ID: 1062570344

View in Genome Browser
Species Human (GRCh38)
Location 9:137182099-137182121
Sequence GGCTTAGTGTCCCTATGTGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 604
Summary {0: 1, 1: 0, 2: 1, 3: 14, 4: 588}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1062570344_1062570347 4 Left 1062570344 9:137182099-137182121 CCAGCACATAGGGACACTAAGCC 0: 1
1: 0
2: 1
3: 14
4: 588
Right 1062570347 9:137182126-137182148 GACCTAAGCCCAGGTGTCCGAGG No data
1062570344_1062570353 19 Left 1062570344 9:137182099-137182121 CCAGCACATAGGGACACTAAGCC 0: 1
1: 0
2: 1
3: 14
4: 588
Right 1062570353 9:137182141-137182163 GTCCGAGGCTGCAGGGAGACAGG No data
1062570344_1062570349 11 Left 1062570344 9:137182099-137182121 CCAGCACATAGGGACACTAAGCC 0: 1
1: 0
2: 1
3: 14
4: 588
Right 1062570349 9:137182133-137182155 GCCCAGGTGTCCGAGGCTGCAGG No data
1062570344_1062570345 -5 Left 1062570344 9:137182099-137182121 CCAGCACATAGGGACACTAAGCC 0: 1
1: 0
2: 1
3: 14
4: 588
Right 1062570345 9:137182117-137182139 AAGCCAGAAGACCTAAGCCCAGG No data
1062570344_1062570351 12 Left 1062570344 9:137182099-137182121 CCAGCACATAGGGACACTAAGCC 0: 1
1: 0
2: 1
3: 14
4: 588
Right 1062570351 9:137182134-137182156 CCCAGGTGTCCGAGGCTGCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1062570344 Original CRISPR GGCTTAGTGTCCCTATGTGC TGG (reversed) Intronic
901726177 1:11244041-11244063 GCCTTGGTGTCCCAAAGTGCTGG - Intronic
901891970 1:12274559-12274581 GTCTTAGTCTCCCAAAGTGCTGG + Intronic
902448104 1:16479972-16479994 GCCTTAGTCTCCCAAAGTGCTGG + Intergenic
902610034 1:17591795-17591817 GCCTTGGTGTCCCAAAGTGCTGG + Intronic
903407267 1:23108357-23108379 GCCTTAGTCTCCCAAAGTGCTGG - Intronic
904119730 1:28189913-28189935 GCCTTAGTCTCCCAAAGTGCTGG + Intronic
904129718 1:28266805-28266827 GCCTCAGTGTCCCAACGTGCTGG + Intronic
904186348 1:28708146-28708168 GGCTTAGCCTCCCAAAGTGCTGG + Intronic
904252474 1:29235088-29235110 GCCTCAGTCTCCCAATGTGCAGG - Intergenic
904502186 1:30919990-30920012 GCCTTAGTCTCCCAAAGTGCTGG + Intergenic
904762034 1:32812260-32812282 GCCTTAGTCTCCCAAAGTGCTGG + Intronic
904781462 1:32952491-32952513 GCCTCAGTGTCCCAAAGTGCTGG - Intronic
905142550 1:35859617-35859639 ACCTCAGTCTCCCTATGTGCTGG + Intergenic
905551918 1:38848733-38848755 GTCTTAGTCTCCCAAAGTGCTGG - Intronic
906014982 1:42568362-42568384 GGCTTAGCTTCCCAAAGTGCTGG + Intronic
906371383 1:45256889-45256911 GCCTTGGTGTCCCAAAGTGCTGG + Intronic
906765551 1:48428203-48428225 GGCTCAGTCTCCCAAAGTGCTGG - Intronic
907129019 1:52078310-52078332 GCCTCAGTTTCCCTAAGTGCTGG + Intronic
907310155 1:53534480-53534502 GGCTGAGTGCCTCTATGTGGGGG + Intronic
908239560 1:62177280-62177302 GGCTTAGCCTCCCGAAGTGCTGG - Intergenic
908762912 1:67528391-67528413 GCCTTGGTGTCCCAAAGTGCTGG + Intergenic
909609109 1:77534446-77534468 GGCTTAGGTTCCCCGTGTGCAGG - Intronic
910176788 1:84439573-84439595 GGCTTAGCCTCCCAAAGTGCTGG - Intergenic
910238327 1:85059293-85059315 GCCTTGGTGTCCCAAAGTGCTGG - Intronic
912229476 1:107775329-107775351 GCCTTGGTGTCCCAACGTGCTGG - Intronic
914742701 1:150478691-150478713 GCCTTAGCCTCCCTAAGTGCTGG - Intergenic
914749827 1:150527188-150527210 GGCTCAGCCTCCCAATGTGCTGG + Intergenic
915382289 1:155452804-155452826 GCCTTGGTCTCCCAATGTGCTGG + Intronic
915449918 1:155997634-155997656 GCCTTAGTCTCCCTAAGTGTTGG - Intronic
915985717 1:160462258-160462280 GCCTTGGCGTCCCAATGTGCTGG + Intergenic
917553723 1:176062249-176062271 GCCTCAGTCTCCCAATGTGCTGG + Intronic
917811343 1:178661317-178661339 GGCTTAGCCTCCCAAAGTGCTGG - Intergenic
917839834 1:178969031-178969053 GCCTTGGTCTCCCTAAGTGCTGG - Intergenic
919477641 1:198048961-198048983 GGCTTAGCCTCCCAAAGTGCTGG + Intergenic
919651695 1:200155920-200155942 CGCTTAGTCTCCCCAAGTGCTGG + Intronic
919909772 1:202103702-202103724 GCCTTAGCCTCCCAATGTGCTGG + Intergenic
920020975 1:202956546-202956568 GGCTTAGTGCCATTATGTGCAGG + Intronic
920404048 1:205695949-205695971 GCCTTAGCCTCCCTAAGTGCTGG + Intergenic
921561762 1:216667434-216667456 GCCTTGGTCTCCCGATGTGCTGG - Intronic
922635662 1:227168172-227168194 GCCTCAGTGTCCCAAAGTGCAGG + Intronic
922960471 1:229641771-229641793 GGCTCAGCCTCCCTAAGTGCAGG - Intronic
923669562 1:236028925-236028947 GGCTCAGCCTCCCTAAGTGCTGG - Intronic
924035599 1:239933423-239933445 GTCTTAGTCTCCCAAAGTGCTGG - Intergenic
1062969311 10:1633972-1633994 AGCTCTGTGTCCCTCTGTGCTGG - Intronic
1063304281 10:4882541-4882563 GCCTCAGTCTCCCTAAGTGCTGG + Intergenic
1063356164 10:5400380-5400402 GCCTTAGTCTCCCAAAGTGCTGG - Intronic
1063427645 10:5962340-5962362 GCCTTAGTCTCCCAAAGTGCTGG - Intronic
1064625925 10:17261170-17261192 GCCTTAGTCTCCCAAAGTGCTGG + Intergenic
1065661708 10:28010280-28010302 GCCTTAGCCTCCCTAAGTGCTGG - Intergenic
1065776252 10:29122888-29122910 GCCTTGGTGTCCCAAAGTGCTGG + Intergenic
1069127043 10:64648877-64648899 GTCTCAGTGTCCCAAAGTGCAGG + Intergenic
1069165776 10:65157188-65157210 GCCTTGGTGTCCCAAAGTGCGGG - Intergenic
1070004840 10:72413481-72413503 GCCTTGGTGTCCCAAAGTGCTGG - Intronic
1070262556 10:74871580-74871602 GTCTTAGCCTCCCTAAGTGCTGG - Intronic
1070418215 10:76209809-76209831 TGGATAGTGTCCCCATGTGCTGG - Intronic
1071015091 10:80987610-80987632 GCCTTGGTGTCCCAAAGTGCTGG + Intergenic
1072096683 10:92188470-92188492 GGCTTAGCCTCCCAAAGTGCTGG - Intronic
1073022837 10:100460873-100460895 GCCTTGGTCTCCCAATGTGCTGG - Intergenic
1073350655 10:102817402-102817424 GGCTTGGTTTCCCAAAGTGCTGG + Intergenic
