Intronic
1162036861 19:7944974-7944996 CCTCAGTGTCCCAAAGTGCTGGG - Intergenic
1162226233 19:9225122-9225144 CCTCAGTCTCCCAATGTGCTGGG - Intergenic
1162251704 19:9450040-9450062 CCTCAGTGTCCCAAAGTGCTGGG - Intergenic
1162295164 19:9808415-9808437 CCTTGGTGTCCCAAAGTGCTGGG + Intergenic
1162504022 19:11071772-11071794 GCTCAGCCTCCCAATGTGCTGGG - Intergenic
1162637618 19:11982650-11982672 GCTCAGTCTCCCAAAGTGCTAGG + Intergenic
1162920969 19:13902679-13902701 TCTTGGTGTCCCAAAGTGCTGGG - Intronic
1162958219 19:14111688-14111710 CCTTAGTCTCCCAAAGTGCTGGG + Intronic
1163029235 19:14533168-14533190 CCTTGGTGTCCCAAAGTGCTGGG - Intronic
1163086168 19:14981040-14981062 CCTTGGCGTCCCAATGTGCTGGG - Intronic
1163096294 19:15059808-15059830 CCTTAGCCTCCCTAAGTGCTGGG - Intergenic
1163877727 19:19888312-19888334 CCTTGGTCTCCCAATGTGCTGGG + Intronic
1163918360 19:20263603-20263625 CCTCAGTTTCCCAATGTGCTGGG + Intergenic
1163934462 19:20429746-20429768 TCTTAGTGTTCCTAAGTGTTAGG + Intergenic
1164207294 19:23069541-23069563 CCTTAGCCTCCCAATGTGCTGGG - Intergenic
1164278839 19:23750589-23750611 CCTCAGTCTCCCTAAGTGCTGGG - Intronic
1164443025 19:28293635-28293657 CCTTAGTCTCCCAACGTGCTGGG - Intergenic
1165910384 19:39222469-39222491 ACTTGGTGTCCCAAAGTGCTGGG - Intergenic
1166220205 19:41359450-41359472 CCTTAGTCTCCCAAAGTGCTGGG - Intronic
1166665737 19:44679241-44679263 CCTTGGTCTCCCAATGTGCTGGG + Intronic
1166724146 19:45015482-45015504 CCTTAGTCTCCCAAGGTGCTGGG - Intronic
1166724509 19:45018152-45018174 CCTTAGTCTCCCAAAGTGCTGGG - Intronic
1166826421 19:45612424-45612446 CCTTAGTTTCCCAAAGTGCTGGG - Intronic
1166841726 19:45701524-45701546 CCTTGGTCTCCCTAAGTGCTGGG + Intronic
1166927835 19:46281280-46281302 CTTTAGTGTCCCAAAGTGCTGGG + Intergenic
1166952086 19:46436106-46436128 GCTCAGTCTCCCAAAGTGCTGGG + Intergenic
1167123563 19:47533590-47533612 CCTCAGTGTCCCAAAGTGCTGGG - Intronic
1167161589 19:47771153-47771175 CCTTAGTCTCCCAAAGTGCTGGG + Intergenic
1167164255 19:47787585-47787607 GCTTAGCCTCCCAAAGTGCTGGG - Intergenic
1167199350 19:48053621-48053643 GCTTGGCGTCCCAAAGTGCTGGG + Intronic
1167215638 19:48162676-48162698 GCTTGGCCTCCCAATGTGCTGGG + Intronic
1167476463 19:49704419-49704441 GCTTAGCCTCCCAAAGTGCTGGG + Intronic
1167496566 19:49822522-49822544 CTTCAGTGTCCCTAAGTGCTGGG + Intronic
1167614931 19:50527435-50527457 CCTCAGTGTCCCAAAGTGCTGGG + Intronic
1167800602 19:51738846-51738868 TCTCAGTGTCCCAAAGTGCTAGG + Intergenic
1167865721 19:52326098-52326120 CCTTGGTCTCCCAATGTGCTGGG - Intergenic
1167895694 19:52578994-52579016 CCTTAGCCTCCCAATGTGCTGGG + Intronic
1167947652 19:53001919-53001941 CCTTGGTGTCCCAAAGTGCTAGG - Intergenic
1167965879 19:53146223-53146245 CCTTAGTCTCCCAAAGTGCTGGG + Intronic
1168105109 19:54161790-54161812 CCTTAGTCTCCCGAAGTGCTGGG + Intronic
1168427373 19:56249520-56249542 GCTCAGCCTCCCAATGTGCTGGG + Intronic
925103206 2:1267019-1267041 CCTTAGTCTCCCAAAGTGCTGGG + Intronic
925323054 2:2991830-2991852 GCTTGGTCTCCCAAAGTGCTAGG - Intergenic
925573045 2:5331930-5331952 CCTTGGTCTCCCTAAGTGCTGGG - Intergenic
925768727 2:7262243-7262265 CCTTAGTCTCCCAAAGTGCTGGG + Intergenic
925887523 2:8405749-8405771 CCTTGGTCTCCCAATGTGCTGGG - Intergenic
925939976 2:8807869-8807891 GCTTAGCCTCCCAAAGTGCTGGG - Intronic
926822447 2:16867305-16867327 CCTTAGTCTCCCAAAGTGCTGGG + Intergenic
927544322 2:23939857-23939879 CCTTGGTCTCCCAATGTGCTGGG - Intronic
927551265 2:24002152-24002174 CTTTAGTGTCCCAAAGTGCTGGG - Exonic
928041875 2:27886622-27886644 ACTTGGTGTCCCAAAGTGCTGGG - Intronic
928470642 2:31572255-31572277 TCTTAGTATCCATATGTACTTGG - Intronic
928908230 2:36391058-36391080 TCTTAGTCTCCCAAAGTGCTGGG + Intronic
929139978 2:38658325-38658347 GCTTGGTCTCCCAAAGTGCTGGG + Intergenic
929300785 2:40301664-40301686 CCTTAGCCTCCCAATGTGCTGGG - Intronic
929639672 2:43565185-43565207 GCTTAGTCTCCCAAAGTGCTGGG - Intronic
929651075 2:43679913-43679935 GCTCAGTGTCCCAAAGTGTTGGG + Intronic
929744476 2:44641806-44641828 GCTTAGCCTCCCAAAGTGCTGGG + Intronic
930125639 2:47794088-47794110 CCTTAGTCTCCCAAAGTGCTGGG - Intronic
930630267 2:53746047-53746069 CCTTAGTTTCCCAAAGTGCTAGG - Intronic
931105518 2:59051106-59051128 GCTTGGTCTCCTGATGTGCTGGG + Intergenic
931108277 2:59081889-59081911 CCTCAGTCTCCCAATGTGCTGGG + Intergenic
931375100 2:61699963-61699985 CCTCAGTGTCCCAAAGTGCTGGG + Intergenic
931581331 2:63778455-63778477 CCTTAGTCTCCCAAAGTGCTAGG + Intronic
931651476 2:64472694-64472716 GCTCAGTCTCCCAAAGTGCTGGG + Intergenic
932095047 2:68839801-68839823 CCTTGGTCTCCCAATGTGCTGGG - Intergenic
932178112 2:69621229-69621251 CCTTAGTTTCCCAAAGTGCTGGG - Intronic
932233183 2:70099372-70099394 CCTTAGTCTCCCAAAGTGCTGGG + Intergenic
932248865 2:70222028-70222050 CCTTAGTCTCCCAAAGTGCTGGG + Intronic
932271398 2:70413296-70413318 CCTTAGTCTCCCAAAGTGCTGGG + Intergenic
932713411 2:74084375-74084397 GCTTGGTCTCCCTAAGTGCTGGG - Intronic
933011675 2:77072545-77072567 CCTCAGTCTCCCTAAGTGCTGGG - Intronic
933323208 2:80803232-80803254 CCTCAGTCTCCCTAAGTGCTGGG + Intergenic
933730249 2:85450812-85450834 CCTCAGTGTCCCAAAGTGCTGGG - Intergenic
933909107 2:86923288-86923310 CCTTGGTGTCCCAAAGTGCTGGG + Intronic
934023617 2:87980097-87980119 CCTTGGTGTCCCAAAGTGCTGGG - Intergenic
935702999 2:105829091-105829113 TCTTACTGTCCCTTTCTGCTTGG + Intronic
