ID: 1062570346

View in Genome Browser
Species Human (GRCh38)
Location 9:137182120-137182142
Sequence ACACCTGGGCTTAGGTCTTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 213
Summary {0: 1, 1: 0, 2: 1, 3: 15, 4: 196}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1062570346_1062570349 -10 Left 1062570346 9:137182120-137182142 CCAGAAGACCTAAGCCCAGGTGT 0: 1
1: 0
2: 1
3: 15
4: 196
Right 1062570349 9:137182133-137182155 GCCCAGGTGTCCGAGGCTGCAGG No data
1062570346_1062570353 -2 Left 1062570346 9:137182120-137182142 CCAGAAGACCTAAGCCCAGGTGT 0: 1
1: 0
2: 1
3: 15
4: 196
Right 1062570353 9:137182141-137182163 GTCCGAGGCTGCAGGGAGACAGG No data
1062570346_1062570351 -9 Left 1062570346 9:137182120-137182142 CCAGAAGACCTAAGCCCAGGTGT 0: 1
1: 0
2: 1
3: 15
4: 196
Right 1062570351 9:137182134-137182156 CCCAGGTGTCCGAGGCTGCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1062570346 Original CRISPR ACACCTGGGCTTAGGTCTTC TGG (reversed) Intronic
900139203 1:1132422-1132444 ACACATGGGCTCAGGGCTACGGG - Intergenic
900311983 1:2037917-2037939 ACACCTTGGTTTTGGACTTCGGG + Intergenic
900387083 1:2415644-2415666 TCCCCTGGGCTTCCGTCTTCTGG + Intergenic
901692733 1:10984156-10984178 ACACCTGGATTTTGGACTTCTGG - Intergenic
901778210 1:11575213-11575235 ACACCTTGACTTCGGACTTCTGG + Intergenic
901930264 1:12592598-12592620 ACACCTGGAGTTTGGACTTCTGG + Intronic
902302810 1:15514520-15514542 GGACTTGGGCCTAGGTCTTCTGG - Intronic
905578298 1:39063489-39063511 ACACCTGGGTTTCAGACTTCTGG + Intergenic
907249296 1:53127532-53127554 ATACCAGGGCTTGGGTCATCGGG - Intronic
910476298 1:87611043-87611065 CCTCCTGGGCTTAGGACTACAGG - Intergenic
917405271 1:174699215-174699237 ACTCCTGGGCTTAAGTGATCTGG + Intronic
918533961 1:185553748-185553770 ACACCTTGGCTTAGAACTTCTGG - Intergenic
919934782 1:202244430-202244452 ACACCTTGGTTTAGAACTTCTGG - Intronic
919996475 1:202756088-202756110 AGACCTGGTCTCAGGCCTTCAGG + Intronic
921330209 1:214028121-214028143 ACATCTGGGCTTAGGACTAAAGG - Intronic
923681489 1:236122159-236122181 ACACTTGGGCTTGGGTGGTCAGG - Intergenic
924683255 1:246259941-246259963 ACACCTAGGCAGAGCTCTTCTGG - Intronic
1063656595 10:7996486-7996508 ACACTTGGGCTTAGTATTTCTGG + Intronic
1067795034 10:49314773-49314795 ACTCCTGGCCTTGGGTCTTATGG - Intronic
1069794314 10:71042527-71042549 ACACCTTGGTTTTGGACTTCTGG + Intergenic
1070682264 10:78456837-78456859 ACACCCTGACTTAGGACTTCTGG + Intergenic
1070906533 10:80078502-80078524 ACACCTGGGCTCAGGTCTGGAGG - Intergenic
1073244595 10:102080741-102080763 ACACCTTGGTTTGGGACTTCTGG + Intergenic
1074844985 10:117389906-117389928 ACAAGTGGTCTTAGGGCTTCAGG - Intergenic