1073419478 10:103412845-103412867 GCCTTGGTGTCCCAAAGTGCTGG + Intronic
1074332846 10:112536387-112536409 TCCTAAGTTTCCCTATGTGCAGG - Intronic
1076233804 10:128848008-128848030 TGATTAGTGTCAATATGTGCTGG - Intergenic
1076316220 10:129543656-129543678 GATTTAGGGTCCTTATGTGCTGG + Intronic
1077008637 11:370372-370394 GCCTCAGTTTCCCTGTGTGCTGG + Intronic
1077022722 11:426248-426270 GCCTTGGTGTCCCCACGTGCTGG - Intronic
1077039575 11:513406-513428 GCCTCAGTGTCCCGAGGTGCTGG + Intergenic
1077337325 11:2011220-2011242 CGCTGGGTGCCCCTATGTGCTGG - Intergenic
1077658532 11:4045699-4045721 GTCTCAGCCTCCCTATGTGCTGG + Intronic
1078810900 11:14762055-14762077 GGCTCAGTTTCCCAAAGTGCTGG - Intronic
1080354889 11:31431560-31431582 GCCTTAGTCTCCCAAAGTGCTGG - Exonic
1082019157 11:47516850-47516872 GCCTCAGTGTCCCCAAGTGCTGG + Intronic
1082021493 11:47537494-47537516 GACTCAGTCTCCCAATGTGCTGG + Intronic
1082100003 11:48164813-48164835 GCCTCAGTGTCCCGAAGTGCTGG + Intronic
1083349884 11:62020055-62020077 GCCTTAGTCTCCCAAAGTGCTGG + Intergenic
1083550753 11:63588317-63588339 GCCTTAGTCTCCCAAAGTGCTGG + Intronic
1083586178 11:63861184-63861206 GCCTTAGCCTCCCTAAGTGCTGG - Intronic
1084082400 11:66836946-66836968 GGCTCAGTCTCCCAAAGTGCTGG + Intronic
1084735151 11:71100617-71100639 GCCTTGGCGTCCCAATGTGCTGG - Intronic
1085094758 11:73751052-73751074 GCCTTAGTGTCCCAAAGTGCTGG + Intronic
1085331694 11:75657358-75657380 GCCTTGGTGTCCCAAAGTGCTGG + Intronic
1085502028 11:77033198-77033220 GCCTTGGTCTCCCTAAGTGCTGG - Intergenic
1085673358 11:78490565-78490587 GCCTCAGTGTCCCAAAGTGCTGG - Intronic
1086019465 11:82209272-82209294 GTCTTGGTGTTCCTAAGTGCTGG - Intergenic
1087085437 11:94213529-94213551 GCCTTAGTTTCCCAAAGTGCTGG + Intergenic
1087893647 11:103563712-103563734 GCCTCAGTGTCCCAAAGTGCTGG - Intergenic
1088844744 11:113655524-113655546 GGCTCAGTCTCCCAAAGTGCTGG - Intergenic
1088877813 11:113950465-113950487 GGAATAGTGTCCCTCTGTGGTGG + Intergenic
1089249509 11:117147445-117147467 GCCTTAGTGTCCCAAAGTGCTGG + Intronic
1089506565 11:118966720-118966742 GGCTTAGCCTCCCAAAGTGCTGG - Intergenic
1089590023 11:119534047-119534069 GTCTGAGTGTCCCTGGGTGCTGG + Intergenic
1090336303 11:125969245-125969267 GCCTTAGTCTCCCAAAGTGCTGG + Intronic
1090356616 11:126144913-126144935 GCCTCAGTGTCCCAAAGTGCTGG + Intergenic
1202820309 11_KI270721v1_random:66402-66424 CGCTGGGTGCCCCTATGTGCTGG - Intergenic
1091425647 12:386595-386617 GCCTCAGTCTCCCAATGTGCTGG - Intronic
1091588400 12:1828780-1828802 GGCTCAGTCTGCCTATATGCAGG - Intronic
1091721078 12:2814192-2814214 GCCTCAGTGTCCCAAAGTGCTGG + Intronic
1092498253 12:9019833-9019855 GCCTTCGTGTCCCAAAGTGCTGG + Intergenic
1094560221 12:31545702-31545724 GGCTTAGCCTCCCAAAGTGCTGG - Intronic
1094576006 12:31686194-31686216 GGCTCAGTCTCCCAAAGTGCTGG - Intronic
1094625495 12:32119620-32119642 GCCTTGGTCTCCCTAAGTGCTGG - Intronic
1095767227 12:45910305-45910327 GCCTCAGCGTCCCAATGTGCTGG - Intergenic
1095907235 12:47390920-47390942 GCCTTGGTGTCCCAAAGTGCTGG + Intergenic
1096151950 12:49319762-49319784 GCCTTGGTGTCCCAAAGTGCTGG + Intergenic
1096327807 12:50681179-50681201 GCCTCAGTGTCCCAAAGTGCTGG - Intronic
1096357608 12:50954914-50954936 TGCTCAGTGGCCCTCTGTGCTGG + Intronic
1096527343 12:52218785-52218807 GCCTTGGTGTCCCAAAGTGCTGG + Intergenic
1096724104 12:53547231-53547253 GCCTCAGTGTCCCAAAGTGCTGG + Intronic
1097116156 12:56698853-56698875 GCCTTGGTGTCCCAAAGTGCTGG + Intergenic
1097813535 12:64045681-64045703 GGCTTAGCTTCCCAAAGTGCTGG + Intronic
1098303704 12:69080361-69080383 GGCTTAGCCTCCCAAAGTGCTGG - Intergenic
1098383599 12:69895579-69895601 GGCTTAGAGGCCCTGTGTTCTGG - Intronic
1098671061 12:73232010-73232032 GGCTTTGTCTCCCTATGTCCTGG - Intergenic
1100350761 12:93779836-93779858 GCCTTAGTCTCCCAAAGTGCTGG + Intronic
1100403407 12:94251739-94251761 GCCTCAGTGTCCCAAAGTGCTGG - Intronic
1100672406 12:96830923-96830945 GCCTTGGTTTCCCAATGTGCTGG + Intronic
1101129032 12:101669685-101669707 GCCTTAGTCTCCCAAAGTGCTGG - Intronic
1101209235 12:102519754-102519776 GGCTCTGTGTTCCTCTGTGCTGG + Intergenic
1101359401 12:104011920-104011942 ACCTTAGTGTCCCAAAGTGCTGG - Intronic
1101982964 12:109423409-109423431 GCCTTGGTCTCCCAATGTGCTGG + Intronic
1102103237 12:110297862-110297884 GCCTTAGCGTCCCAAAGTGCTGG + Intronic
1102107333 12:110336582-110336604 GGCTAGGTGTCCCTAACTGCAGG - Intronic
1102115203 12:110397646-110397668 GCCTTGGTGTCCCAAAGTGCTGG - Intronic
1102257309 12:111423731-111423753 GCCTTGGTCTCCCTAAGTGCTGG - Intronic
1102306457 12:111808453-111808475 GCCTCAGTGTCCCAAAGTGCTGG - Intronic
1102390616 12:112545976-112545998 GGCTTAGCCTCCCAAAGTGCTGG - Intergenic
1102508367 12:113398183-113398205 GCCTTAGTCTCCCTAGGAGCTGG + Intronic
1102524461 12:113501431-113501453 GGCTGAGTATCCCATTGTGCAGG - Intergenic
1102837036 12:116074143-116074165 GCCTTGGTGTCCCAAAGTGCTGG - Intronic
1103142075 12:118557296-118557318 GCCTCAGTGTCCCAAAGTGCTGG - Intergenic
1103577045 12:121885711-121885733 GCCTTAGCCTCCCAATGTGCTGG - Intergenic
1103616559 12:122156791-122156813 GCCTTAGTGTCCCAAAGTGTTGG - Intergenic
1103788702 12:123453802-123453824 GCCTTGGTTTCCCAATGTGCTGG + Intergenic
1103861978 12:124022848-124022870 GCCTCAGTGTCCCAAAGTGCTGG + Intronic
1104158409 12:126155024-126155046 GGCTCTGTGTTCCTATGTTCTGG - Intergenic
1104317980 12:127721818-127721840 GCCTTAGTCTCCCAAAGTGCTGG - Intergenic
1104624917 12:130343874-130343896 GGCTTAGCCTCCCAAAGTGCTGG + Intronic