936061913 2:109300428-109300450 CCTCAGTGTCCCAAAGTGCTGGG + Intronic
936364270 2:111837831-111837853 CCTTGGTGTCCCAAAGTGCTGGG - Intronic
936512646 2:113160691-113160713 CCTCAGTCTCCCTAAGTGCTGGG - Intronic
936743702 2:115547521-115547543 CCTTAGTGTCCCAAAGTGCTGGG - Intronic
937087815 2:119182886-119182908 CCTTAGCCTCCCTAAGTGCTGGG - Intergenic
938381921 2:130841312-130841334 CCTTAGTCTCCCAAAGTGCTGGG + Intronic
938596559 2:132793256-132793278 CCTTAGTTTCCCAAAGTGCTGGG + Intronic
938894682 2:135738274-135738296 CCTCAGTCTCCCAATGTGCTGGG + Intergenic
940025521 2:149203102-149203124 GCTTAGCTTCCCTATGCACTGGG + Intronic
940028826 2:149238831-149238853 CCTCAGTCTCCCAATGTGCTGGG - Intergenic
940292381 2:152089934-152089956 GCTCAGTGACCCTCTGTGTTTGG - Intronic
941301891 2:163812759-163812781 CCTTAGTCTCCCAAAGTGCTGGG + Intergenic
941713133 2:168735953-168735975 CCTCAGTGTCCCAAAGTGCTGGG - Intronic
942039881 2:172049233-172049255 CCTTAGTCTCCCAAAGTGCTGGG + Intronic
942170864 2:173288311-173288333 CCTTAGCCTCCCTAAGTGCTGGG - Intergenic
942318504 2:174715447-174715469 GCTTAGCCTCCCAAAGTGCTGGG - Intergenic
942365266 2:175219495-175219517 TCTTAGTCTCCCAAAGTGCTAGG + Intergenic
943102434 2:183504850-183504872 CCTTAGTCTCCCAAAGTGCTGGG + Intergenic
943183602 2:184576202-184576224 CCTTAGCTTCCCAATGTGCTGGG - Intergenic
943300460 2:186191394-186191416 CCTTAGTCTCCCAAAGTGCTGGG - Intergenic
943434019 2:187840757-187840779 CCTCAGTGTCCCAAAGTGCTGGG + Intergenic
943855341 2:192783198-192783220 CCTTAGCCTCCCTAAGTGCTGGG - Intergenic
944238583 2:197463680-197463702 CCTTAGTCTCCCAAAGTGCTGGG - Intronic
944350746 2:198724183-198724205 CCTCAGTGTCCCAAAGTGCTGGG - Intergenic
944456605 2:199901436-199901458 CCTTAGCCTCCCAATGTGCTGGG - Intergenic
944738711 2:202591013-202591035 CCTTAGTTTCCCAAAGTGCTGGG + Intergenic
945073428 2:206013906-206013928 GCTTGGTCTCCCAAAGTGCTGGG - Intronic
945076904 2:206048641-206048663 GCTCAGTGTCCCAAACTGCTGGG - Intronic
945109980 2:206353460-206353482 CCTTAGCCTCCCAATGTGCTGGG + Intergenic
945253259 2:207782465-207782487 GCTTGGGGTACCTATGTGATGGG + Intergenic
945438249 2:209844851-209844873 CCTCAGTGTCCCAAAGTGCTGGG + Intronic
946421752 2:219568997-219569019 CCTTAGTCTCCCAAAGTGCTGGG + Intronic
946501300 2:220250050-220250072 CCTTGGTGTCCCAAAGTGCTGGG + Intergenic
946694745 2:222343739-222343761 TCTCAGCGTCCCTAAGTGCTGGG - Intergenic
947065827 2:226224757-226224779 CCTTGGTGTCCCAAAGTGCTGGG - Intergenic
947281046 2:228455167-228455189 TCTTTGTGTCCATATGTACTCGG + Intergenic
947422738 2:229955290-229955312 CCTTAGTCTCCCAAAGTGCTGGG - Intronic
947626619 2:231623137-231623159 GCTTAGCCTCCCAAAGTGCTGGG - Intergenic
947973802 2:234346678-234346700 CCTCAGTCTCCCTAAGTGCTGGG - Intergenic
948706853 2:239799967-239799989 GCTTAGTATCCCTAATGGCTGGG - Exonic
1168740016 20:179721-179743 CCTCAGTGTCCCAAAGTGCTAGG + Intergenic
1168974012 20:1950624-1950646 CCTTGGTGTCCCAAAGTGCTGGG + Intergenic
1169335502 20:4752628-4752650 CCTCAGTGTCCCAAAGTGCTGGG - Intergenic
1169573885 20:6936796-6936818 GCTTGGTCTCCCAAAGTGCTGGG + Intergenic
1170404914 20:16025893-16025915 TCTTGGTGTCCCAAAGTGCTGGG - Intronic
1170985765 20:21256833-21256855 CCTCAGTGTCCCAAAGTGCTGGG - Intergenic
1170990813 20:21300689-21300711 TCTTAGTCTCCCCATTTGCTAGG + Intergenic
1171509609 20:25670830-25670852 CCTTGGTGTCCCAAAGTGCTGGG + Intergenic
1171991926 20:31703291-31703313 CCTTGGTGTCCCAATGTGCTGGG + Intronic
1172164671 20:32891942-32891964 CCTTAGCCTCCCTAAGTGCTGGG + Intronic
1172199346 20:33114287-33114309 GCTTGGTCTCCCAAAGTGCTGGG - Intergenic
1172721982 20:37006148-37006170 GCTTAGCTTCCCAAAGTGCTGGG + Intronic
1172730824 20:37085897-37085919 GCTTGGTCTCCCAAAGTGCTGGG + Intronic
1172787849 20:37480921-37480943 CCTCAGTGTCCCAAAGTGCTGGG + Intergenic
1173396679 20:42686740-42686762 CCTCAGTGTCCCAAAGTGCTGGG + Intronic
1173581828 20:44152423-44152445 CCTTAGTCTCCCTAAGAGCTGGG - Intronic
1173780702 20:45754574-45754596 TCTTAGTCTCCCAAAGTGCTGGG - Intronic
1173932210 20:46830220-46830242 CCTCAGTCTCCCAATGTGCTGGG + Intergenic
1173956640 20:47038247-47038269 GCTTGGTCTCCCAAAGTGCTGGG - Intronic
1174458553 20:50666808-50666830 CCTTAGTCTCCCAAAGTGCTGGG + Intronic
1174550621 20:51358959-51358981 GCTGAGTGCCTCTATGTGCCAGG - Intergenic
1175095634 20:56539265-56539287 GCTTAGTCTCCCAAAGTGCTGGG + Intergenic
1175111697 20:56653016-56653038 CCTTAGTCTCCCAAAGTGCTGGG + Intergenic
1175114860 20:56674806-56674828 CCTTGGTGTCCCAAAGTGCTGGG + Intergenic
1175332405 20:58174620-58174642 GCTTGGTCTCCAGATGTGCTGGG - Intergenic
1175703405 20:61157186-61157208 CCTTAGTCTCCCAAAGTGCTGGG + Intergenic
1176208820 20:63906851-63906873 CCTTAGACTCCCAATGTGCTGGG - Intronic
1176704786 21:10106111-10106133 CCTCAGTGTCCCAAAGTGCTGGG - Intergenic
1177262388 21:18748289-18748311 CCTTAGTCTCCCAAAGTGCTGGG + Intergenic
1178138799 21:29658510-29658532 TCTTGGTCTCCCTAAGTGCTGGG + Intronic
1178173482 21:30070029-30070051 TGTTAATGTTCCTATGTGCTTGG + Intergenic
1178312673 21:31542714-31542736 GCTCAGTCTCCCAAAGTGCTGGG - Intronic
1178690809 21:34748009-34748031 CCTTGGCCTCCCTATGTGCTGGG + Intergenic
1178813636 21:35907232-35907254 CCTTAGTCTCCCAAAGTGCTGGG - Intronic
1179579771 21:42334315-42334337 CCTTAGCCTCCCTAAGTGCTAGG + Intergenic
1179707481 21:43190539-43190561 GCTTGGTCTCCCAAAGTGCTGGG + Intergenic