1079188345 11:18256800-18256822 TCTGCTGGGCTTAGGTCTCCTGG + Intergenic
1079366005 11:19810733-19810755 ACACCTGGGCCTGGGCCTTATGG + Intronic
1079665315 11:23097345-23097367 AGACATGGGGTTAGGTCTTGAGG + Intergenic
1084430603 11:69108672-69108694 ACACCTGGGTCTTGGGCTTCGGG + Intergenic
1086919845 11:92573802-92573824 ACACCTTGGTTTTGGGCTTCTGG + Intronic
1087721940 11:101676035-101676057 ACACGTGGACTTAGTTCTTTTGG - Intronic
1088536592 11:110868140-110868162 ACTCCTGGGACTAGTTCTTCTGG - Intergenic
1089178433 11:116564564-116564586 TCACCTGGTCCTAGGTCTCCTGG - Intergenic
1089757012 11:120694686-120694708 ACACTGAGGCTTAGGTCTCCTGG + Intronic
1090889427 11:130910194-130910216 CCACCTTGGCTTGGGTGTTCTGG + Intronic
1091048921 11:132350558-132350580 ACACCTGTGCTCAGGTCCCCTGG + Intergenic
1092085088 12:5750458-5750480 ACACCTTGCCTTGGGTCTTATGG + Intronic
1094073778 12:26450176-26450198 ACACCTTGGCTTAGGACTTTCGG + Intronic
1101002233 12:100368169-100368191 ACACCTTGGGTTTGGACTTCTGG - Intronic
1101852865 12:108418185-108418207 ACACCTTGACTTTGGACTTCTGG - Intergenic
1106034583 13:26032211-26032233 CCTCCTGGGCTGAGGTCTTTGGG - Intergenic
1106594796 13:31126827-31126849 ACACCTTGGCTTCAGACTTCTGG + Intergenic
1107088837 13:36454030-36454052 ACACCTGGGCTTAGGTTGGAGGG + Intergenic
1107482838 13:40799154-40799176 CCACCTGGGAGTAAGTCTTCAGG - Exonic
1108498363 13:51046264-51046286 ACACCTTGGCTTTAGACTTCTGG + Intergenic
1110725082 13:78813001-78813023 AAACATAGGCTTAGGTGTTCTGG + Intergenic
1111467792 13:88640225-88640247 CCAGCTGGGCTTATGGCTTCCGG + Intergenic
1112956424 13:105064337-105064359 ACACCTGGACTTGTGACTTCTGG + Intergenic
1113113008 13:106844921-106844943 ACACCTTGATTTTGGTCTTCTGG - Intergenic
1113876820 13:113599864-113599886 ACCCTTGTGCTTAGGGCTTCAGG + Intronic
1120575977 14:86181332-86181354 ACACCTTGATTTAGGACTTCTGG + Intergenic
1121432256 14:93895916-93895938 ACACCTTGATTTTGGTCTTCTGG + Intergenic
1122121946 14:99559252-99559274 ACACCTTGACTTTGGACTTCTGG + Intronic
1122621207 14:103058313-103058335 ACACCTAGGCATTGGTCTGCAGG - Intergenic
1125810571 15:42537157-42537179 TCACTTGGGCTCAGGTGTTCAGG + Intronic
1128613558 15:69092224-69092246 ATACCTGGGCTCAGGATTTCCGG - Intergenic
1130769527 15:86910784-86910806 ACACCTGGGCTTAGGTGCTCAGG - Intronic
1131465439 15:92651266-92651288 ACACCTGGGAGTGGGGCTTCTGG - Intronic
1132534834 16:473039-473061 ACACCTTGGCTTTGGACTTCGGG + Intronic
1132850825 16:2024160-2024182 GCACCTGGGCAAAGGTGTTCAGG - Intergenic
1133017302 16:2949981-2950003 ACACCTGGGGTTGGGGCCTCTGG + Exonic
1133487089 16:6230742-6230764 ACACCTGGGCTGTGACCTTCTGG + Intronic