1105055762 12:133097766-133097788 GCCTCAGTCTCCCAATGTGCTGG + Intronic
1105271706 13:18882410-18882432 GCCTTGGTCTCCCTAAGTGCTGG - Intergenic
1105384827 13:19920056-19920078 GCCTTGGTCTCCCAATGTGCTGG + Intergenic
1105909253 13:24845976-24845998 GCCTTAGTGTCCCAAAGTGCTGG - Intronic
1106145054 13:27042778-27042800 GCCTTAGTCTCCCAAAGTGCTGG + Intergenic
1106145438 13:27045554-27045576 GGCTTAGTGTACCTAACTGATGG + Intergenic
1106367279 13:29093193-29093215 GTCTTAGTCTCCCAAAGTGCTGG - Intronic
1106979345 13:35258411-35258433 GCCTCAGCGTCCCTAAGTGCTGG + Intronic
1107205561 13:37781827-37781849 AGCTGAGTGTCCCTGTCTGCTGG - Intronic
1107394065 13:39996920-39996942 GGCTCAGGGTCCTTCTGTGCTGG - Intergenic
1107502212 13:40991524-40991546 GCCTTAGTCTCCCAAAGTGCTGG + Intronic
1108001037 13:45906138-45906160 GACTTGGTGTCCCAAAGTGCTGG + Intergenic
1109092918 13:58071361-58071383 GCCTTAGTCTCCTTAAGTGCTGG + Intergenic
1109466740 13:62744418-62744440 GGCTTAGCCTCCCAAAGTGCTGG + Intergenic
1110998323 13:82142349-82142371 GCCTCAGTCTCCCAATGTGCTGG - Intergenic
1111352523 13:87050034-87050056 GCCTTAGTCTCCCAAAGTGCTGG + Intergenic
1112621763 13:101060538-101060560 GCCTCAGTTTCCCAATGTGCTGG + Intronic
1113306275 13:109082583-109082605 GCCTTAGTCTCCCAAAGTGCTGG - Intronic
1113490586 13:110688658-110688680 GCCTTAGTCTCCCAAAGTGCTGG - Intronic
1115234176 14:31192076-31192098 GTCTCAGTGTCCCAAAGTGCTGG - Intronic
1115252290 14:31362216-31362238 GTCTTAGCCTCCCAATGTGCTGG + Intronic
1116878024 14:50133447-50133469 GCCTTGGTCTCCCAATGTGCTGG + Intronic
1117784850 14:59272327-59272349 GCCTTAGTCTCCCAAAGTGCTGG - Intronic
1118341649 14:64898698-64898720 GGCTTAGCCTCCCAAAGTGCTGG - Intergenic
1118396425 14:65340927-65340949 GCCTTGGTGTCCCAAAGTGCTGG + Intergenic
1118448441 14:65873741-65873763 GCCTTAGTCTCCCAAAGTGCTGG + Intergenic
1119026712 14:71158315-71158337 GCCTTGGTGCCCCTATGTGCAGG - Intergenic
1119414571 14:74460897-74460919 GCCTTGGTGTCCCAAAGTGCTGG + Intergenic
1120899386 14:89562507-89562529 GCCTCAGTGTCCCCAAGTGCTGG + Intronic
1121584133 14:95051305-95051327 GCCTTAGTTCCCCTCTGTGCAGG - Intergenic
1123712967 15:23003900-23003922 GCCTCAGTTTCCCAATGTGCTGG + Intronic
1123902809 15:24893365-24893387 GCCTTAGGTTCCCAATGTGCTGG - Intronic
1123910621 15:24963365-24963387 GGCTTAGCCTCCCAAAGTGCTGG - Intronic
1123989913 15:25675694-25675716 GCCTTAGCGTCCCAAAGTGCTGG - Intergenic
1125504082 15:40257011-40257033 GGCTTGGTGTTCCTAAGTCCCGG - Intronic
1125607125 15:40946173-40946195 TGCTGAGTGTTCCTATGTGACGG + Intergenic
1126042029 15:44600902-44600924 GCCTTAGTCTCCCAAAGTGCTGG - Intronic
1126451732 15:48815967-48815989 GGCTTAGCCTCCCAAAGTGCTGG - Intergenic
1126728246 15:51655037-51655059 GCCTTAGTCTCCCAAAGTGCTGG + Intergenic
1126759132 15:51953371-51953393 GCCTTGGTGTCCCAAAGTGCTGG - Intronic
1127086421 15:55428201-55428223 GCCTCAGTGTCCCAAAGTGCTGG + Intronic
1127434806 15:58946573-58946595 GCCTTGGTGTCCCAAAGTGCTGG - Intronic
1127926180 15:63545718-63545740 GCCTTAGCCTCCCAATGTGCTGG - Intronic
1128247680 15:66144104-66144126 GGCTTAGTGTCCGTGTGTGCTGG - Intronic
1128284769 15:66427764-66427786 GGCTCAGCGTCCCAAAGTGCTGG - Intronic
1128295654 15:66516753-66516775 GCCTTAGCCTCCCAATGTGCTGG + Intronic
1129315648 15:74742005-74742027 GCCTTGGTGTCCCAAAGTGCTGG - Intergenic
1129375860 15:75130922-75130944 GGCTTGGTCTCCCAAAGTGCTGG + Intergenic
1129754590 15:78089779-78089801 GCCTTGGTGTCCCAAAGTGCTGG + Intronic
1130104143 15:80916732-80916754 GCCTAAGTGTCCCTGTGTGATGG - Intronic
1131011396 15:89021100-89021122 GCCTTAGCCTCCCAATGTGCTGG + Intergenic
1131969167 15:97875167-97875189 GGCTTTGTGGCCATCTGTGCTGG + Intergenic
1132060692 15:98690090-98690112 GTCTTAGTCTCCCAAAGTGCTGG - Intronic
1132759997 16:1504183-1504205 GGCTTAGCCTCCCAAAGTGCTGG - Intronic
1133935715 16:10267616-10267638 GCCTTGGTGTCCCAAAGTGCTGG - Intergenic
1134030321 16:10987103-10987125 GTCTTAGCCTCCCAATGTGCTGG + Intronic
1135399877 16:22159296-22159318 GCCTTGGTCTCCCTAAGTGCTGG - Intergenic
1135624963 16:23986499-23986521 GCCTTGGTGTCCCAAAGTGCTGG + Intronic
1135780462 16:25295360-25295382 GCCTTGGTCTCCCAATGTGCTGG - Intergenic
1136154417 16:28373682-28373704 GCCTCAGTGTCCCAAAGTGCTGG + Intergenic
1136208673 16:28741582-28741604 GCCTCAGTGTCCCAAAGTGCTGG - Intergenic
1136383431 16:29907886-29907908 GCCTTAGCCTCCCAATGTGCTGG - Intronic
1136399468 16:30009927-30009949 GGCTTGGAGGCCCCATGTGCTGG - Intronic
1136471084 16:30480747-30480769 GGCTAAGCCTCCCAATGTGCTGG - Intronic
1136537181 16:30906845-30906867 GCCTTAGCCTCCCAATGTGCTGG - Intergenic
1137033298 16:35544650-35544672 GCCTTGGTGTCCCAAAGTGCTGG - Intergenic
1137367752 16:47875468-47875490 GCCTTAGCCTCCCAATGTGCTGG + Intergenic
1137653932 16:50143911-50143933 GCCTTAGTCTCCCAAAGTGCTGG - Intergenic
1138171862 16:54858904-54858926 GGCTCAGTTTCCCAAAGTGCTGG + Intergenic
1138485812 16:57342708-57342730 GTCTCAGTGTCCCAAAGTGCTGG - Intergenic
1139716005 16:68813711-68813733 GCCTCAGCGTCCCTAAGTGCTGG - Intronic
1139823155 16:69736606-69736628 GCCTTAGCCTCCCAATGTGCTGG - Intergenic
1140338045 16:74130364-74130386 GCCTTAGCGTCCCAAAGTGCTGG - Intergenic
1140562392 16:75998445-75998467 GCCTCAGTGTCCCAAAGTGCTGG - Intergenic
1140737886 16:77914874-77914896 GCCTTAGTCTCCCAAAGTGCTGG - Intronic
1143076948 17:4352342-4352364 GTCTTAGTCTCCCAAAGTGCTGG + Intronic
1143624235 17:8099818-8099840 GCCTTAGCCTCCCAATGTGCTGG - Intronic