1180113926 21:45683674-45683696 CCTTAGTCTCCCAAAGTGCTGGG - Intronic
1180620712 22:17159758-17159780 GCGCAGTCTCCCTATGCGCTGGG - Intronic
1180987039 22:19911184-19911206 GCTCAGTCTCCCAAAGTGCTAGG + Intronic
1181262516 22:21608673-21608695 GCTTAGCCTCCCAAAGTGCTGGG + Intronic
1181964912 22:26649662-26649684 CCTCAGTGTCCCAAAGTGCTGGG - Intergenic
1182141720 22:27965282-27965304 CCTTGGTGTCCCAAAGTGCTGGG + Intergenic
1182361158 22:29747365-29747387 CCTCAGTGTCCCAAAGTGCTAGG + Intronic
1182464187 22:30504303-30504325 CCTTAGTATCCCAAAGTGCTGGG + Intronic
1182820998 22:33216142-33216164 GCTAAATGTCCATATGTGCCTGG + Intronic
1183054621 22:35297128-35297150 ACTTAGTCTCCCAAAGTGCTGGG - Intergenic
1183145652 22:35989091-35989113 GCTCAGTGTGCATCTGTGCTTGG - Intronic
1183159122 22:36099073-36099095 TCTTAGTTTCCCAAAGTGCTGGG + Intergenic
1183164394 22:36136585-36136607 CCTTGGTCTCCCAATGTGCTGGG + Intergenic
1183860050 22:40663298-40663320 CCTCAGTCTCCCAATGTGCTGGG - Intergenic
1183985122 22:41565508-41565530 CCTCAGTCTCCCTAAGTGCTAGG - Intronic
949116294 3:329099-329121 GCTTATTTGCCCTATGTGCATGG + Intronic
949116450 3:331490-331512 CCTCAGTGTCCCAAAGTGCTGGG + Intronic
949250193 3:1974199-1974221 GCTTAGTCTCCCAAAGTGTTGGG - Intergenic
949306845 3:2651598-2651620 GCTCAGTCTCCCAAAGTGCTGGG - Intronic
949917184 3:8974217-8974239 GCTTGGTCTCCCAAAGTGCTGGG + Intergenic
950506231 3:13396495-13396517 GCTTAGCCTCCCAAAGTGCTGGG - Intronic
950808003 3:15624972-15624994 CCTTAGCCTCCCTAAGTGCTGGG + Intronic
951141568 3:19168275-19168297 GCTCAGTCTCCCAAAGTGCTGGG + Intronic
952371006 3:32722731-32722753 CCTCAGTCTCCCAATGTGCTGGG - Intronic
952439337 3:33309908-33309930 GCTTAGTCTCCCAAAGTGCTGGG - Intronic
952596331 3:35023061-35023083 CCTTAGCTTCCCAATGTGCTGGG - Intergenic
952751674 3:36830062-36830084 CCTTGGTGTCCCAAGGTGCTGGG - Intronic
952760895 3:36913298-36913320 GCCTCGTGTCCCAAAGTGCTGGG + Intronic
952775955 3:37046851-37046873 GCTTAGCCTCCCAAAGTGCTGGG + Intronic
952782796 3:37119910-37119932 CCTCAGTGTCCCAAAGTGCTGGG + Intronic
953602080 3:44376836-44376858 CCTTAGTCTCCCAAAGTGCTGGG - Intronic
953802670 3:46038266-46038288 GCTTGGTCTCCCAAAGTGCTGGG + Intergenic
953887600 3:46724994-46725016 CCTTAGTCTCCCAAAGTGCTGGG - Intronic
954000931 3:47556429-47556451 GCTTGGTCTCCCAAAGTGCTGGG + Intergenic
954216451 3:49127234-49127256 CCTCAGTGTCCCAAAGTGCTGGG + Intronic
954265367 3:49467267-49467289 CCTTAGTTTCCCAAAGTGCTGGG + Intergenic
954352502 3:50056542-50056564 CCTCAGTCTCCCAATGTGCTGGG + Intronic
954789949 3:53124719-53124741 TCTTAGTCTCCCAAAGTGCTGGG - Intronic
954840473 3:53507356-53507378 GCTAAGTGTCCCAAAGTGCTGGG - Intronic
954849914 3:53591502-53591524 CCTTGGTGTCCCAAAGTGCTGGG + Intronic
955201166 3:56853583-56853605 CCTTAGTCTCCCAAAGTGCTGGG + Intronic
955309310 3:57868473-57868495 GCTTAGCCTCCCAAAGTGCTGGG - Intronic
955427232 3:58804611-58804633 CCTTAGTCTCCCAAAGTGCTGGG + Intronic
955651803 3:61202799-61202821 CCTTGGTGTCCCAAAGTGCTGGG - Intronic
955698578 3:61660749-61660771 CCTTAGTCTCCCAAAGTGCTGGG - Intronic
955788268 3:62562583-62562605 GCTCAGTCTCCCAAAGTGCTGGG + Intronic
957053676 3:75428672-75428694 CCTCAGCCTCCCTATGTGCTGGG + Intergenic
957695094 3:83626028-83626050 CCTCAGTGTCCCAAAGTGCTGGG - Intergenic
957811854 3:85231963-85231985 GCTCAGCGTCCCAAAGTGCTGGG + Intronic
958121169 3:89290583-89290605 GCTAAGTGTCATTATGTGTTTGG + Intronic
958197122 3:90255756-90255778 CCTTAGTCTCCCAAAGTGCTAGG - Intergenic
958420543 3:93925585-93925607 CCTTAGTCTCCCAAAGTGCTAGG - Intronic
958882355 3:99687092-99687114 CCTTAGTCTCCCAAAGTGCTGGG + Intronic
959040015 3:101410594-101410616 TCTTGGTGTCCCAAAGTGCTGGG - Intronic
959056446 3:101572418-101572440 CCTTAGCCTCCCTAAGTGCTGGG - Intergenic
959109988 3:102111448-102111470 GCTCGGTGTCCCAAAGTGCTGGG + Intronic
959388499 3:105743205-105743227 GCTCAGTCTCCCAACGTGCTGGG - Intronic
959522186 3:107333390-107333412 TCTTGGTGTCCCAAAGTGCTGGG + Intergenic
960113559 3:113870109-113870131 CCTCAGTCTCCCAATGTGCTGGG - Intronic
960306078 3:116062256-116062278 CCTTGGTGTCCCAAAGTGCTGGG - Intronic
960414893 3:117372252-117372274 CCTTAGTCTCCCAAAGTGCTGGG + Intergenic
960443888 3:117723519-117723541 CCTTAGTCTCCCAAAGTGCTGGG + Intergenic
960811411 3:121630974-121630996 GCTTAGCCTCCCAAAGTGCTGGG - Intergenic
961088596 3:124090995-124091017 GCTTAGTGTCCCCAGGTGAACGG - Intronic
961649484 3:128410295-128410317 GCTTTCTGTCCCAATGTGCAGGG - Intergenic
961768164 3:129228455-129228477 GCTTGGTCTCCCAAAGTGCTGGG + Intergenic
962132408 3:132695682-132695704 GCTTAGCCTCCCAAAGTGCTGGG - Intronic
962235659 3:133705022-133705044 CCTCAGTGTCCCAAAGTGCTGGG - Intergenic
962311469 3:134329905-134329927 GCTTAGTCTCCCAAAGTGATGGG + Intergenic
962537827 3:136346846-136346868 CCTCAGTGTCCCAAAGTGCTAGG - Intronic
962800004 3:138882418-138882440 CCTTAGTCTCCCAAAGTGCTGGG + Intergenic
963083716 3:141417764-141417786 GCTTAGACTCCCAAAGTGCTGGG - Intronic
963313529 3:143733944-143733966 CCTTGGTGTCCCAAAGTGCTGGG - Intronic
963508585 3:146219664-146219686 CCTCAGTGTCCCAAAGTGCTGGG - Intronic
964491769 3:157243792-157243814 CCTTAGTCTCCCAAAGTGCTGGG - Intergenic
964496246 3:157293425-157293447 CCTTTGAGTCCCTATGTGTTGGG + Intronic
965220598 3:165921577-165921599 GCTTAGCCTCCCAAAGTGCTGGG - Intergenic