1134673652 16:16074327-16074349 ACTCCTGGGCTGTGGTCATCTGG + Intronic
1136284737 16:29234095-29234117 ACACCTGGATTTTGGTCTCCAGG - Intergenic
1138375790 16:56563173-56563195 ACACCTGGTCATGGGTCTCCTGG + Intergenic
1139392195 16:66612053-66612075 GCACCTGGGCTTCAGTCTTGGGG + Intronic
1140716346 16:77728809-77728831 ACACCTGGGCACAGCCCTTCAGG + Intronic
1141315922 16:82962368-82962390 ACACCTTGATTTAGGTCTTCTGG + Intronic
1141498857 16:84429851-84429873 ACACCTGGACCTCGGACTTCTGG - Intronic
1142089756 16:88203563-88203585 ACACCTGGATTTTGGTCTCCAGG - Intergenic
1142183040 16:88680901-88680923 ACACCTGGATTTTGGACTTCTGG + Intronic
1142551795 17:745318-745340 ACTCCTGGGCAAAGGGCTTCAGG + Exonic
1142839146 17:2613524-2613546 CCACCTGGGCCTGGGTCTTGAGG + Intronic
1142970227 17:3606425-3606447 ACTCCTGGGCAGAGGTCTTTAGG - Intergenic
1143083435 17:4398033-4398055 ACACCCGGCCTTAGGCCATCAGG + Intergenic
1143333160 17:6152715-6152737 ACACCTTGGTTTTGGACTTCTGG + Intergenic
1144754518 17:17671046-17671068 ACACCTTGACTTTGGACTTCCGG + Intergenic
1147950532 17:44105213-44105235 ACCCCTGGGCTCAGATGTTCTGG - Intronic
1150452944 17:65284399-65284421 ACACCTTGACTTTGGACTTCTGG - Intergenic
1150587360 17:66531134-66531156 ACACCTGAGCACAGGGCTTCAGG + Intronic
1150653171 17:67022997-67023019 ACACCTTGACTTCGGGCTTCTGG - Intronic
1150691253 17:67369122-67369144 TCACCTGAGCTTAGGCCGTCAGG - Intergenic
1151356970 17:73564869-73564891 ACAGCTGGGCTTTGGGCATCTGG + Intronic
1152192660 17:78897911-78897933 ACATCTGGGCAGAGGTCTTTGGG + Intronic
1152366065 17:79857162-79857184 ACACCTTGATTTAGGACTTCTGG + Intergenic
1152762576 17:82116712-82116734 TCACCTGTGCTCAGGTCTTTAGG - Intronic
1154267423 18:12891191-12891213 ACACCTTGGTTTTGGACTTCTGG + Intronic
1157114620 18:44851470-44851492 ACACCTGGACTCAGCTCTTCTGG + Intronic
1158208116 18:55016433-55016455 GCACCTGGGCCCAGATCTTCTGG - Intergenic
1159375439 18:67586418-67586440 ACCCCTGGTTTTAGGTCTTCAGG - Intergenic
1159845380 18:73452647-73452669 CCAACTGGGCATAGGTTTTCAGG - Intergenic
1159957607 18:74530714-74530736 ACACCTGGGCTTGCCACTTCTGG + Intergenic
1160622357 18:80180174-80180196 TCACCTGGGCTTGGGTGTCCAGG + Intronic
1160954999 19:1687060-1687082 ACCCCTGGGCTGGGGGCTTCGGG + Intergenic
1161127458 19:2566389-2566411 ACACCTTGGCCTTGGACTTCCGG + Intronic
1161421185 19:4176729-4176751 ACACCTGGATTTTGGACTTCTGG + Intronic
1162141153 19:8586292-8586314 ATACCTGGGCTGAGGTTCTCTGG - Intronic
1164040918 19:21492038-21492060 ACACCTGGGCTTAGGGCCACAGG + Intergenic
1164126829 19:22326105-22326127 ATACCTGGGCTTAGGGCCACGGG + Intergenic
1164128350 19:22338912-22338934 ACACCTGGGCTTAGGGCCACAGG - Intergenic