1144532352 17:16051660-16051682 GCCTTAGCGTCCCCACGTGCTGG - Intronic
1146304537 17:31720918-31720940 GCCTTAGTCTCCCAAAGTGCTGG - Intergenic
1146512681 17:33463708-33463730 TGATTAGTGTCCCTAAGTCCTGG + Intronic
1146724015 17:35142790-35142812 GCCTCAGTGTCCCAAAGTGCTGG + Intergenic
1147273428 17:39294222-39294244 GCCTCAGTCTCCCAATGTGCTGG + Intronic
1147972852 17:44229101-44229123 GGCTTGGTCTCCCAAAGTGCTGG + Intergenic
1148242741 17:46011145-46011167 GCCTTAGTCTCCCAAAGTGCTGG - Intronic
1149188759 17:54032562-54032584 GCCTCAGTCTCCCAATGTGCTGG - Intergenic
1149327464 17:55546799-55546821 GCCTTAGTCTCCCAAAGTGCTGG - Intergenic
1149460508 17:56826201-56826223 GCCTTAGTCTCCCAAAGTGCTGG + Intronic
1149828517 17:59850937-59850959 GTCTTGGTCTCCCAATGTGCTGG - Intergenic
1149891807 17:60396324-60396346 GCCTTAGTCTCCCAAAGTGCTGG + Intronic
1149903481 17:60503633-60503655 GCCTTAGCCTCCCAATGTGCTGG + Intronic
1149915373 17:60603511-60603533 GCCTTTGTGTCCCAAAGTGCTGG - Intronic
1149945191 17:60917840-60917862 GCCTTGGTGTCCCAAAGTGCTGG + Intronic
1150301632 17:64052114-64052136 GGCTTAGCCTCCCAAAGTGCTGG - Intronic
1150513875 17:65786833-65786855 GCCTTCGTCTCCCTAAGTGCTGG + Intronic
1150610108 17:66726971-66726993 GCCTTGGTGTCCCAAAGTGCTGG + Intronic
1150758200 17:67935172-67935194 GCCTTAGTCTCCCAAAGTGCTGG - Intronic
1151465350 17:74281505-74281527 GGCTTGGCCTCCCAATGTGCTGG + Exonic
1151609980 17:75166537-75166559 GCCTTAGCCTCCCAATGTGCTGG - Intronic
1151737118 17:75950200-75950222 GGCTTGGCGTCCCAAAGTGCTGG + Intronic
1153050097 18:893918-893940 GCCTTGGTGTCCCAAAGTGCTGG + Intergenic
1153464855 18:5378078-5378100 GCCTTGGTCTCCCAATGTGCTGG + Intergenic
1154160322 18:11976600-11976622 GGCTCAGTCTCCCAAAGTGCTGG + Intergenic
1154345660 18:13541801-13541823 GGCTTGGTCTCCCAAAGTGCTGG - Intronic
1154377460 18:13822070-13822092 GGCCCAGGGGCCCTATGTGCAGG - Intergenic
1154943982 18:21142534-21142556 GCCTCAGTCTCCCTAGGTGCTGG + Intergenic
1155219845 18:23674329-23674351 GTCTTAGGCTCCCTAAGTGCTGG + Intergenic
1157264645 18:46207635-46207657 GCCTTGGTGTCCCAAAGTGCTGG + Intronic
1157841845 18:50966515-50966537 GCCTCAGTGTCCCAAAGTGCTGG - Intergenic
1159595742 18:70381287-70381309 GCCTTAGTCTCCCAAAGTGCTGG - Intergenic
1160084821 18:75766777-75766799 GCCTCAGTCTCCCAATGTGCTGG - Intergenic
1160359387 18:78258609-78258631 GGCTCAGTCTCCCAAAGTGCTGG - Intergenic
1160439591 18:78879252-78879274 GGCTGAGTGCGCCCATGTGCGGG + Intergenic
1161352062 19:3799052-3799074 GCCTTAGTCTCCCAAAGTGCTGG + Intronic
1162036863 19:7944975-7944997 GCCTCAGTGTCCCAAAGTGCTGG - Intergenic
1162251706 19:9450041-9450063 GCCTCAGTGTCCCAAAGTGCTGG - Intergenic
1162295162 19:9808414-9808436 GCCTTGGTGTCCCAAAGTGCTGG + Intergenic
1162920970 19:13902680-13902702 GTCTTGGTGTCCCAAAGTGCTGG - Intronic
1163096296 19:15059809-15059831 GCCTTAGCCTCCCTAAGTGCTGG - Intergenic
1163633974 19:18430040-18430062 ACCTGAGTGTCCCTGTGTGCTGG + Intronic
1163877725 19:19888311-19888333 GCCTTGGTCTCCCAATGTGCTGG + Intronic
1165208398 19:34211535-34211557 GGCTTTGCCTCCCTAAGTGCTGG - Intronic
1166220207 19:41359451-41359473 GCCTTAGTCTCCCAAAGTGCTGG - Intronic
1166234882 19:41448333-41448355 GCCTCAGTCTCCCTAAGTGCTGG - Intergenic
1166724148 19:45015483-45015505 GCCTTAGTCTCCCAAGGTGCTGG - Intronic
1166724511 19:45018153-45018175 GCCTTAGTCTCCCAAAGTGCTGG - Intronic
1166841724 19:45701523-45701545 GCCTTGGTCTCCCTAAGTGCTGG + Intronic
1166952085 19:46436105-46436127 GGCTCAGTCTCCCAAAGTGCTGG + Intergenic
1167199349 19:48053620-48053642 GGCTTGGCGTCCCAAAGTGCTGG + Intronic
1167614929 19:50527434-50527456 GCCTCAGTGTCCCAAAGTGCTGG + Intronic
1167895692 19:52578993-52579015 GCCTTAGCCTCCCAATGTGCTGG + Intronic
1168105107 19:54161789-54161811 GCCTTAGTCTCCCGAAGTGCTGG + Intronic
1168427372 19:56249519-56249541 GGCTCAGCCTCCCAATGTGCTGG + Intronic
925554606 2:5115821-5115843 GGCTTAGTGTCCTTATGAAACGG - Intergenic
925573047 2:5331931-5331953 GCCTTGGTCTCCCTAAGTGCTGG - Intergenic
925768725 2:7262242-7262264 GCCTTAGTCTCCCAAAGTGCTGG + Intergenic
925887525 2:8405750-8405772 GCCTTGGTCTCCCAATGTGCTGG - Intergenic
925939977 2:8807870-8807892 GGCTTAGCCTCCCAAAGTGCTGG - Intronic
926822445 2:16867304-16867326 GCCTTAGTCTCCCAAAGTGCTGG + Intergenic
927544324 2:23939858-23939880 GCCTTGGTCTCCCAATGTGCTGG - Intronic
927551266 2:24002153-24002175 GCTTTAGTGTCCCAAAGTGCTGG - Exonic
929300787 2:40301665-40301687 GCCTTAGCCTCCCAATGTGCTGG - Intronic
929639673 2:43565186-43565208 TGCTTAGTCTCCCAAAGTGCTGG - Intronic
929744475 2:44641805-44641827 GGCTTAGCCTCCCAAAGTGCTGG + Intronic
930589917 2:53315258-53315280 TGCACAGAGTCCCTATGTGCAGG + Intergenic
931375098 2:61699962-61699984 GCCTCAGTGTCCCAAAGTGCTGG + Intergenic
931651475 2:64472693-64472715 GGCTCAGTCTCCCAAAGTGCTGG + Intergenic
932095049 2:68839802-68839824 GCCTTGGTCTCCCAATGTGCTGG - Intergenic
932178114 2:69621230-69621252 GCCTTAGTTTCCCAAAGTGCTGG - Intronic
932233181 2:70099371-70099393 GCCTTAGTCTCCCAAAGTGCTGG + Intergenic
932248863 2:70222027-70222049 GCCTTAGTCTCCCAAAGTGCTGG + Intronic
932713412 2:74084376-74084398 CGCTTGGTCTCCCTAAGTGCTGG - Intronic
932857863 2:75256509-75256531 GCCTTAGTCTCCCAAAGTGCTGG + Intergenic
933323206 2:80803231-80803253 GCCTCAGTCTCCCTAAGTGCTGG + Intergenic
933730251 2:85450813-85450835 GCCTCAGTGTCCCAAAGTGCTGG - Intergenic
936512648 2:113160692-113160714 GCCTCAGTCTCCCTAAGTGCTGG - Intronic
936743704 2:115547522-115547544 GCCTTAGTGTCCCAAAGTGCTGG - Intronic