965758715 3:172052326-172052348 CCTTGGCGTCCCTAAGTGCTGGG + Intronic
965783883 3:172316248-172316270 GCTCAGTTTCCCAAAGTGCTGGG + Intronic
966237057 3:177713473-177713495 CCTCAGCCTCCCTATGTGCTGGG + Intergenic
966373016 3:179267967-179267989 GCCTAGTCTCCCAAAGTGCTGGG + Intergenic
966923936 3:184632307-184632329 CCTTGGTCTCCCTAAGTGCTGGG + Intronic
967166097 3:186780742-186780764 GCTTAGCTTCCCAAAGTGCTGGG + Intergenic
967547722 3:190751436-190751458 GCTCAGTCTCCCAAAGTGCTGGG + Intergenic
967748606 3:193087707-193087729 CCTTGGTCTCCCTAAGTGCTAGG - Intergenic
967785962 3:193496538-193496560 TCTCAGTGTCCCAAAGTGCTGGG - Intronic
967803689 3:193693387-193693409 CCTTGGTCTCCCTAAGTGCTGGG - Intronic
968216124 3:196892395-196892417 GCTTAGCCTCCCAAAGTGCTGGG + Intronic
968312460 3:197695361-197695383 GCTTGGCCTCCCTAAGTGCTGGG - Intronic
968595664 4:1481293-1481315 CCTTGGTGTCCCAAAGTGCTGGG - Intergenic
969603934 4:8192740-8192762 CCTTGGTCTCCCTAAGTGCTGGG + Intronic
969658845 4:8514525-8514547 CCTCAGCCTCCCTATGTGCTGGG + Intergenic
969666447 4:8560173-8560195 GCTTAGTTTCTGTCTGTGCTAGG + Intronic
970691523 4:18625798-18625820 CCTTAGTGTCCCAAAGTGCTAGG + Intergenic
970898628 4:21132756-21132778 CCTTAGCGTCCCAAAGTGCTAGG - Intronic
971164718 4:24171159-24171181 TCTCAGTGTCCCAAAGTGCTGGG - Intergenic
971423837 4:26497443-26497465 CCTTGGTCTCCCTAAGTGCTGGG + Intergenic
971668762 4:29528760-29528782 CCTCAGTGTCCCAAAGTGCTGGG + Intergenic
971714864 4:30162988-30163010 TCTTAGTCTCCCAATGTGTTGGG - Intergenic
971763808 4:30803687-30803709 CCTTGGTGTCCCAAAGTGCTGGG + Intronic
972388696 4:38592401-38592423 TCTTAGTGTCCACATGTCCTTGG + Intergenic
972582098 4:40404058-40404080 GCTCAGTCTCCCAAAGTGCTGGG + Intergenic
972585314 4:40432102-40432124 TCTTGGCCTCCCTATGTGCTGGG + Intronic
973139418 4:46747550-46747572 CCTCAGTGTCCCAAAGTGCTGGG + Intronic
973178286 4:47235299-47235321 CCTTAGTCTCCCAAAGTGCTGGG - Intronic
973232927 4:47863429-47863451 CCTTAGTCTCCCAAAGTGCTGGG - Intronic
973325597 4:48857901-48857923 GCTTGGTCTCCCAAAGTGCTGGG - Intronic
973540827 4:51933770-51933792 CCTTAGCCTCCCAATGTGCTGGG - Intergenic
973610751 4:52634256-52634278 CCTCAGTGTCCCAAAGTGCTGGG - Intronic
973686543 4:53376333-53376355 CCTTGGTGTCCCAAAGTGCTGGG - Intergenic
973842715 4:54878675-54878697 CCTTAGTCTCCCAAAGTGCTGGG + Intergenic
973979735 4:56298067-56298089 GCATTGTGTCCCTGTCTGCTGGG - Intronic
973994638 4:56445345-56445367 CCTTAGTCTCCCAAGGTGCTGGG - Intronic
974032994 4:56793047-56793069 GCTTAGCCTCCCAAAGTGCTAGG - Intergenic
974436976 4:61869192-61869214 CCTTGGTCTCCCAATGTGCTGGG + Intronic
974664169 4:64936507-64936529 CCTTAGTCTCCCAAAGTGCTGGG - Intergenic
975123489 4:70755699-70755721 CCTCAGTGTCCCAAAGTGCTGGG - Intronic
975131079 4:70833767-70833789 CCTTAGTCTCCCAAAGTGCTGGG + Intronic
976261938 4:83154174-83154196 CCTTAGTCTCCCAAAGTGCTGGG - Intergenic
976599535 4:86925465-86925487 CCTTAGTCTCCCAAAGTGCTGGG + Intronic
976748722 4:88432343-88432365 GCTCAGTATCCCTATGTGAAAGG - Intronic
977260038 4:94786937-94786959 CCTCAGTGTGCCTAAGTGCTGGG + Intronic
977283990 4:95079007-95079029 CCTTAGCGTCCCAAAGTGCTGGG + Intronic
977605495 4:98980676-98980698 CCTCAGTGTCCCAAAGTGCTGGG + Intergenic
977958346 4:103056052-103056074 GCTTGGTCTCCCAAAGTGCTGGG + Intronic
978439304 4:108716819-108716841 CCTCAGTCTCCCAATGTGCTGGG - Intergenic
978779128 4:112531653-112531675 CCTTGGTGTCCCAAAGTGCTGGG - Intergenic
979182177 4:117743865-117743887 CCTTGGTCTCCCAATGTGCTGGG - Intergenic
979280030 4:118856760-118856782 CCTTGGTGTCCCAAAGTGCTGGG + Intronic
979413307 4:120405844-120405866 CCTTGGTCTCCCTAAGTGCTGGG + Intergenic
980178540 4:129376075-129376097 CCTCAGTCTCCCAATGTGCTGGG - Intergenic
980277145 4:130667505-130667527 GCTTGGCCTCCCTAAGTGCTGGG + Intergenic
980303631 4:131026922-131026944 CCTTAGCCTCCCTAAGTGCTTGG + Intergenic
980311313 4:131133112-131133134 CCTTAGTTTCCCAAAGTGCTGGG - Intergenic
980929342 4:139170510-139170532 CCTCAGTGTCCCAAAGTGCTGGG + Intronic
980966527 4:139526532-139526554 GCTTAGCCTCCCAAAGTGCTAGG + Intronic
981037708 4:140189539-140189561 CCTCAGTGTCCCAAAGTGCTGGG - Intergenic
981051642 4:140315044-140315066 ATTTAGTGTCCCTATATGTTAGG + Intronic
981977718 4:150750681-150750703 TCTTAGTCTCCCAAAGTGCTGGG + Intronic
982565457 4:156980282-156980304 GCTAAGTCTCCCCATGTGCCAGG + Intergenic
982720781 4:158857690-158857712 CCTCAGTGTCCCAAAGTGCTGGG - Intronic
983337910 4:166420178-166420200 CCTTAGTCTCCCAGTGTGCTGGG + Intergenic
984113650 4:175650553-175650575 CCTTAGTCTCCCAAAGTGCTGGG + Intronic
984280890 4:177669739-177669761 CCTTAGGGTCCCAAAGTGCTGGG + Intergenic
984284565 4:177712789-177712811 GCATAGTGGCCCTAAATGCTTGG + Intergenic
984369732 4:178847359-178847381 CCTTGGTCTCCCTAAGTGCTAGG + Intergenic
984398961 4:179237378-179237400 CCTTAGCCTCCCAATGTGCTGGG - Intergenic
985124745 4:186682274-186682296 CCTTAGTCTCCCAAAGTGCTAGG - Intronic
986071141 5:4284688-4284710 CCTTAGCCTCCCAATGTGCTGGG + Intergenic
986118301 5:4802889-4802911 TCATCGTATCCCTATGTGCTAGG - Intergenic
986228051 5:5835533-5835555 CCTTGGTGTCCCAAAGTGCTGGG - Intergenic
986850133 5:11802315-11802337 CCTTAGTCTCCCAAAGTGCTGGG - Intronic
987224578 5:15826667-15826689 CCTCAGTCTCCCTAAGTGCTGGG + Intronic
987381641 5:17290953-17290975 CCTTAGTCTCCCAAAGTGCTGGG - Intergenic