1164170304 19:22719140-22719162 ATACCTGGGCTTAGGGCAACAGG - Intergenic
1164172495 19:22737606-22737628 ATACCTGGGCTTAGGGCCACGGG - Intergenic
1164204457 19:23046402-23046424 ATACATGGGCTTAGGTCCACAGG - Intergenic
1165303433 19:34987901-34987923 ACACCTTGACTTTGGCCTTCTGG + Intergenic
929816944 2:45240079-45240101 AGACCTGGCCCTAGGTCTTTAGG - Intergenic
929854819 2:45627995-45628017 ACACCTTGACTTTGGACTTCTGG - Intergenic
931644145 2:64406236-64406258 ACACCTGGGCTGAGCTCTTGTGG + Intergenic
932941764 2:76175007-76175029 ACACCTTGGCTTTGGACTTCTGG - Intergenic
933991019 2:87633896-87633918 ACACCTGGCCTCTGGCCTTCAGG + Intergenic
935135927 2:100301712-100301734 GGACCAGGGTTTAGGTCTTCTGG - Intronic
935394214 2:102588372-102588394 ACAACAGGGCTTAGCTCCTCGGG - Intergenic
936302820 2:111316927-111316949 ACACCTGGCCTCTGGCCTTCAGG - Intergenic
937082365 2:119149446-119149468 AGACCTGGGCTTCAATCTTCAGG + Intergenic
940117343 2:150223575-150223597 ACAGCTGAGCTCAGATCTTCAGG + Intergenic
940766249 2:157792520-157792542 ACACCTGACCATAGGTCATCTGG - Intronic
941818323 2:169820795-169820817 TCACCTGAGCTCAGGTATTCGGG - Intronic
942969745 2:181943640-181943662 TCACCAGGGCTAAGGTCTTTGGG - Intergenic
945907330 2:215609857-215609879 ACACCTGGATTTTGGACTTCTGG - Intergenic
948362970 2:237435677-237435699 AGACCTGTCCTCAGGTCTTCTGG - Intergenic
1174382294 20:50163895-50163917 ACATCTGGGCCTAGGGCTCCTGG - Intergenic
1175860222 20:62146488-62146510 ACCCCTGGACTTGGGACTTCTGG - Intronic
1176267957 20:64220610-64220632 ACAGCTGGACTTTGCTCTTCAGG - Intronic
1178877792 21:36426111-36426133 ACCCCTTGACTTAGGACTTCTGG - Intergenic
1182890616 22:33815654-33815676 ACACCTGGGCTTGCCACTTCAGG + Intronic
1182901405 22:33901267-33901289 ACACCTTGGCTTTGGACTTCTGG + Intronic
1184805835 22:46794317-46794339 ACACGTGGGCTCAGGTCTGTAGG + Intronic
1185273757 22:49941115-49941137 ACACCAGGGCAGGGGTCTTCCGG - Intergenic
950533223 3:13565172-13565194 ACACCTGGGGTTACGTACTCAGG - Intronic
950622587 3:14217657-14217679 ACACCTGGCCTTATCCCTTCAGG + Intergenic
951232101 3:20191217-20191239 ACACCTTGGCTTTGGACGTCTGG + Intergenic
951843303 3:27058317-27058339 ACACTGAGGCTTAGGTCTCCAGG + Intergenic
953028877 3:39163234-39163256 ACACCTTGACTTAGGACTTCTGG - Intergenic
954329118 3:49879963-49879985 ACAACTGGCCTGAGGTCTCCTGG + Intergenic
961452563 3:127008999-127009021 ACACCTTGGCCTGGCTCTTCAGG - Intronic
963034509 3:141013749-141013771 ACAGCTGGCCTTAGTTTTTCTGG + Intergenic
964153421 3:153556765-153556787 AAACTTGGGCTTTAGTCTTCTGG + Intergenic
967095216 3:186172329-186172351 ACACCAGGGTTCAGGTCTTGGGG + Intronic
968976923 4:3826978-3827000 ACACCCAGGCTTTGGGCTTCTGG - Intergenic
