ID: 1062571223

View in Genome Browser
Species Human (GRCh38)
Location 9:137186277-137186299
Sequence CCAGGTGACCCGGGAGAGGA TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 406
Summary {0: 1, 1: 0, 2: 1, 3: 27, 4: 377}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1062571223_1062571233 2 Left 1062571223 9:137186277-137186299 CCATCCTCTCCCGGGTCACCTGG 0: 1
1: 0
2: 1
3: 27
4: 377
Right 1062571233 9:137186302-137186324 CAGGGTGGTGGTCACAGCCTCGG 0: 1
1: 0
2: 1
3: 28
4: 320
1062571223_1062571231 -10 Left 1062571223 9:137186277-137186299 CCATCCTCTCCCGGGTCACCTGG 0: 1
1: 0
2: 1
3: 27
4: 377
Right 1062571231 9:137186290-137186312 GGTCACCTGGTGCAGGGTGGTGG 0: 1
1: 1
2: 4
3: 32
4: 406

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1062571223 Original CRISPR CCAGGTGACCCGGGAGAGGA TGG (reversed) Exonic
900392807 1:2441063-2441085 CCAGGTGCCCAGGAAGTGGAGGG + Intronic
900620800 1:3586796-3586818 CCAGATGACCCAGGAGGGGAGGG + Intronic
900977269 1:6025572-6025594 ACAGGTGGCCCTGGGGAGGACGG - Intronic
902167406 1:14583712-14583734 GCAGGTGACCCTGAAGAGGATGG + Intergenic
902388876 1:16091365-16091387 CCAGGTGTGCCAGGAGAGGCTGG - Intergenic
902921258 1:19667080-19667102 GGAGGTGACACTGGAGAGGATGG - Intronic
903875432 1:26470572-26470594 CCAGGTATCCCGGGACAGAAAGG - Exonic
904297145 1:29527293-29527315 CCTGGTGACCCTGGAGGAGAAGG + Intergenic
904431916 1:30469777-30469799 CCAGGAGCCCCAGGAGAGCAGGG + Intergenic
904528965 1:31155449-31155471 GCGGGTGGCCCGGGAGAGGCCGG + Intergenic
904800070 1:33086354-33086376 CAAGGTGGCTGGGGAGAGGATGG + Intronic
904983450 1:34525648-34525670 CCAGGTGACCCAGGGGAGGAGGG + Intergenic
905847519 1:41244807-41244829 CCAAGTGACAGTGGAGAGGAGGG - Intergenic
905915069 1:41678904-41678926 CCAGATGTCCAGGGAGAAGAAGG + Intronic
906568018 1:46814210-46814232 CCAGGTCATCAGGGAGCGGAAGG + Exonic
906687396 1:47771509-47771531 ACAGCTGACATGGGAGAGGAAGG - Intronic
907659449 1:56378437-56378459 CTAGCAGACCCGGGAGGGGAGGG + Intergenic
910310902 1:85823561-85823583 CCAGGTGACCAGGGTGAACAAGG - Exonic
913655373 1:120954987-120955009 GCAGGTCACACGGAAGAGGAGGG + Intergenic
914141741 1:144955528-144955550 CCAGGTGAAGCGGGAAAGCAGGG - Exonic
917600665 1:176570723-176570745 CCAGGTGCCATGGCAGAGGAGGG + Intronic
917687105 1:177428013-177428035 TTAGGTGACACAGGAGAGGAAGG - Intergenic
919977156 1:202620157-202620179 CCAGTGGACCAGGGAGAGAAGGG - Intronic
920483150 1:206342897-206342919 CCAGGTGAAGCGGGAAAGCAGGG + Exonic
921207235 1:212858928-212858950 CCAGGTGGCCGGGAAGATGAGGG - Exonic
922208816 1:223471448-223471470 CCAGCTGACCCAGGAAAGAAAGG - Intergenic
922969936 1:229727754-229727776 CCAGGTGACCAGACGGAGGAGGG + Intergenic
923055691 1:230425142-230425164 GCAGGTGACGCGGGCGAGGCAGG - Intronic