938381919 2:130841311-130841333 GCCTTAGTCTCCCAAAGTGCTGG + Intronic
938891992 2:135715098-135715120 GGCTCAGCCTCCCTAAGTGCTGG - Intronic
938894680 2:135738273-135738295 GCCTCAGTCTCCCAATGTGCTGG + Intergenic
940028828 2:149238832-149238854 GCCTCAGTCTCCCAATGTGCTGG - Intergenic
941301889 2:163812758-163812780 GCCTTAGTCTCCCAAAGTGCTGG + Intergenic
941713135 2:168735954-168735976 GCCTCAGTGTCCCAAAGTGCTGG - Intronic
942039879 2:172049232-172049254 GCCTTAGTCTCCCAAAGTGCTGG + Intronic
942170866 2:173288312-173288334 GCCTTAGCCTCCCTAAGTGCTGG - Intergenic
942942327 2:181632884-181632906 GGTTTAGTTTCCCTATGAGTAGG - Intronic
942942509 2:181635639-181635661 TGTTTAGTGTCCATCTGTGCAGG - Intronic
943183604 2:184576203-184576225 GCCTTAGCTTCCCAATGTGCTGG - Intergenic
943300462 2:186191395-186191417 GCCTTAGTCTCCCAAAGTGCTGG - Intergenic
943855343 2:192783199-192783221 GCCTTAGCCTCCCTAAGTGCTGG - Intergenic
945073429 2:206013907-206013929 GGCTTGGTCTCCCAAAGTGCTGG - Intronic
945076905 2:206048642-206048664 GGCTCAGTGTCCCAAACTGCTGG - Intronic
945109978 2:206353459-206353481 GCCTTAGCCTCCCAATGTGCTGG + Intergenic
945816770 2:214614323-214614345 GGCCTAGTTTCCCTTTCTGCAGG + Intergenic
946501298 2:220250049-220250071 GCCTTGGTGTCCCAAAGTGCTGG + Intergenic
946694746 2:222343740-222343762 GTCTCAGCGTCCCTAAGTGCTGG - Intergenic
947065829 2:226224758-226224780 GCCTTGGTGTCCCAAAGTGCTGG - Intergenic
947768444 2:232652347-232652369 TGCTCAGTGTCCCCATGTCCAGG - Intronic
947973804 2:234346679-234346701 GCCTCAGTCTCCCTAAGTGCTGG - Intergenic
948706854 2:239799968-239799990 GGCTTAGTATCCCTAATGGCTGG - Exonic
1169335504 20:4752629-4752651 GCCTCAGTGTCCCAAAGTGCTGG - Intergenic
1169573884 20:6936795-6936817 GGCTTGGTCTCCCAAAGTGCTGG + Intergenic
1170404915 20:16025894-16025916 GTCTTGGTGTCCCAAAGTGCTGG - Intronic
1170463641 20:16602374-16602396 GCCTTAGTCTCCCAAGGTGCTGG - Intergenic
1170985767 20:21256834-21256856 GCCTCAGTGTCCCAAAGTGCTGG - Intergenic
1171509607 20:25670829-25670851 GCCTTGGTGTCCCAAAGTGCTGG + Intergenic
1171991924 20:31703290-31703312 GCCTTGGTGTCCCAATGTGCTGG + Intronic
1172116529 20:32576576-32576598 GCCTTAGTTTCCCCATCTGCAGG + Intronic
1172164669 20:32891941-32891963 GCCTTAGCCTCCCTAAGTGCTGG + Intronic
1172199347 20:33114288-33114310 GGCTTGGTCTCCCAAAGTGCTGG - Intergenic
1172721981 20:37006147-37006169 GGCTTAGCTTCCCAAAGTGCTGG + Intronic
1172730823 20:37085896-37085918 GGCTTGGTCTCCCAAAGTGCTGG + Intronic
1173396677 20:42686739-42686761 GCCTCAGTGTCCCAAAGTGCTGG + Intronic
1173581830 20:44152424-44152446 GCCTTAGTCTCCCTAAGAGCTGG - Intronic
1173932208 20:46830219-46830241 GCCTCAGTCTCCCAATGTGCTGG + Intergenic
1174090751 20:48044997-48045019 GCCTCAGTGTCCCAAAGTGCCGG + Intergenic
1174458551 20:50666807-50666829 GCCTTAGTCTCCCAAAGTGCTGG + Intronic
1175095633 20:56539264-56539286 TGCTTAGTCTCCCAAAGTGCTGG + Intergenic
1175111695 20:56653015-56653037 GCCTTAGTCTCCCAAAGTGCTGG + Intergenic
1175114858 20:56674805-56674827 GCCTTGGTGTCCCAAAGTGCTGG + Intergenic
1175153709 20:56955088-56955110 GGCTGCATGTCCCTGTGTGCGGG + Intergenic
1175703403 20:61157185-61157207 GCCTTAGTCTCCCAAAGTGCTGG + Intergenic
1177075416 21:16565494-16565516 GCCTTAGTCTCCCAAAGTGCAGG - Intergenic
1177262386 21:18748288-18748310 GCCTTAGTCTCCCAAAGTGCTGG + Intergenic
1178138798 21:29658509-29658531 GTCTTGGTCTCCCTAAGTGCTGG + Intronic
1178690807 21:34748008-34748030 GCCTTGGCCTCCCTATGTGCTGG + Intergenic
1178813638 21:35907233-35907255 GCCTTAGTCTCCCAAAGTGCTGG - Intronic
1179506463 21:41844922-41844944 GGCTGTGTGTCCCTGTGTGGGGG - Intronic
1179707480 21:43190538-43190560 GGCTTGGTCTCCCAAAGTGCTGG + Intergenic
1180113928 21:45683675-45683697 GCCTTAGTCTCCCAAAGTGCTGG - Intronic
1180617302 22:17136787-17136809 GCCTTGGTGTCCCAAAGTGCTGG - Intergenic
1181008211 22:20024611-20024633 GGCTTAGTCACCCTCTGTTCAGG + Intronic
1181964914 22:26649663-26649685 GCCTCAGTGTCCCAAAGTGCTGG - Intergenic
1182141718 22:27965281-27965303 GCCTTGGTGTCCCAAAGTGCTGG + Intergenic
1182464185 22:30504302-30504324 GCCTTAGTATCCCAAAGTGCTGG + Intronic
1183054622 22:35297129-35297151 GACTTAGTCTCCCAAAGTGCTGG - Intergenic
1183159121 22:36099072-36099094 GTCTTAGTTTCCCAAAGTGCTGG + Intergenic
1183164392 22:36136584-36136606 GCCTTGGTCTCCCAATGTGCTGG + Intergenic
1183860052 22:40663299-40663321 GCCTCAGTCTCCCAATGTGCTGG - Intergenic
1185080602 22:48707563-48707585 GGCCCAGTGTCCCTGTGTGAGGG + Intronic
949116448 3:331489-331511 GCCTCAGTGTCCCAAAGTGCTGG + Intronic
949306846 3:2651599-2651621 GGCTCAGTCTCCCAAAGTGCTGG - Intronic
949917183 3:8974216-8974238 GGCTTGGTCTCCCAAAGTGCTGG + Intergenic
950506232 3:13396496-13396518 GGCTTAGCCTCCCAAAGTGCTGG - Intronic
950882352 3:16333127-16333149 TGCCTAGTGTTCCTAAGTGCAGG - Intronic
951141567 3:19168274-19168296 GGCTCAGTCTCCCAAAGTGCTGG + Intronic
952371008 3:32722732-32722754 GCCTCAGTCTCCCAATGTGCTGG - Intronic
952439338 3:33309909-33309931 TGCTTAGTCTCCCAAAGTGCTGG - Intronic
952751676 3:36830063-36830085 GCCTTGGTGTCCCAAGGTGCTGG - Intronic
952782794 3:37119909-37119931 GCCTCAGTGTCCCAAAGTGCTGG + Intronic
953602082 3:44376837-44376859 GCCTTAGTCTCCCAAAGTGCTGG - Intronic
953802669 3:46038265-46038287 GGCTTGGTCTCCCAAAGTGCTGG + Intergenic
953887602 3:46724995-46725017 GCCTTAGTCTCCCAAAGTGCTGG - Intronic
954000930 3:47556428-47556450 GGCTTGGTCTCCCAAAGTGCTGG + Intergenic
954216449 3:49127233-49127255 GCCTCAGTGTCCCAAAGTGCTGG + Intronic