969047359 4:4346085-4346107 ACACCTTGACTTTGGACTTCTGG - Intergenic
969539787 4:7780470-7780492 ACATATGGGCTTAGGTCTTTAGG + Intronic
971745480 4:30574437-30574459 ACACCTAGGGTTTGGACTTCTGG + Intergenic
978446599 4:108786528-108786550 AGATCTGGGCTTAGATCTTCCGG - Intergenic
979199689 4:117962176-117962198 ACACCTTTGCTTAGGGGTTCTGG - Intergenic
979511401 4:121557739-121557761 ACACCTTGACTTTGGGCTTCTGG + Intergenic
980881269 4:138712195-138712217 ACTCCTGGGCTCAAGTCATCAGG + Intergenic
984796822 4:183669373-183669395 ACACCTGGCCTCAGCTCTCCAGG + Intronic
985986794 5:3522739-3522761 ACACCTTGGTTTTGGACTTCTGG + Intergenic
986163090 5:5249107-5249129 ACTCCTGGTCCTAGGCCTTCAGG - Intronic
986231128 5:5865757-5865779 ACATCTGGACTTTGGACTTCTGG - Intergenic
986348329 5:6854636-6854658 ACACCTTGCCTTTGGACTTCTGG + Intergenic
987602565 5:20090803-20090825 ACACCTGGGCTCAAGTGATCTGG - Intronic
990977018 5:61569305-61569327 ACAGCTGGGTCTAGGTCCTCGGG - Intergenic
992481981 5:77160211-77160233 ACACCTGGGCTTGGTGCTTTGGG - Intergenic
992887041 5:81169364-81169386 ACACCTTGGTTTTGGACTTCTGG - Intronic
993706557 5:91178104-91178126 TCACCTGGGCTCAGGAGTTCGGG + Intergenic
995469989 5:112491115-112491137 ACACCCGGGTTTTGGACTTCTGG + Intergenic
996131300 5:119784579-119784601 AAACTTGGACTTGGGTCTTCGGG + Intergenic
997616445 5:135249388-135249410 ACACCTGGGTTTTGAACTTCTGG - Intronic
998082443 5:139287984-139288006 ACTCCTGGGCTTATGTGATCTGG - Intronic
998537961 5:142951912-142951934 ACACCTTGGTTCAGGACTTCTGG - Intronic
1008305872 6:49899410-49899432 ACACCTTGACTTAAGACTTCTGG + Intergenic
1008591522 6:52998105-52998127 ACATCTGTGCTGAGGTCTACTGG + Intergenic
1013364897 6:109429608-109429630 CTGCCTGGGCTTAGGTCTCCAGG + Intronic
1015414674 6:132934720-132934742 ACACCTTGATTTAGGACTTCTGG + Intergenic
1017878503 6:158543510-158543532 ACACCTGGATTTCGGACTTCTGG - Intronic
1018891857 6:167988372-167988394 ACACCTTGGGTTTGGACTTCTGG + Intergenic
1022117067 7:27270482-27270504 ATCAGTGGGCTTAGGTCTTCAGG - Intergenic
1024520571 7:50302316-50302338 AAACCTGTGCCTTGGTCTTCAGG - Intergenic
1025745888 7:64242427-64242449 ACACCTGGGCTTAGGGCAATGGG - Intronic
1025784339 7:64630875-64630897 ATACCTGGGCTTAGGGCCACAGG + Intergenic
1026973823 7:74484192-74484214 GAACCTGGACTTGGGTCTTCAGG + Intronic
1030820801 7:114088016-114088038 ACACATGGGTCTAGGTCTTTGGG - Intronic
1032474532 7:132203102-132203124 TGACCTGGGCTGAGGGCTTCTGG - Intronic
1033041172 7:137919496-137919518 ACACCTGGGCCTAGGTCACATGG + Intronic
1034162850 7:149005569-149005591 CCACCTGGGCACAGGTCTTAAGG - Intronic
1037889674 8:22617211-22617233 ACACCTGGGCTTTTTTCCTCAGG - Intronic