923101596 1:230821859-230821881 CCAGGAAATCCAGGAGAGGATGG + Intergenic
924172750 1:241358173-241358195 ACAGCTGGCCCAGGAGAGGAAGG - Intergenic
1064476553 10:15696181-15696203 CCAGTGGTTCCGGGAGAGGATGG + Intronic
1067720927 10:48727248-48727270 GCAGGTGACACAGGAGAGGAAGG - Intronic
1068773583 10:60848791-60848813 CGAGGTGACCTAGGAGAGCAGGG + Intergenic
1069905079 10:71727438-71727460 CCATGAGACCCGGGAGAGCTGGG + Intronic
1070506659 10:77119079-77119101 CCAGGGGACGAGGGAGAGAATGG - Intronic
1070823259 10:79375564-79375586 GCTAGTGACCAGGGAGAGGATGG + Intergenic
1070917145 10:80162082-80162104 CCAGGTCACCCAGGAGAGCCTGG + Intronic
1072540404 10:96394161-96394183 CCAGGAGTCCTAGGAGAGGAGGG + Intronic
1072795168 10:98349076-98349098 CCTGGAGACACGGGAGAGGCTGG - Intergenic
1073327120 10:102649533-102649555 CCAGGCCAGCCGGGAAAGGAAGG - Intronic
1073460133 10:103661340-103661362 CCAGGGGGCCGGGGAGGGGACGG + Intronic
1074414919 10:113259630-113259652 CCAGGTGAACCAGGAGAAGATGG - Intergenic
1075047354 10:119156594-119156616 CCAGGTGCCTCTGGAGATGAAGG + Intronic
1075519438 10:123135251-123135273 CGAGGTGACCCGGGAGGGCCTGG + Intergenic
1076135858 10:128045475-128045497 CCTGGGGCCCCGGGAGATGAGGG + Intronic
1076858407 10:133128379-133128401 ACAGGTGACCAGGGTGATGATGG - Exonic
1076980177 11:199930-199952 CAGGGTCACCTGGGAGAGGAGGG - Exonic
1077071459 11:675974-675996 CCAGGTGCCCCGGGGGATGTCGG - Intronic
1078641593 11:13101822-13101844 CCATGTGAGCCTGGTGAGGAGGG + Intergenic
1079131433 11:17749048-17749070 GCAGGTGTGCCGGGAGAAGATGG + Intronic
1080591124 11:33723813-33723835 ACAAGTGAGCAGGGAGAGGAAGG + Intronic
1083281562 11:61629946-61629968 CTAGGTGAGCTGGGAGAAGAGGG - Intergenic
1083784249 11:64934735-64934757 CCCTGTGACCCAGGGGAGGAAGG + Exonic
1084093338 11:66893864-66893886 CTTGGTGACCAGGGAGAGGGTGG - Intronic
1084114481 11:67033789-67033811 CCAGGTTTCCTGGGAGAGGGAGG + Intronic
1084708668 11:70830504-70830526 CCAGGTGACCTTGGAGAGCTGGG + Intronic
1086361962 11:86069019-86069041 CCAGCTGACCCGGGAAGGGGTGG - Intronic
1088249871 11:107853143-107853165 CCAGGTGGCCTAGGTGAGGAAGG - Intronic
1089300659 11:117496836-117496858 TCAGGGGACCAGGGCGAGGATGG + Intronic
1089706692 11:120283308-120283330 CCACGTGACCTGGGAGAGACAGG + Intronic
1090644639 11:128757914-128757936 GCAGGTTACCTGGGTGAGGAGGG - Intronic
1090865166 11:130693570-130693592 GGAGGTGACACTGGAGAGGAAGG - Intronic
1091448674 12:559418-559440 ACAGGTGACTGGGAAGAGGAGGG + Exonic
1091788047 12:3254960-3254982 CCAGGGGACAGGGGAGAGGCTGG + Intronic
1092160339 12:6312204-6312226 GGAGGTGACCCAGGAGAGAAGGG + Exonic
1092512430 12:9170938-9170960 ACAGGTGATCCAGGTGAGGAAGG + Intronic
1094063028 12:26334718-26334740 CCAGTTGACCAGGCAAAGGAAGG + Intergenic
1094411215 12:30170276-30170298 CTAGGCTACCCAGGAGAGGAGGG + Intergenic