954265365 3:49467266-49467288 GCCTTAGTTTCCCAAAGTGCTGG + Intergenic
954352500 3:50056541-50056563 GCCTCAGTCTCCCAATGTGCTGG + Intronic
954547553 3:51451364-51451386 GGCTTGGTTTCCCAAGGTGCTGG - Intronic
954840474 3:53507357-53507379 TGCTAAGTGTCCCAAAGTGCTGG - Intronic
955201164 3:56853582-56853604 GCCTTAGTCTCCCAAAGTGCTGG + Intronic
955321815 3:57979887-57979909 GGCCTTGTGGCCCTATGTCCTGG - Intergenic
955427230 3:58804610-58804632 GCCTTAGTCTCCCAAAGTGCTGG + Intronic
955651805 3:61202800-61202822 GCCTTGGTGTCCCAAAGTGCTGG - Intronic
957053674 3:75428671-75428693 GCCTCAGCCTCCCTATGTGCTGG + Intergenic
957695096 3:83626029-83626051 GCCTCAGTGTCCCAAAGTGCTGG - Intergenic
958882353 3:99687091-99687113 GCCTTAGTCTCCCAAAGTGCTGG + Intronic
960113561 3:113870110-113870132 GCCTCAGTCTCCCAATGTGCTGG - Intronic
960306080 3:116062257-116062279 GCCTTGGTGTCCCAAAGTGCTGG - Intronic
960414891 3:117372251-117372273 GCCTTAGTCTCCCAAAGTGCTGG + Intergenic
961649485 3:128410296-128410318 AGCTTTCTGTCCCAATGTGCAGG - Intergenic
963508587 3:146219665-146219687 GCCTCAGTGTCCCAAAGTGCTGG - Intronic
965220599 3:165921578-165921600 GGCTTAGCCTCCCAAAGTGCTGG - Intergenic
965827796 3:172748022-172748044 GCCTTAGTCTCCCAAAGTGCTGG + Intergenic
966923934 3:184632306-184632328 GCCTTGGTCTCCCTAAGTGCTGG + Intronic
967166096 3:186780741-186780763 GGCTTAGCTTCCCAAAGTGCTGG + Intergenic
967547721 3:190751435-190751457 GGCTCAGTCTCCCAAAGTGCTGG + Intergenic
967785963 3:193496539-193496561 GTCTCAGTGTCCCAAAGTGCTGG - Intronic
967803691 3:193693388-193693410 GCCTTGGTCTCCCTAAGTGCTGG - Intronic
967957923 3:194892154-194892176 CACTTAGTTGCCCTATGTGCTGG - Intergenic
968216123 3:196892394-196892416 GGCTTAGCCTCCCAAAGTGCTGG + Intronic
968278474 3:197458392-197458414 GCCTTAGGGTGCCTGTGTGCAGG - Intergenic
968312461 3:197695362-197695384 GGCTTGGCCTCCCTAAGTGCTGG - Intronic
968595666 4:1481294-1481316 GCCTTGGTGTCCCAAAGTGCTGG - Intergenic
968803356 4:2756850-2756872 GGCTCAGTGTCCCCAGGTGACGG - Intergenic
969603932 4:8192739-8192761 GCCTTGGTCTCCCTAAGTGCTGG + Intronic
969658843 4:8514524-8514546 GCCTCAGCCTCCCTATGTGCTGG + Intergenic
970109493 4:12621541-12621563 GCCTTATTGTGCCTAGGTGCTGG - Intergenic
971164719 4:24171160-24171182 GTCTCAGTGTCCCAAAGTGCTGG - Intergenic
971423835 4:26497442-26497464 GCCTTGGTCTCCCTAAGTGCTGG + Intergenic
971648966 4:29246838-29246860 GCCTTAGTCTCCCAAAGTGCTGG - Intergenic
971668760 4:29528759-29528781 GCCTCAGTGTCCCAAAGTGCTGG + Intergenic
971714865 4:30162989-30163011 GTCTTAGTCTCCCAATGTGTTGG - Intergenic
971763806 4:30803686-30803708 GCCTTGGTGTCCCAAAGTGCTGG + Intronic
972582097 4:40404057-40404079 GGCTCAGTCTCCCAAAGTGCTGG + Intergenic
973139416 4:46747549-46747571 GCCTCAGTGTCCCAAAGTGCTGG + Intronic
973178288 4:47235300-47235322 GCCTTAGTCTCCCAAAGTGCTGG - Intronic
973232929 4:47863430-47863452 GCCTTAGTCTCCCAAAGTGCTGG - Intronic
973540829 4:51933771-51933793 GCCTTAGCCTCCCAATGTGCTGG - Intergenic
973605229 4:52580310-52580332 GCCTTGGTGTCCCAAAGTGCTGG + Intergenic
974664171 4:64936508-64936530 GCCTTAGTCTCCCAAAGTGCTGG - Intergenic
975123491 4:70755700-70755722 GCCTCAGTGTCCCAAAGTGCTGG - Intronic
976261940 4:83154175-83154197 GCCTTAGTCTCCCAAAGTGCTGG - Intergenic
976599533 4:86925464-86925486 GCCTTAGTCTCCCAAAGTGCTGG + Intronic
977260036 4:94786936-94786958 GCCTCAGTGTGCCTAAGTGCTGG + Intronic
977283988 4:95079006-95079028 GCCTTAGCGTCCCAAAGTGCTGG + Intronic
977605493 4:98980675-98980697 GCCTCAGTGTCCCAAAGTGCTGG + Intergenic
977871614 4:102097005-102097027 GAGTTAGTATCCCTATGGGCAGG - Intergenic
977958345 4:103056051-103056073 GGCTTGGTCTCCCAAAGTGCTGG + Intronic
978779130 4:112531654-112531676 GCCTTGGTGTCCCAAAGTGCTGG - Intergenic
979182179 4:117743866-117743888 GCCTTGGTCTCCCAATGTGCTGG - Intergenic
979280028 4:118856759-118856781 GCCTTGGTGTCCCAAAGTGCTGG + Intronic
979413305 4:120405843-120405865 GCCTTGGTCTCCCTAAGTGCTGG + Intergenic
980178542 4:129376076-129376098 GCCTCAGTCTCCCAATGTGCTGG - Intergenic
980277144 4:130667504-130667526 GGCTTGGCCTCCCTAAGTGCTGG + Intergenic
980781292 4:137495511-137495533 GGTTCAGTGTTCCTATTTGCTGG - Intergenic
980929340 4:139170509-139170531 GCCTCAGTGTCCCAAAGTGCTGG + Intronic
984113648 4:175650552-175650574 GCCTTAGTCTCCCAAAGTGCTGG + Intronic
984280888 4:177669738-177669760 GCCTTAGGGTCCCAAAGTGCTGG + Intergenic
984502405 4:180572691-180572713 GCCTTAGCTTCCCTAAGTGCTGG + Intergenic
986228053 5:5835534-5835556 GCCTTGGTGTCCCAAAGTGCTGG - Intergenic
986850135 5:11802316-11802338 GCCTTAGTCTCCCAAAGTGCTGG - Intronic
988508314 5:31843513-31843535 GCCTTAGCCTCCCTAAGTGCTGG + Intronic
988567786 5:32333486-32333508 GCCTTAGTCTCCCAAAGTGCTGG + Intergenic
988577441 5:32441224-32441246 GCCTTAGCCTCCCAATGTGCTGG + Intronic
989024513 5:37051074-37051096 GCCTCAGTGTCCCAAAGTGCTGG + Intronic
989413281 5:41144514-41144536 GCCTTGGTGTCCCAAAGTGCTGG + Intronic
990002805 5:50914363-50914385 GCCTCAGTCTCCCAATGTGCTGG + Intergenic
990234819 5:53755808-53755830 GCCTTAGTCTCCCAAAGTGCTGG - Intergenic
990251976 5:53925444-53925466 GCCTTGGTGTCCCAAAGTGCTGG + Intronic
990404898 5:55479274-55479296 GCCTTAGTCTCCCAAAGTGCTGG + Intronic
990550024 5:56866161-56866183 GCCTTAGTCTCCCAAGGTGCTGG - Intronic
991425363 5:66486429-66486451 GGCTTGGTCTCCCAAAGTGCTGG - Intergenic
991518466 5:67466515-67466537 GCCTCAGTCTCCCTAAGTGCTGG + Intergenic
991916681 5:71612604-71612626 GCCTTAGCCTCCCAATGTGCTGG + Intronic