988508316 5:31843514-31843536 CCTTAGCCTCCCTAAGTGCTGGG + Intronic
988523987 5:31970403-31970425 CCTTAGCTTCCCTAAGTGCTGGG - Intronic
988567788 5:32333487-32333509 CCTTAGTCTCCCAAAGTGCTGGG + Intergenic
988577443 5:32441225-32441247 CCTTAGCCTCCCAATGTGCTGGG + Intronic
989024515 5:37051075-37051097 CCTCAGTGTCCCAAAGTGCTGGG + Intronic
989183842 5:38604026-38604048 GTTGAGTCTCACTATGTGCTTGG - Intronic
989413283 5:41144515-41144537 CCTTGGTGTCCCAAAGTGCTGGG + Intronic
990234817 5:53755807-53755829 CCTTAGTCTCCCAAAGTGCTGGG - Intergenic
990251978 5:53925445-53925467 CCTTGGTGTCCCAAAGTGCTGGG + Intronic
990404900 5:55479275-55479297 CCTTAGTCTCCCAAAGTGCTGGG + Intronic
990550022 5:56866160-56866182 CCTTAGTCTCCCAAGGTGCTGGG - Intronic
991356241 5:65772143-65772165 GCTTAGTTTCCCCATTGGCTAGG + Intronic
991425362 5:66486428-66486450 GCTTGGTCTCCCAAAGTGCTGGG - Intergenic
991518468 5:67466516-67466538 CCTCAGTCTCCCTAAGTGCTGGG + Intergenic
991916683 5:71612605-71612627 CCTTAGCCTCCCAATGTGCTGGG + Intronic
991928578 5:71729406-71729428 GCTCAGTCTCCCAAAGTGCTGGG - Intergenic
992437850 5:76772670-76772692 CCTTAGTCTCCCAAAGTGCTGGG - Intergenic
992736011 5:79722424-79722446 GCTCAGTCTCCCAAAGTGCTGGG - Intronic
993363613 5:87007632-87007654 GCTTAGCCTCCCAAAGTGCTGGG + Intergenic
993399728 5:87433874-87433896 GATTAGTATCCTTATGTGGTTGG + Intergenic
994570055 5:101504518-101504540 CCTTAGTCTCCCAAAGTGCTGGG - Intergenic
994870520 5:105343339-105343361 CCTTGGTGTCCCAAAGTGCTGGG + Intergenic
995100260 5:108292369-108292391 CCTCAGTGTCCCAAAGTGCTAGG + Intronic
995453395 5:112327463-112327485 CCTTTGTGTCCCAAAGTGCTGGG - Intronic
995573624 5:113507034-113507056 CCTCAGTGTCCCAAAGTGCTGGG + Intergenic
995714509 5:115068884-115068906 GCTTAAACTCCCTATGTGATTGG + Intergenic
995757612 5:115526109-115526131 CCTTAGTCTCCCAAAGTGCTGGG + Intronic
996233968 5:121104800-121104822 GCTTAGCCTCCCAAAGTGCTGGG - Intergenic
996512876 5:124337014-124337036 CCTTAGCCTCCCTAAGTGCTGGG + Intergenic
996886567 5:128362713-128362735 GCTTGGTCTCCCAAAGTGCTGGG + Intronic
997407333 5:133661308-133661330 GCTTACTGTCACTATGACCTTGG + Intergenic
997558009 5:134818449-134818471 CCTTAGTCTCCCAAAGTGCTGGG - Intronic
999398280 5:151244834-151244856 GCTTAGCCTCCCAAAGTGCTGGG - Intronic
999463933 5:151783105-151783127 CCTTGGTGTCCCAAAGTGCTGGG + Intronic
999779458 5:154837377-154837399 CCTTAGTCTCCCAAAGTGCTGGG + Intronic
999783821 5:154873154-154873176 GCTTGGTCTCCCAAAGTGCTGGG + Intronic
999987856 5:157021900-157021922 TCTTAGTCTCCCAAAGTGCTGGG + Intergenic
1000252873 5:159511828-159511850 GCTGAGTGACTCTTTGTGCTTGG + Intergenic
1000387467 5:160688329-160688351 GGTTAGAATCCCTATGTTCTAGG + Intronic
1000553022 5:162690374-162690396 GCTTGGCCTCCCTAAGTGCTGGG - Intergenic
1001664433 5:173421016-173421038 GCTTGGTCTCCCAAAGTGCTGGG + Intergenic
1001707235 5:173750397-173750419 CCTTGGTGTCCCAAAGTGCTGGG + Intergenic
1001722967 5:173871606-173871628 TCTTTGTGCCCCTTTGTGCTTGG + Intergenic
1001788045 5:174430795-174430817 GCTTAGCCTCCCAATGTGCTGGG - Intergenic
1002113055 5:176933784-176933806 CCTCAGCGTCCCAATGTGCTTGG + Intronic
1002507256 5:179688301-179688323 GCTTAGCCTCCCAAAGTGCTGGG + Intronic
1002542386 5:179914777-179914799 CCTTAGTGTCTCAAAGTGCTGGG - Intronic
1002627215 5:180538433-180538455 CCTTAGTCTCCCAAAGTGCTAGG - Intronic
1003513846 6:6802669-6802691 CCTCAGGGTCCCTATGAGCTGGG + Intergenic
1003560360 6:7174857-7174879 CCTCAGTGTCCCTAAGTGCTGGG + Intronic
1004329988 6:14712665-14712687 CCTCAGTGTCCCAAAGTGCTGGG + Intergenic
1004514107 6:16307416-16307438 CCTTGGTGTCCCAAAGTGCTGGG - Intronic
1005081711 6:21962774-21962796 GCTCAGTCTCCCAAAGTGCTGGG + Intergenic
1005096372 6:22121022-22121044 CCTTGGTCTCCCAATGTGCTGGG + Intergenic
1006149302 6:31977735-31977757 CCTTAGCGTCCCAAAGTGCTGGG + Intronic
1006264354 6:32905545-32905567 CCTTGGTCTCCCAATGTGCTGGG - Intergenic
1007453141 6:41955686-41955708 CCTTAGTCTCCCAAAGTGCTGGG - Intronic
1007490265 6:42215675-42215697 CCTCAGTGTCCCAAAGTGCTGGG + Intronic
1008279999 6:49585581-49585603 CCTCAGTGTCCCAAAGTGCTGGG + Intergenic
1008689753 6:53964850-53964872 CCTTAGCCTCCCAATGTGCTGGG - Intronic
1008836141 6:55832858-55832880 CCTTAGTCTCCCAAAGTGCTGGG - Intronic
1009356638 6:62756209-62756231 CCTTGGTGTCCCAAAGTGCTGGG - Intergenic
1009697736 6:67131389-67131411 CCTTAGTCTCCCAAAGTGCTGGG + Intergenic
1009843780 6:69110194-69110216 CCTCAGTGTCCCAAAGTGCTGGG + Intronic
1010228208 6:73511532-73511554 GCTTAGCCTCCCAAAGTGCTGGG - Intergenic
1010427170 6:75740661-75740683 CCTAAGAGTCCCTAAGTGCTGGG + Intergenic
1010467666 6:76188178-76188200 CCTTAGCCTCCCTAAGTGCTGGG - Intergenic
1011415468 6:87115257-87115279 TCTTAATGTCCCTTGGTGCTGGG - Intergenic
1011678801 6:89762802-89762824 CCTCAGTGTCCCAAAGTGCTGGG - Intronic
1011758012 6:90525437-90525459 CCTCAGTCTCCCTAAGTGCTGGG + Intronic
1011907257 6:92387308-92387330 CCCTAGTCTCCCTAAGTGCTGGG - Intergenic
1011989250 6:93492138-93492160 CCTTAGTCTCCCAAAGTGCTGGG + Intergenic
1012085349 6:94818771-94818793 CCTTAGTCTCCCAAAGTGCTGGG - Intergenic
1012283747 6:97363023-97363045 GCTTCGTTTCCCAAAGTGCTAGG + Intergenic
1012874680 6:104712521-104712543 CCTTAGCCTCCCAATGTGCTGGG - Intergenic
1013336557 6:109168844-109168866 CCTCAGTGTCCCAAAGTGCTGGG + Intergenic