1095496507 12:42790006-42790028 CCACTTGAGCCGTGAGAGGAGGG - Intergenic
1096122061 12:49094674-49094696 CCACGTGCCCCGGGAGCGGGCGG + Exonic
1096589950 12:52651539-52651561 CAAGGTGACTCTGGAGAAGACGG - Exonic
1096690922 12:53321324-53321346 CCAGGTGGCCAGGGCGAGGAGGG - Exonic
1098652380 12:72989674-72989696 CCAGGTGACCCAGGGAGGGAAGG - Intergenic
1099365122 12:81758860-81758882 CCGGGTGGCCCGGGCGCGGAGGG - Intronic
1100565224 12:95789439-95789461 CCAGGTGACCCGCAAGAGGGAGG + Intronic
1100684398 12:96970899-96970921 CCTGGTGAAGAGGGAGAGGAAGG + Intergenic
1101102397 12:101407431-101407453 CAAGGGGAACCGAGAGAGGACGG + Intronic
1101529461 12:105560853-105560875 CCAGGTGACCTAGGAGTGGGTGG + Intergenic
1101835360 12:108291313-108291335 ATAGGTGATCTGGGAGAGGAAGG - Exonic
1102214061 12:111147709-111147731 CAAGGTCACCTGGCAGAGGAGGG + Intronic
1104040974 12:125130438-125130460 TCAGATGACCCTGAAGAGGAGGG + Intronic
1104989208 12:132615657-132615679 CCGTGTGTCCCGGGAGAGAATGG - Intergenic
1105013072 12:132768626-132768648 CCCGGTGAACCGGGGAAGGATGG - Intergenic
1105917287 13:24928268-24928290 CCAGGTGATCCGGGCTAGAAAGG + Intergenic
1106110316 13:26771431-26771453 CCAGGTGACCAGGAAGGGCAGGG - Intergenic
1107849933 13:44561063-44561085 TCGGGGGACCAGGGAGAGGAGGG + Intronic
1113296174 13:108961152-108961174 CAACGTGAGCCTGGAGAGGAGGG + Intronic
1113593390 13:111515666-111515688 CCCAGTGCCCGGGGAGAGGAGGG - Intergenic
1113882478 13:113635401-113635423 CCAGGGTGGCCGGGAGAGGAAGG + Intronic
1113905144 13:113815821-113815843 CCGGGTGACCCGCGTGTGGATGG - Exonic
1118722528 14:68604515-68604537 CCAGGTGCCCCAGGAGAGCAGGG + Intronic
1121621927 14:95356259-95356281 CCTGGTGACTGGGGAGAGAATGG - Intergenic
1121714691 14:96065211-96065233 ACAGGTGCCCCTGGGGAGGAGGG + Intronic
1122131135 14:99604910-99604932 GCAGGGGACCCGGGTGGGGACGG - Intergenic
1122703096 14:103603453-103603475 CCAGGAGACCCAGGAGGCGAAGG + Intronic
1122972592 14:105158463-105158485 CCAGGTGGCCCGGGGGCAGAGGG - Intronic
1123047806 14:105527063-105527085 CCAGGAGACCCAGGACAGGTGGG + Intronic
1124256258 15:28145189-28145211 CCAGGTGACCAGGCAGCAGAAGG + Intronic
1124434092 15:29633527-29633549 CCAGCTGAACCAGGAAAGGAGGG + Intergenic
1124492819 15:30168541-30168563 CCAGTGGACCAGGGAGAGAAGGG - Intergenic
1124750715 15:32369784-32369806 CCAGTGGACCAGGGAGAGAAGGG + Intergenic
1127143126 15:55997045-55997067 CCAGGTTACAAGGCAGAGGAAGG + Intergenic
1127658184 15:61075335-61075357 CAAGGTGACCTTGGAGAGCAGGG - Intronic
1129090357 15:73143365-73143387 GAAGGTGACCCGGGAGTGGGAGG - Intronic
1129616957 15:77106192-77106214 GCAGATGAACCGGGAGAGAAGGG + Exonic
1130316302 15:82799893-82799915 CCAGCTGGCCCGTGAGAGGTTGG + Intronic
1130330326 15:82917441-82917463 CCTGGGGCCCTGGGAGAGGAGGG - Intronic