1038227234 8:25668723-25668745 ACTCCTCTGCTTAGGGCTTCTGG - Intergenic
1038345930 8:26732472-26732494 ACACCTTGACTTTGGACTTCTGG + Intergenic
1038417234 8:27406014-27406036 ACACCTTGATTTAGGACTTCTGG - Intronic
1038682062 8:29677978-29678000 ACACCTGAGCCAAGGTCTTTTGG + Intergenic
1040713494 8:50219219-50219241 AATGCTGGGCTTAGGTCTTTTGG - Intronic
1041706050 8:60847332-60847354 ACAACTGGAACTAGGTCTTCAGG - Intronic
1044585771 8:93868152-93868174 ACACCTTGGTTTTGGACTTCTGG + Intronic
1045511363 8:102814422-102814444 ACACTTGAGCTGGGGTCTTCTGG + Intergenic
1046069978 8:109239214-109239236 ACACCTTGATTTTGGTCTTCTGG - Intergenic
1046690764 8:117282025-117282047 ACACCTTGACTTTGGACTTCTGG - Intergenic
1046697332 8:117356815-117356837 ACACCTGGATTTAGGATTTCTGG - Intergenic
1049616202 8:143576782-143576804 ACACCTGGGCTTTGGCCGCCAGG + Exonic
1049875065 8:145012078-145012100 AGAGCTGGACTTAGATCTTCTGG + Intergenic
1050175681 9:2867402-2867424 ACACCTGGATTTTGGACTTCTGG - Intergenic
1058523149 9:105831913-105831935 ACACTTGGGCTTAGGACCTTAGG - Intergenic
1058755837 9:108082499-108082521 ACACCTTGACTTTGGACTTCTGG - Intergenic
1061173498 9:128976855-128976877 ACACCTGAGCTCAGGAGTTCAGG + Intronic
1061547735 9:131314476-131314498 ACACCTGGGATTAGGTGTGAGGG + Intergenic
1062340370 9:136091371-136091393 AACCCTGGGCTCAGGTCTCCTGG - Intronic
1062570346 9:137182120-137182142 ACACCTGGGCTTAGGTCTTCTGG - Intronic
1186091278 X:6051637-6051659 ACACCTTGATTTTGGTCTTCTGG + Intronic
1187718739 X:22130245-22130267 ACACCTGGCCCTAAGTCTTTAGG - Intronic
1189744027 X:44151399-44151421 ACACCTTGGTTTTGGACTTCTGG - Intronic
1189769859 X:44414933-44414955 ACTCCTGGCCTTAGGTGATCTGG + Intergenic
1191740638 X:64432944-64432966 ACACCTGGACTCAGGTCACCAGG + Intergenic
1192074760 X:67982281-67982303 GCACCTGGGCTGAGGTCCTGTGG - Intergenic
1192625164 X:72719500-72719522 ACACCTTGATTTAGGACTTCTGG + Intergenic
1192783257 X:74315035-74315057 ACTCCTGGGCTTAAGTGGTCTGG - Intergenic
1194047564 X:89027524-89027546 AAACCTGGGATAAGCTCTTCTGG - Intergenic
1194813222 X:98412007-98412029 CCACCTGTGGTTGGGTCTTCAGG - Intergenic
1195120920 X:101751566-101751588 CCACCTGGTCTTAGGTGTTTTGG + Intergenic
1198395440 X:136214630-136214652 TCAGCTGGGTTCAGGTCTTCAGG + Intronic
1200077478 X:153558337-153558359 ACACCTGGGCTCAGGCCTGAGGG + Intronic
1201505639 Y:14696379-14696401 ACACCTGGATTTTGGTTTTCTGG - Intronic
1201529275 Y:14974061-14974083 ACACCTGAGCTCAGGAGTTCAGG - Intergenic
1202242266 Y:22783539-22783561 ACACCTGGCCTCAAGTCATCTGG - Intergenic
1202395250 Y:24417287-24417309 ACACCTGGCCTCAAGTCATCTGG - Intergenic
1202475535 Y:25252807-25252829 ACACCTGGCCTCAAGTCATCTGG + Intergenic