1014600176 6:123401692-123401714 CCTTGGTGTCCCAAAGTGCTGGG - Intronic
1014819867 6:125975824-125975846 CCTTGGTGTCCCAAAGTGCTGGG + Intronic
1014893071 6:126866678-126866700 TCTTAGCCTCCCTAAGTGCTGGG - Intergenic
1015016485 6:128419360-128419382 CCTTGGTGTCCCAAAGTGCTGGG - Intronic
1017099687 6:150836909-150836931 CCTTAGCCTCCCTAAGTGCTGGG - Intronic
1017313896 6:153006099-153006121 CCTTAGTCTCCCAAAGTGCTGGG + Exonic
1017345999 6:153381507-153381529 CCTTAGTCTCCCAAAGTGCTGGG + Intergenic
1017428432 6:154346118-154346140 CCTCAGTGTCCCAAAGTGCTAGG + Intronic
1017659831 6:156663194-156663216 GCTTGGTCTCCCAATATGCTGGG - Intergenic
1017885473 6:158596167-158596189 GCCTAGTCTCCCAAAGTGCTGGG + Intronic
1017936901 6:159013706-159013728 CCTTAGTCTCCCAAAGTGCTGGG + Intergenic
1018367414 6:163135435-163135457 CCTTGGTGTCCCAAAGTGCTGGG + Intronic
1018638160 6:165883290-165883312 CCTTAGTCTCCCAAAGTGCTGGG - Intronic
1019213323 6:170423564-170423586 CCTCAGTGTCCCAAAGTGCTGGG - Intergenic
1019680373 7:2344666-2344688 CCTCAGTGTCCCAAAGTGCTGGG - Intronic
1019982051 7:4628993-4629015 CCTTAGTCTCCCAAAGTGCTGGG - Intergenic
1020190904 7:5996962-5996984 CCTTGGTGTCCCAAAGTGCTGGG - Intronic
1020206811 7:6124124-6124146 CCTCAGTCTCCCTAAGTGCTGGG + Intronic
1020216026 7:6191195-6191217 CCTCAGTGTCCCAAAGTGCTGGG - Intronic
1020395547 7:7713086-7713108 CCTTAGCCTCCCAATGTGCTGGG - Intronic
1020849313 7:13330773-13330795 CCTTGGTCTCCCAATGTGCTGGG + Intergenic
1021198079 7:17694465-17694487 CCTTGGTGTCCCAAAGTGCTGGG + Intergenic
1022087418 7:27081899-27081921 CCTTGGTGTCCCAAAGTGCTAGG - Intergenic
1022140019 7:27485564-27485586 CCTCAGTGTCCCAAAGTGCTGGG + Intergenic
1022636318 7:32139501-32139523 TCTCAGTGTCCCTGTTTGCTTGG + Intronic
1022715962 7:32898789-32898811 CCTCAGCCTCCCTATGTGCTGGG + Intergenic
1023109346 7:36794078-36794100 GCCTGGTCTCCCAATGTGCTGGG + Intergenic
1023702189 7:42903890-42903912 CCTTAGTGTCCCTAGTAGCTGGG + Intergenic
1023787693 7:43724300-43724322 CCTCAGTGTCCCAAAGTGCTGGG - Intronic
1023822810 7:43989332-43989354 CCTTAGTCTCCCAAAGTGCTGGG - Intergenic
1024071396 7:45788629-45788651 CCTTAGTCTCCCTGTGGGCTGGG + Intergenic
1024259962 7:47566787-47566809 CCTGGGTGTCCCTAAGTGCTGGG - Intronic
1024646573 7:51376034-51376056 GCTTTGTTTCCCAAAGTGCTGGG + Intergenic
1024673364 7:51616594-51616616 GCTGAGTGTGCTCATGTGCTAGG + Intergenic
1025170305 7:56750422-56750444 CCTCAGTGTCCCAAAGTGCTGGG + Intergenic
1025650566 7:63464696-63464718 GCTCAGTCTCCCAAAGTGCTGGG - Intergenic
1025701579 7:63825284-63825306 CCTCAGTGTCCCAAAGTGCTGGG - Intergenic
1025792687 7:64704927-64704949 CCTTGGTCTCCCAATGTGCTGGG + Intronic
1025909168 7:65813652-65813674 CCTTAGTCTCCCAATGGGCTGGG + Intergenic
1025939213 7:66061814-66061836 CCTTAGTCTCCCAAAGTGCTGGG - Intergenic
1025979809 7:66396107-66396129 CCTTAGTCTCCCAATGGGCTGGG - Intronic
1026023947 7:66730805-66730827 GCTTAGCCTCCCAAAGTGCTGGG + Intronic
1026096733 7:67352362-67352384 CCTTGGTCTCCCAATGTGCTGGG - Intergenic
1026288833 7:68987650-68987672 CCTCAGTGTCCCAAAGTGCTGGG + Intergenic
1026759729 7:73117463-73117485 GCTTAGCCTCCCAAAGTGCTGGG + Intergenic
1026799833 7:73393037-73393059 CCTTAGTCTCCCAAAGTGCTGGG + Intergenic
1027036067 7:74926276-74926298 GCTTAGCCTCCCAAAGTGCTGGG + Intergenic
1027087681 7:75276007-75276029 GCTTAGCCTCCCAAAGTGCTGGG - Intergenic
1027204676 7:76088367-76088389 CCTTAGTCTCCCAATGGGCTGGG - Intergenic
1027253444 7:76414245-76414267 CCTTAGCGTCCCAAAGTGCTGGG + Intronic
1027707737 7:81555336-81555358 GCATAGTGGCCCTATCTGTTGGG - Intergenic
1027886802 7:83918753-83918775 GCTTGGTCTCCCAAAGTGCTGGG - Intergenic
1028132013 7:87186497-87186519 GCTTGGCTTCCCAATGTGCTGGG + Intronic
1028164830 7:87526428-87526450 CCTTAGTCTCCCAAAGTGCTAGG - Intronic
1028243669 7:88450590-88450612 CCTTGGTGTCCCAAAGTGCTGGG + Intergenic
1028840339 7:95423071-95423093 GCTTGGTCTCCCAAAGTGCTGGG - Intronic
1029142374 7:98420474-98420496 CCTTGGTCTCCCAATGTGCTGGG + Intergenic
1029346883 7:99985029-99985051 CCTTGGTGTCCCAAAGTGCTGGG - Intergenic
1029380721 7:100212708-100212730 GCTCAGCCTCCCTAAGTGCTGGG + Intronic
1029549428 7:101229752-101229774 CCTTAGTCTCCCAAAGTGCTGGG + Intergenic
1029609997 7:101621834-101621856 CCTCAGTCTCCCTAAGTGCTGGG + Intronic
1029751074 7:102542747-102542769 CCTTAGTCTCCCAAAGTGCTGGG - Intronic
1029769027 7:102641858-102641880 CCTTAGTCTCCCAAAGTGCTGGG - Intronic
1030027039 7:105334469-105334491 CCTTAGTCTCCCAAAGTGCTGGG + Intronic
1030134825 7:106236552-106236574 CCTTGGTCTCCCAATGTGCTAGG + Intergenic
1030135002 7:106238174-106238196 CCTTGGTCTCCCAATGTGCTAGG - Intergenic
1030823844 7:114130061-114130083 CCTTTGTCTCCCAATGTGCTGGG - Intronic
1031093718 7:117393095-117393117 GCTCAGTCTCCCAAAGTGCTGGG + Intronic
1031955315 7:127936795-127936817 CCTTAGTCTCCCAAAGTGCTAGG + Intronic
1032140375 7:129324131-129324153 CCTTGGTGTCCCAAAGTGCTGGG + Intronic
1032714049 7:134489111-134489133 CCTTGGTGTCCCAAAGTGCTGGG - Intergenic
1032879713 7:136076133-136076155 CCTTAGTCTCCCAAAGTGCTGGG + Intergenic
1033349486 7:140550569-140550591 TCTTAGTCTCCCAAAGTGCTGGG + Intronic
1033642744 7:143278002-143278024 CCTTAGTCTCCCAAAGTGCTGGG + Intergenic
1034764212 7:153702801-153702823 CCTCAGTGTCCCAAAGTGCTGGG - Intergenic
1035102268 7:156410611-156410633 CCTTGGTGTCCCAAAGTGCTGGG - Intergenic