1131052469 15:89357920-89357942 CCAGGTGAGAGGGGAGAGGTAGG + Intergenic
1131174287 15:90200647-90200669 GCACGTGACCCGGCAGGGGAAGG - Intronic
1132206892 15:99992652-99992674 CCAGGGGTCCCGGGAGTGAATGG + Intronic
1132309951 15:100849973-100849995 CCCGGGGACCCGGGAGCGGGGGG + Intergenic
1132565026 16:618116-618138 CCAGGTGGGTCGGCAGAGGAGGG + Intronic
1132807140 16:1780034-1780056 CCAGGTGTCCTGGGAGGGGTGGG - Intronic
1133393177 16:5425764-5425786 CCAGGTGATCTGGAAGAGGTGGG - Intergenic
1134022340 16:10929809-10929831 CAATGTCACACGGGAGAGGAAGG + Exonic
1136478493 16:30527144-30527166 CCCGGAGGCCCGGGAGGGGAGGG - Intronic
1136598311 16:31266722-31266744 CCAGGTCACACTGCAGAGGAGGG + Intronic
1136927383 16:34388011-34388033 CCAGGTTACCCAGGAGAACAAGG - Intergenic
1136977191 16:35023795-35023817 CCAGGTTACCCAGGAGAACAAGG + Exonic
1137707161 16:50543667-50543689 CCAGGTGAGCCTGGAGGAGAGGG - Intergenic
1138451696 16:57097109-57097131 CCAGGAGCCCCAGGAGAGCAAGG - Intronic
1139432069 16:66916185-66916207 CCAGGTCACCCTGGAGATGCAGG - Exonic
1139572447 16:67821635-67821657 CCAGGAGAGCTGGGAGAGGTGGG - Intronic
1139955499 16:70691231-70691253 CTCGGAGACCCGGGAGAGGCTGG + Intronic
1140032705 16:71351131-71351153 GGAGGTGACCCTGGAGAGGTTGG - Intergenic
1140484433 16:75282616-75282638 TCAGCGGACCTGGGAGAGGAGGG + Intergenic
1142107772 16:88315551-88315573 CCAGGTGACTTTGCAGAGGAGGG + Intergenic
1142127840 16:88419095-88419117 CCAGGTCACCCGAGACAGCAAGG - Intergenic
1142200906 16:88760723-88760745 CCAGGGGGCCCGGGACAGGCAGG + Intronic
1142263445 16:89053034-89053056 CCAGGGGACCTGGCAGGGGAAGG - Intergenic
1142647571 17:1324538-1324560 CGAGATGACCCTGGAGTGGAGGG - Intergenic
1143965017 17:10750902-10750924 CCAAATGACCCTGGGGAGGAGGG + Intergenic
1144386310 17:14751712-14751734 AGAGGAGACCCAGGAGAGGATGG - Intergenic
1145935963 17:28715062-28715084 CCAGGTGGCCCAGGAGATGAAGG - Exonic
1146948916 17:36892376-36892398 CCAGGAGGCCCGAGAGAAGAGGG - Intergenic
1147456929 17:40543675-40543697 CCAGGTGCCCCAGGACAGGGAGG - Intergenic
1147563296 17:41521907-41521929 CCTGGAGACCTGGGATAGGAGGG - Exonic
1148259867 17:46172049-46172071 CCAGGGGACAAGGTAGAGGATGG + Exonic
1148750279 17:49941575-49941597 TCAGGTGTCCCGGGAGAGGGAGG - Intergenic
1148790360 17:50169242-50169264 CAATGTGACCCTGGTGAGGAGGG + Exonic
1149947030 17:60939656-60939678 CCAGGTGGTTGGGGAGAGGATGG + Intronic
1151802857 17:76387871-76387893 CCTGGTGACTGGGGAGAGAATGG + Intergenic
1152048384 17:77953862-77953884 GCAGATGACCTGGAAGAGGAAGG - Intergenic
1152101105 17:78302149-78302171 TCAGGTGACCTGGGAGGGAAGGG + Intergenic
1152342022 17:79730724-79730746 CCAGGGGACCCAGGTGAGGCTGG - Intergenic
1152558231 17:81065246-81065268 GCAGGTGACCCGAGGGAGGGCGG + Intronic
1152583515 17:81179270-81179292 CCAGGGGACCCAGGGGAGGTGGG + Intergenic