991928579 5:71729407-71729429 GGCTCAGTCTCCCAAAGTGCTGG - Intergenic
992437852 5:76772671-76772693 GCCTTAGTCTCCCAAAGTGCTGG - Intergenic
995757610 5:115526108-115526130 GCCTTAGTCTCCCAAAGTGCTGG + Intronic
998164179 5:139833081-139833103 GGCTTGCTGCCCCTCTGTGCAGG + Intronic
999463931 5:151783104-151783126 GCCTTGGTGTCCCAAAGTGCTGG + Intronic
999779456 5:154837376-154837398 GCCTTAGTCTCCCAAAGTGCTGG + Intronic
999783820 5:154873153-154873175 GGCTTGGTCTCCCAAAGTGCTGG + Intronic
1000553023 5:162690375-162690397 GGCTTGGCCTCCCTAAGTGCTGG - Intergenic
1001579535 5:172789447-172789469 GGCTCAGGGTCCCTTGGTGCTGG + Intergenic
1001788046 5:174430796-174430818 GGCTTAGCCTCCCAATGTGCTGG - Intergenic
1002507255 5:179688300-179688322 GGCTTAGCCTCCCAAAGTGCTGG + Intronic
1002542388 5:179914778-179914800 GCCTTAGTGTCTCAAAGTGCTGG - Intronic
1003560358 6:7174856-7174878 GCCTCAGTGTCCCTAAGTGCTGG + Intronic
1004329986 6:14712664-14712686 GCCTCAGTGTCCCAAAGTGCTGG + Intergenic
1005081710 6:21962773-21962795 GGCTCAGTCTCCCAAAGTGCTGG + Intergenic
1005096370 6:22121021-22121043 GCCTTGGTCTCCCAATGTGCTGG + Intergenic
1005568646 6:27123225-27123247 GCCTTGGTGTCCCAAAGTGCTGG - Intergenic
1006264356 6:32905546-32905568 GCCTTGGTCTCCCAATGTGCTGG - Intergenic
1007490263 6:42215674-42215696 GCCTCAGTGTCCCAAAGTGCTGG + Intronic
1008836143 6:55832859-55832881 GCCTTAGTCTCCCAAAGTGCTGG - Intronic
1010467668 6:76188179-76188201 GCCTTAGCCTCCCTAAGTGCTGG - Intergenic
1011296191 6:85828704-85828726 GCCTCAGTCTCCCAATGTGCTGG - Intergenic
1011415469 6:87115258-87115280 GTCTTAATGTCCCTTGGTGCTGG - Intergenic
1011758010 6:90525436-90525458 GCCTCAGTCTCCCTAAGTGCTGG + Intronic
1011907259 6:92387309-92387331 GCCCTAGTCTCCCTAAGTGCTGG - Intergenic
1012874682 6:104712522-104712544 GCCTTAGCCTCCCAATGTGCTGG - Intergenic
1013336555 6:109168843-109168865 GCCTCAGTGTCCCAAAGTGCTGG + Intergenic
1014819865 6:125975823-125975845 GCCTTGGTGTCCCAAAGTGCTGG + Intronic
1014893072 6:126866679-126866701 GTCTTAGCCTCCCTAAGTGCTGG - Intergenic
1015016487 6:128419361-128419383 GCCTTGGTGTCCCAAAGTGCTGG - Intronic
1016560117 6:145387370-145387392 GGCTTTAGGTCCCTATGTGTGGG - Intergenic
1017099689 6:150836910-150836932 GCCTTAGCCTCCCTAAGTGCTGG - Intronic
1017313894 6:153006098-153006120 GCCTTAGTCTCCCAAAGTGCTGG + Exonic
1017659832 6:156663195-156663217 GGCTTGGTCTCCCAATATGCTGG - Intergenic
1018367412 6:163135434-163135456 GCCTTGGTGTCCCAAAGTGCTGG + Intronic
1019680375 7:2344667-2344689 GCCTCAGTGTCCCAAAGTGCTGG - Intronic
1019719995 7:2563455-2563477 GGCTTTGAGTCCCAAAGTGCCGG + Intronic
1020206809 7:6124123-6124145 GCCTCAGTCTCCCTAAGTGCTGG + Intronic
1020216028 7:6191196-6191218 GCCTCAGTGTCCCAAAGTGCTGG - Intronic
1020395549 7:7713087-7713109 GCCTTAGCCTCCCAATGTGCTGG - Intronic
1021198077 7:17694464-17694486 GCCTTGGTGTCCCAAAGTGCTGG + Intergenic
1022140017 7:27485563-27485585 GCCTCAGTGTCCCAAAGTGCTGG + Intergenic
1022715960 7:32898788-32898810 GCCTCAGCCTCCCTATGTGCTGG + Intergenic
1023702187 7:42903889-42903911 GCCTTAGTGTCCCTAGTAGCTGG + Intergenic
1023822812 7:43989333-43989355 GCCTTAGTCTCCCAAAGTGCTGG - Intergenic
1024071394 7:45788628-45788650 GCCTTAGTCTCCCTGTGGGCTGG + Intergenic
1024182056 7:46906554-46906576 GACTTAGTCTCCCAAAGTGCTGG - Intergenic
1024259964 7:47566788-47566810 GCCTGGGTGTCCCTAAGTGCTGG - Intronic
1025170303 7:56750421-56750443 GCCTCAGTGTCCCAAAGTGCTGG + Intergenic
1025650567 7:63464697-63464719 GGCTCAGTCTCCCAAAGTGCTGG - Intergenic
1025701581 7:63825285-63825307 GCCTCAGTGTCCCAAAGTGCTGG - Intergenic
1025792685 7:64704926-64704948 GCCTTGGTCTCCCAATGTGCTGG + Intronic
1025909166 7:65813651-65813673 GCCTTAGTCTCCCAATGGGCTGG + Intergenic
1025939215 7:66061815-66061837 GCCTTAGTCTCCCAAAGTGCTGG - Intergenic
1025952917 7:66159810-66159832 GCCTTAGTCTCCCAAAGTGCTGG - Intergenic
1025979811 7:66396108-66396130 GCCTTAGTCTCCCAATGGGCTGG - Intronic
1026096735 7:67352363-67352385 GCCTTGGTCTCCCAATGTGCTGG - Intergenic
1026288831 7:68987649-68987671 GCCTCAGTGTCCCAAAGTGCTGG + Intergenic
1026426567 7:70300443-70300465 GACTTAGTGTGCCTACCTGCAGG + Intronic
1027204678 7:76088368-76088390 GCCTTAGTCTCCCAATGGGCTGG - Intergenic
1027253442 7:76414244-76414266 GCCTTAGCGTCCCAAAGTGCTGG + Intronic
1027707738 7:81555337-81555359 GGCATAGTGGCCCTATCTGTTGG - Intergenic
1029142372 7:98420473-98420495 GCCTTGGTCTCCCAATGTGCTGG + Intergenic
1029242278 7:99171795-99171817 GGGTCAGTGTCCCTGTTTGCAGG - Intergenic
1029346885 7:99985030-99985052 GCCTTGGTGTCCCAAAGTGCTGG - Intergenic
1029380720 7:100212707-100212729 GGCTCAGCCTCCCTAAGTGCTGG + Intronic
1029609995 7:101621833-101621855 GCCTCAGTCTCCCTAAGTGCTGG + Intronic
1029751076 7:102542748-102542770 GCCTTAGTCTCCCAAAGTGCTGG - Intronic
1029769029 7:102641859-102641881 GCCTTAGTCTCCCAAAGTGCTGG - Intronic
1030027037 7:105334468-105334490 GCCTTAGTCTCCCAAAGTGCTGG + Intronic
1030869028 7:114733235-114733257 GGCTTAGTGTACCTGTCTTCAGG + Intergenic
1032140373 7:129324130-129324152 GCCTTGGTGTCCCAAAGTGCTGG + Intronic
1032539586 7:132692166-132692188 GCCTTAGTCTCCCAAAGTGCTGG - Intronic
1032879711 7:136076132-136076154 GCCTTAGTCTCCCAAAGTGCTGG + Intergenic
1033060719 7:138104446-138104468 GCCTCAGTGTCCCAAAGTGCTGG - Intronic
1034702903 7:153111696-153111718 GCCTTAGCGTCCCAAAGTGCTGG - Intergenic
1035102270 7:156410612-156410634 GCCTTGGTGTCCCAAAGTGCTGG - Intergenic