1036204621 8:6795933-6795955 CCTCAGTGTCCCAAAGTGCTAGG - Intergenic
1036487390 8:9191810-9191832 GCTAAATGTGCCTCTGTGCTTGG + Intergenic
1036832210 8:12029647-12029669 GCTCAGCCTCCCTAAGTGCTGGG + Intergenic
1036902420 8:12680438-12680460 GCTCAGCCTCCCTAAGTGCTGGG + Intergenic
1036945627 8:13091994-13092016 GCTTAGCCTCCCAAAGTGCTGGG - Intronic
1037856006 8:22370980-22371002 GCTTCGTGACCCTGTGTTCTAGG - Intronic
1038034305 8:23674232-23674254 TCTTGGTCTCCCTAAGTGCTGGG - Intergenic
1038301584 8:26355492-26355514 GCTCAGTCTCCCAAAGTGCTGGG + Intronic
1038522045 8:28242298-28242320 CCTTAGTTTCCCAATGTGCTGGG - Intergenic
1038727353 8:30093761-30093783 TCTTAGCCTCCCAATGTGCTGGG + Intergenic
1038794892 8:30701213-30701235 TCTTAGTCTCCCAAAGTGCTGGG - Intronic
1039062010 8:33579469-33579491 GCTTAGCCTCCCAAAGTGCTGGG + Intergenic
1039503723 8:38036261-38036283 GCTTAGCCTCCCAAAGTGCTGGG - Intronic
1039813789 8:41073823-41073845 CCTTGGTTTCCCTAAGTGCTGGG - Intergenic
1039818490 8:41115626-41115648 CCTCAGTGTCCCAAAGTGCTGGG + Intergenic
1039844210 8:41314317-41314339 CCTTACTTTCCCTAAGTGCTGGG - Intergenic
1040467656 8:47710126-47710148 CCTTGGTCTCCCAATGTGCTGGG + Intronic
1041056586 8:53992360-53992382 CCTCAGTGTCCCAAAGTGCTGGG - Intronic
1041918404 8:63158541-63158563 CCTTGGTGTCCCAAAGTGCTGGG - Intergenic
1042859621 8:73299062-73299084 CCTCAGTGTCCCAAAGTGCTAGG + Intronic
1042932463 8:74027188-74027210 GCTTAGCCTCCCAAAGTGCTGGG + Intronic
1043014379 8:74920072-74920094 CCTTAGTCTCCCAAAGTGCTGGG + Intergenic
1043423691 8:80126731-80126753 CCTCAGCCTCCCTATGTGCTGGG + Intronic
1043536335 8:81209096-81209118 CCTTAGTCTCCCAAAGTGCTGGG + Intergenic
1043874922 8:85475055-85475077 CCTTGGTGTCCCAAGGTGCTGGG - Intronic
1044395421 8:91704881-91704903 CCTTAGCCTCCCAATGTGCTGGG - Intergenic
1044665953 8:94634709-94634731 CCTCAGTGTCCCAAAGTGCTAGG + Intergenic
1044803427 8:95980318-95980340 TCTTTGTGTCCATATGTACTCGG + Intergenic
1044980465 8:97711245-97711267 CCTTAGTCTCCCAAAGTGCTGGG - Intronic
1045282424 8:100760684-100760706 CCTTGGTGTCCCAAAGTGCTGGG + Intergenic
1045467466 8:102483666-102483688 CCTTAGTTTCCCAAAGTGCTGGG + Intergenic
1045596462 8:103661753-103661775 GCTTGGTCTCCCAACGTGCTAGG + Intronic
1045640751 8:104247768-104247790 GCTTAGTCTACATATCTGCTTGG - Intronic
1045828104 8:106425312-106425334 CCTTAGCCTCCCAATGTGCTGGG + Intronic
1046127394 8:109927461-109927483 CCTCAGTGTCCCAAAGTGCTAGG + Intergenic
1046439627 8:114241032-114241054 TCTTAGTGTCCCTATCTTCCAGG - Intergenic
1046747063 8:117887598-117887620 GCTTGGTCTCCCAAAGTGCTGGG + Intronic
1046749959 8:117916660-117916682 CCTTGGTGTCCCAAAGTGCTGGG - Intronic
1046904376 8:119556357-119556379 CCTTAGTGTCCCAAAGTGCTGGG + Intergenic
1046930154 8:119833661-119833683 CCTCAGTTTCCCTAAGTGCTAGG - Intergenic
1047183143 8:122608147-122608169 GCTTGGTCTCCCAAAGTGCTGGG - Intergenic
1047217852 8:122892932-122892954 CCTTAGTCTCCCAAAGTGCTGGG + Intronic
1047923971 8:129664651-129664673 ACTTAGTGTCTGTATGGGCTAGG - Intergenic
1047989236 8:130268233-130268255 CCTCAGTCTCCCTAAGTGCTGGG - Intronic
1048064682 8:130955892-130955914 GCTCAGTCTCCCAAAGTGCTGGG - Intronic
1048250524 8:132863245-132863267 GCTTTGTGTCCCTAGGTATTTGG + Intergenic
1048351533 8:133620488-133620510 CCTTAGTCTCCCAAAGTGCTGGG - Intergenic
1048712992 8:137232941-137232963 CCTTGGTGTCCCAAAGTGCTGGG - Intergenic
1048964088 8:139602659-139602681 ATTTAGTGTCCCTGTGTCCTTGG - Intronic
1049015937 8:139920093-139920115 GCTTAGCCTCCCAAAGTGCTGGG - Intronic
1049168467 8:141141790-141141812 TCTTAGTCTCCCAATATGCTGGG - Intronic
1049550767 8:143258073-143258095 CCTCAGTCTCCCAATGTGCTGGG - Intronic
1049633512 8:143672841-143672863 GCTTAGCCTCCCAAAGTGCTGGG + Intergenic
1049644917 8:143731885-143731907 GCTCAGTGACCCTGTGTGCGTGG - Intronic
1050527975 9:6562809-6562831 CCTTAGCCTCCCAATGTGCTGGG + Intronic
1050550770 9:6746627-6746649 CCTTGGTGTCCCAAAGTGCTGGG - Intronic
1050554619 9:6778514-6778536 GCTTAGCCTCCCAAAGTGCTGGG - Intronic
1050746838 9:8885745-8885767 CCTTGGTCTCCCAATGTGCTGGG + Intronic
1050960814 9:11728139-11728161 GCTTGGTGTCCCAAAGTGCTGGG - Intergenic
1051394422 9:16604544-16604566 GCTCAGTGTCCCTAAGTGCTGGG - Intronic
1051424362 9:16918707-16918729 CCTTAGTTTCCCAAAGTGCTAGG - Intergenic
1051636639 9:19186775-19186797 CCTTAGTCTCCCAAAGTGCTGGG - Intergenic
1051765197 9:20515194-20515216 CCTTAGTCTCCCAAAGTGCTGGG + Intronic
1051778695 9:20664727-20664749 ACTTAGCATCCCAATGTGCTGGG + Intronic
1052940988 9:34132026-34132048 CCTTAGTCTCCCAAAGTGCTGGG - Intergenic
1053035285 9:34822580-34822602 GCTTAGTGTGTATATGTGGTAGG + Intergenic
1053506884 9:38650837-38650859 CCTTAGTCTCCCAAAGTGCTAGG - Intergenic
1053909704 9:42885151-42885173 CCTCAGTGTCCCAAAGTGCTGGG - Intergenic
1055304400 9:74914163-74914185 CCTTTGTGTCCCAAAGTGCTGGG - Intergenic
1055423939 9:76173720-76173742 CCTTAGCCTCCCTAAGTGCTGGG - Intronic
1055445266 9:76376092-76376114 GCTCAGTCTCCCAAAGTGCTGGG - Intergenic
1055960351 9:81814696-81814718 GCTTACTATCCCTATCTGCCTGG - Intergenic
1056281970 9:85050552-85050574 CCTTAGTCTCCCAAAGTGCTGGG + Intergenic
1056359610 9:85841868-85841890 GCTTAGCCTCCCAAAGTGCTGGG + Intergenic
1056524069 9:87426507-87426529 TCTCAGTCTCCCAATGTGCTAGG - Intergenic
1056648221 9:88433331-88433353 CCTTGGTCTCCCTAAGTGCTGGG + Intronic
