ID: 1062570347

View in Genome Browser
Species Human (GRCh38)
Location 9:137182126-137182148
Sequence GACCTAAGCCCAGGTGTCCG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1062570339_1062570347 21 Left 1062570339 9:137182082-137182104 CCTGCGCACCTGCAATCCCAGCA 0: 1
1: 1
2: 6
3: 123
4: 420
Right 1062570347 9:137182126-137182148 GACCTAAGCCCAGGTGTCCGAGG No data
1062570343_1062570347 5 Left 1062570343 9:137182098-137182120 CCCAGCACATAGGGACACTAAGC 0: 1
1: 0
2: 2
3: 25
4: 1027
Right 1062570347 9:137182126-137182148 GACCTAAGCCCAGGTGTCCGAGG No data
1062570344_1062570347 4 Left 1062570344 9:137182099-137182121 CCAGCACATAGGGACACTAAGCC 0: 1
1: 0
2: 1
3: 14
4: 588
Right 1062570347 9:137182126-137182148 GACCTAAGCCCAGGTGTCCGAGG No data
1062570342_1062570347 13 Left 1062570342 9:137182090-137182112 CCTGCAATCCCAGCACATAGGGA 0: 2
1: 82
2: 8827
3: 308303
4: 273243
Right 1062570347 9:137182126-137182148 GACCTAAGCCCAGGTGTCCGAGG No data
1062570338_1062570347 25 Left 1062570338 9:137182078-137182100 CCGGCCTGCGCACCTGCAATCCC 0: 1
1: 0
2: 1
3: 24
4: 220
Right 1062570347 9:137182126-137182148 GACCTAAGCCCAGGTGTCCGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1062570347 Original CRISPR GACCTAAGCCCAGGTGTCCG AGG Intronic
No off target data available for this crispr