1036832209 8:12029646-12029668 GGCTCAGCCTCCCTAAGTGCTGG + Intergenic
1036902419 8:12680437-12680459 GGCTCAGCCTCCCTAAGTGCTGG + Intergenic
1036945628 8:13091995-13092017 GGCTTAGCCTCCCAAAGTGCTGG - Intronic
1036989183 8:13572336-13572358 GCCTTGGTGTCCCAAAGTGCTGG + Intergenic
1038522047 8:28242299-28242321 GCCTTAGTTTCCCAATGTGCTGG - Intergenic
1038727352 8:30093760-30093782 GTCTTAGCCTCCCAATGTGCTGG + Intergenic
1038794893 8:30701214-30701236 GTCTTAGTCTCCCAAAGTGCTGG - Intronic
1039062009 8:33579468-33579490 GGCTTAGCCTCCCAAAGTGCTGG + Intergenic
1039813791 8:41073824-41073846 GCCTTGGTTTCCCTAAGTGCTGG - Intergenic
1039818488 8:41115625-41115647 GCCTCAGTGTCCCAAAGTGCTGG + Intergenic
1039844212 8:41314318-41314340 GCCTTACTTTCCCTAAGTGCTGG - Intergenic
1040467654 8:47710125-47710147 GCCTTGGTCTCCCAATGTGCTGG + Intronic
1043014377 8:74920071-74920093 GCCTTAGTCTCCCAAAGTGCTGG + Intergenic
1043423689 8:80126730-80126752 GCCTCAGCCTCCCTATGTGCTGG + Intronic
1043874924 8:85475056-85475078 GCCTTGGTGTCCCAAGGTGCTGG - Intronic
1045282422 8:100760683-100760705 GCCTTGGTGTCCCAAAGTGCTGG + Intergenic
1046749961 8:117916661-117916683 GCCTTGGTGTCCCAAAGTGCTGG - Intronic
1046904374 8:119556356-119556378 GCCTTAGTGTCCCAAAGTGCTGG + Intergenic
1047217850 8:122892931-122892953 GCCTTAGTCTCCCAAAGTGCTGG + Intronic
1047989238 8:130268234-130268256 GCCTCAGTCTCCCTAAGTGCTGG - Intronic
1048351535 8:133620489-133620511 GCCTTAGTCTCCCAAAGTGCTGG - Intergenic
1048712994 8:137232942-137232964 GCCTTGGTGTCCCAAAGTGCTGG - Intergenic
1049015938 8:139920094-139920116 GGCTTAGCCTCCCAAAGTGCTGG - Intronic
1050527973 9:6562808-6562830 GCCTTAGCCTCCCAATGTGCTGG + Intronic
1050732779 9:8728445-8728467 GCCTCAGTCTCCCAATGTGCTGG + Intronic
1050960815 9:11728140-11728162 AGCTTGGTGTCCCAAAGTGCTGG - Intergenic
1051394423 9:16604545-16604567 AGCTCAGTGTCCCTAAGTGCTGG - Intronic
1051636641 9:19186776-19186798 GCCTTAGTCTCCCAAAGTGCTGG - Intergenic
1051765195 9:20515193-20515215 GCCTTAGTCTCCCAAAGTGCTGG + Intronic
1051778694 9:20664726-20664748 GACTTAGCATCCCAATGTGCTGG + Intronic
1052806927 9:33021571-33021593 GCCTTGGTGTCCCAAAGTGCTGG - Intronic
1052938825 9:34115825-34115847 GCCTTAGTCTCCCAAAGTGCGGG + Intronic
1052940990 9:34132027-34132049 GCCTTAGTCTCCCAAAGTGCTGG - Intergenic
1053909706 9:42885152-42885174 GCCTCAGTGTCCCAAAGTGCTGG - Intergenic
1055289762 9:74770592-74770614 GGCTGGGTGTGCCTATGTGTGGG - Intronic
1055304402 9:74914164-74914186 GCCTTTGTGTCCCAAAGTGCTGG - Intergenic
1055423941 9:76173721-76173743 GCCTTAGCCTCCCTAAGTGCTGG - Intronic
1055800731 9:80032810-80032832 GCCTTAGTGTTTCTCTGTGCGGG + Intergenic
1056281968 9:85050551-85050573 GCCTTAGTCTCCCAAAGTGCTGG + Intergenic
1056648219 9:88433330-88433352 GCCTTGGTCTCCCTAAGTGCTGG + Intronic
1056671977 9:88638274-88638296 GGCTTTGAGTCCCTATGTGTTGG + Intergenic
1056804666 9:89719275-89719297 GCCTTAGTATACCTGTGTGCAGG - Intergenic
1057055681 9:91958845-91958867 GACTTAGCGTCCCAAAGTGCTGG - Intergenic
1058047367 9:100370899-100370921 GCCTTAGTCTCCCAAAGTGCTGG - Intergenic
1058290232 9:103231977-103231999 GCCTTAGGTTCCCAATGTGCTGG + Intergenic
1058413622 9:104762981-104763003 GGCTCAGCCTCCCTAAGTGCTGG - Intergenic
1059144111 9:111882453-111882475 ACCTTAGTCTCCCAATGTGCTGG - Intergenic
1060939002 9:127532781-127532803 GCCTTAGTCTCCCAAAGTGCTGG - Intronic
1061161098 9:128894541-128894563 GCCTTGGTGTCCCAAAGTGCTGG - Intronic
1061215422 9:129218940-129218962 GGCTTAGCCTCCCAAAGTGCTGG + Intergenic
1061501606 9:131006566-131006588 GCCTTAGCCTCCCAATGTGCTGG + Intergenic
1062301218 9:135871677-135871699 GCCTTGGTCTCCCAATGTGCTGG - Intronic
1062570344 9:137182099-137182121 GGCTTAGTGTCCCTATGTGCTGG - Intronic
1185501957 X:603739-603761 GGCTCAGTCTCCCAAAGTGCTGG - Intergenic
1185976336 X:4724901-4724923 GCCTTAGTTTCCCAAAGTGCTGG + Intergenic
1186203230 X:7175234-7175256 GCCTTAGTCTCCCAAAGTGCTGG - Intergenic
1187358292 X:18599702-18599724 GCCTCAGTCTCCCCATGTGCTGG + Intronic
1189392386 X:40587018-40587040 GCCTCAGCCTCCCTATGTGCTGG - Intronic
1189477923 X:41370863-41370885 GCCTTAGCTTCCCTAAGTGCTGG + Intergenic
1190687165 X:52885547-52885569 GCCTCAGTCTCCCTAAGTGCTGG + Intergenic
1190698817 X:52970245-52970267 GCCTCAGTCTCCCTAAGTGCTGG - Intronic
1190824090 X:54001076-54001098 GCCTCAGTCTCCCAATGTGCTGG - Intronic
1190922524 X:54869243-54869265 GCCTCAGTCTCCCAATGTGCTGG + Intergenic
1193421574 X:81289606-81289628 GTCTTAGTCTCCCAAAGTGCTGG - Intronic
1193653541 X:84169919-84169941 GCCTTAGTTTCCCAAAGTGCTGG - Intronic
1194103834 X:89742807-89742829 GGCTCAGTCTCCCAAAGTGCTGG + Intergenic
1194202752 X:90974806-90974828 GCCTTGGTCTCCCTAAGTGCTGG + Intergenic
1194451286 X:94047461-94047483 GCCTCAGCCTCCCTATGTGCTGG - Intergenic
1195302617 X:103545701-103545723 GCCTCAGCCTCCCTATGTGCTGG - Intergenic
1195365567 X:104122019-104122041 GCCTTAGTCTCCCAAAGTGCTGG + Intronic
1196848610 X:119916748-119916770 GGCTTAGCCTCCCAAAGTGCTGG + Intronic
1197187815 X:123607997-123608019 GACTTGGTCTCCCAATGTGCTGG - Intronic
1197343056 X:125297363-125297385 GCCTTAGCGTCCCAAAGTGCTGG + Intergenic
1197487669 X:127074314-127074336 GCCTTGGTGTCCCAAAGTGCTGG + Intergenic
1198069517 X:133134311-133134333 GCCTCAGTGTCCCAAAGTGCTGG + Intergenic
1198815180 X:140581961-140581983 GCCTCAGTGTCCCAAAGTGCTGG - Intergenic
1201295298 Y:12457539-12457561 GGCTTGGCCTCCCAATGTGCTGG - Intergenic
1201341596 Y:12939924-12939946 GCCTTGGTGTCCCAAAGTGCTGG + Intergenic