1056648842 9:88440407-88440429 CCTTAGTCTCCCAAAGTGCTGGG + Intronic
1057055680 9:91958844-91958866 ACTTAGCGTCCCAAAGTGCTGGG - Intergenic
1057771960 9:97976239-97976261 GCTTAGCCTCCCAAAGTGCTGGG - Intergenic
1057789648 9:98116047-98116069 CCTCAGTGTCCCAAAGTGCTGGG - Intronic
1057815945 9:98294726-98294748 CCTTAGTCTCCCAAAGTGCTAGG + Intronic
1057823454 9:98352729-98352751 GCTTTGGGTCCCTTTGTCCTGGG + Intronic
1058047365 9:100370898-100370920 CCTTAGTCTCCCAAAGTGCTGGG - Intergenic
1058286229 9:103183015-103183037 CCTTGGTGTCCCAAAGTGCTGGG - Intergenic
1058290234 9:103231978-103232000 CCTTAGGTTCCCAATGTGCTGGG + Intergenic
1058413621 9:104762980-104763002 GCTCAGCCTCCCTAAGTGCTGGG - Intergenic
1058445815 9:105053950-105053972 GCTCAGTGCCCCTTTGTCCTTGG + Intergenic
1058512902 9:105738970-105738992 GCCTAGTCTCCCAAAGTGCTGGG + Intronic
1058799116 9:108527660-108527682 CCTTAGCCTCCCTAAGTGCTGGG + Intergenic
1058844738 9:108945723-108945745 GCTTGGTCTCCCAAAGTGCTAGG + Intronic
1059132402 9:111766860-111766882 GCTTAGCCTCCCAAAGTGCTGGG + Intronic
1059144109 9:111882452-111882474 CCTTAGTCTCCCAATGTGCTGGG - Intergenic
1059737154 9:117113403-117113425 GCTTGGCCTCCCAATGTGCTGGG - Intronic
1060604733 9:124903547-124903569 CCTTTGTTTCCCTAAGTGCTTGG - Intronic
1060939000 9:127532780-127532802 CCTTAGTCTCCCAAAGTGCTGGG - Intronic
1061025418 9:128045594-128045616 ACTTAGTCTCCCAAAGTGCTGGG - Intergenic
1061094889 9:128450764-128450786 GCTCAGTCTCCCAAAGTGCTAGG + Intergenic
1061161096 9:128894540-128894562 CCTTGGTGTCCCAAAGTGCTGGG - Intronic
1061215423 9:129218941-129218963 GCTTAGCCTCCCAAAGTGCTGGG + Intergenic
1061262444 9:129487706-129487728 CCTCAGTTTCCCTATGTGCACGG + Intergenic
1061282185 9:129603809-129603831 GCTTAGCCTCCCGAAGTGCTGGG + Intergenic
1061501608 9:131006567-131006589 CCTTAGCCTCCCAATGTGCTGGG + Intergenic
1062075196 9:134584604-134584626 CCTTGGTCTCCCAATGTGCTGGG + Intergenic
1062301216 9:135871676-135871698 CCTTGGTCTCCCAATGTGCTGGG - Intronic
1062570343 9:137182098-137182120 GCTTAGTGTCCCTATGTGCTGGG - Intronic
1185501956 X:603738-603760 GCTCAGTCTCCCAAAGTGCTGGG - Intergenic
1185685655 X:1926186-1926208 GCTTGGCCTCCCGATGTGCTGGG - Intergenic
1185717341 X:2353479-2353501 TCTTAGTGACCCTTTGTCCTAGG - Intronic
1185748858 X:2594294-2594316 CCTTAGTCTCCCAAAGTGCTAGG + Intergenic
1185976338 X:4724902-4724924 CCTTAGTTTCCCAAAGTGCTGGG + Intergenic
1186203228 X:7175233-7175255 CCTTAGTCTCCCAAAGTGCTGGG - Intergenic
1186370785 X:8944921-8944943 CCTCAGTCTCCCTAAGTGCTGGG + Intergenic
1186427013 X:9470503-9470525 GCTTAGCCTCCCAAAGTGCTGGG + Intronic
1187899184 X:24011393-24011415 CCTTGGTGTCCCAAAGTGCTGGG - Intronic
1188330170 X:28860710-28860732 GCTTAGCCTCCCAAAGTGCTGGG + Intronic
1188425609 X:30043565-30043587 CCTTAGTCTCCCAAAGTGCTAGG + Intergenic
1189392384 X:40587017-40587039 CCTCAGCCTCCCTATGTGCTGGG - Intronic
1189477925 X:41370864-41370886 CCTTAGCTTCCCTAAGTGCTGGG + Intergenic
1190031006 X:46972847-46972869 CCTCAGTGTCCCAAAGTGCTAGG + Intronic
1190687167 X:52885548-52885570 CCTCAGTCTCCCTAAGTGCTGGG + Intergenic
1190698815 X:52970244-52970266 CCTCAGTCTCCCTAAGTGCTGGG - Intronic
1190814511 X:53917657-53917679 CCTTGGTGTCCCAAAGTGCTAGG + Intergenic
1190824088 X:54001075-54001097 CCTCAGTCTCCCAATGTGCTGGG - Intronic
1190922526 X:54869244-54869266 CCTCAGTCTCCCAATGTGCTGGG + Intergenic
1193381223 X:80818564-80818586 CCTTAGCCTCCCTAAGTGCTAGG - Intergenic
1193421573 X:81289605-81289627 TCTTAGTCTCCCAAAGTGCTGGG - Intronic
1193653539 X:84169918-84169940 CCTTAGTTTCCCAAAGTGCTGGG - Intronic
1194048957 X:89044253-89044275 GCTTGGTTTCCCAATGTGTTAGG - Intergenic
1194103835 X:89742808-89742830 GCTCAGTCTCCCAAAGTGCTGGG + Intergenic
1194202754 X:90974807-90974829 CCTTGGTCTCCCTAAGTGCTGGG + Intergenic
1194399618 X:93427288-93427310 GCTTAGTGTCTCAATATGTTAGG - Intergenic
1194451284 X:94047460-94047482 CCTCAGCCTCCCTATGTGCTGGG - Intergenic
1195131059 X:101852717-101852739 GCTTAGCCTCCCAAAGTGCTGGG - Intronic
1195302615 X:103545700-103545722 CCTCAGCCTCCCTATGTGCTGGG - Intergenic
1195365569 X:104122020-104122042 CCTTAGTCTCCCAAAGTGCTGGG + Intronic
1196295033 X:113987330-113987352 CCTTGGTGTCCCAAAGTGCTGGG + Intergenic
1196848611 X:119916749-119916771 GCTTAGCCTCCCAAAGTGCTGGG + Intronic
1197029290 X:121794683-121794705 GCTTAGCCTCCCAAAGTGCTAGG - Intergenic
1197187814 X:123607996-123608018 ACTTGGTCTCCCAATGTGCTGGG - Intronic
1197311576 X:124911793-124911815 GCTTACTATTCCTGTGTGCTAGG + Intronic
1197343058 X:125297364-125297386 CCTTAGCGTCCCAAAGTGCTGGG + Intergenic
1197487671 X:127074315-127074337 CCTTGGTGTCCCAAAGTGCTGGG + Intergenic
1197855020 X:130905021-130905043 ACTTGGTGTCCCAAAGTGCTAGG - Intergenic
1198069519 X:133134312-133134334 CCTCAGTGTCCCAAAGTGCTGGG + Intergenic
1198075954 X:133193144-133193166 TCTTAATGTCCCAAAGTGCTGGG - Intergenic
1198815178 X:140581960-140581982 CCTCAGTGTCCCAAAGTGCTGGG - Intergenic
1200419224 Y:2945724-2945746 CCTTAGCGTCCCAAAGTGCTGGG + Intronic
1201295297 Y:12457538-12457560 GCTTGGCCTCCCAATGTGCTGGG - Intergenic
1201341598 Y:12939925-12939947 CCTTGGTGTCCCAAAGTGCTGGG + Intergenic
1201379427 Y:13357298-13357320 TCTCAGTGTCCCAAAGTGCTCGG - Intronic
1201424084 Y:13830472-13830494 GCTTAAACTCCCTATGTGATTGG + Intergenic
1201935293 Y:19405443-19405465 GCAGAGTGTCTCTAGGTGCTGGG + Intergenic