1152722587 17:81930158-81930180 CCTGGAGACCAGGGAGAGCAGGG - Intergenic
1152797367 17:82314927-82314949 CCAGGCAGCCCGGCAGAGGACGG - Exonic
1152936791 17:83143447-83143469 CCAGGTGACCTGGAAGGGGTTGG + Intergenic
1154194990 18:12258946-12258968 CCTGGTGACCCGGGGGGAGAGGG - Intronic
1154197248 18:12275679-12275701 CCAGGAGACCTCTGAGAGGAGGG - Intronic
1155787788 18:29923254-29923276 CCAGGTGAGGTGGGAGGGGAGGG + Intergenic
1156228324 18:35130464-35130486 CCAGGTGCACAGGAAGAGGATGG + Intronic
1158782145 18:60664016-60664038 CCAGGTGTCCCTGGAGATGAGGG + Intergenic
1159080363 18:63729469-63729491 TCAGGGGACTAGGGAGAGGAAGG + Intergenic
1160147210 18:76375461-76375483 CCCGGAGACCAGGTAGAGGATGG + Intronic
1160147234 18:76375563-76375585 CCCGGAGACCAGGGAGAGGATGG + Intronic
1160147263 18:76375653-76375675 CCAAGAGACCAGGTAGAGGATGG + Intronic
1160147282 18:76375719-76375741 CCAAGAGACCAGGTAGAGGATGG + Intronic
1160147291 18:76375752-76375774 CCAAGAGACCAGGTAGAGGATGG + Intronic
1160147325 18:76375886-76375908 CCTGGGGACCAGGTAGAGGATGG + Intronic
1160147334 18:76375919-76375941 CCAAGAGACCAGGTAGAGGATGG + Intronic
1160147360 18:76376019-76376041 CCAAGAGACCAGGTAGAGGATGG + Intronic
1160297534 18:77651524-77651546 CCAGGTGACCTAGGTGGGGAAGG + Intergenic
1160562376 18:79766734-79766756 CCAGCTAAGCCGGAAGAGGAGGG - Intergenic
1160996276 19:1883531-1883553 CCTGGAGACCCCGGAGACGAAGG + Intronic
1161112369 19:2477433-2477455 ACAGGGGCCCCGGGAGAGGGAGG + Intronic
1161554613 19:4933615-4933637 CTGGGTGACCAGGCAGAGGAGGG - Intronic
1161766817 19:6212955-6212977 GCAGGCGAGACGGGAGAGGAGGG + Exonic
1161901832 19:7125088-7125110 CCAGGCGAAGTGGGAGAGGATGG + Intronic
1161966395 19:7551275-7551297 CCAGGAGCCCCGGCATAGGAGGG + Intronic
1162323760 19:9986385-9986407 CCAGGTCCCCGGGGAGAGGATGG - Exonic
1162324927 19:9993387-9993409 CCCGGTCCCCCAGGAGAGGATGG - Exonic
1162367382 19:10257686-10257708 TCAGGTCAAGCGGGAGAGGAAGG - Intronic
1162549547 19:11350986-11351008 CCAGGAGATCCGGGACAGGTCGG + Exonic
1162736065 19:12747767-12747789 CCCTGTGACCCTGGAGAGCAGGG + Intronic
1163372441 19:16908909-16908931 CCAGGTCACGCGGGCCAGGACGG + Intronic
1163557102 19:17999031-17999053 GGAGGTGACCTGGGTGAGGAAGG + Exonic
1163574803 19:18104461-18104483 CAAGGTCTCCCGGGAGAGGCGGG - Intronic
1164508505 19:28878602-28878624 CCAGGTGACAGGGGAGCGGGAGG - Intergenic
1165326906 19:35119238-35119260 GCAGCTCACCCGGGACAGGAAGG - Exonic
1165376704 19:35448194-35448216 CCACGTGACCAGAGAAAGGAAGG - Intronic
1165858531 19:38894543-38894565 CCAGGGGACCCGGGAACGAAGGG - Intronic
1166257824 19:41618937-41618959 CTGTGTGACCCGGGAGAGAATGG + Intronic
1166269775 19:41706914-41706936 CGAGGTGACCCGGGTGAGGGTGG - Intronic
1166422894 19:42652473-42652495 CCAAGTGACCCTGGTGAGGGCGG - Intronic
1166471786 19:43084307-43084329 CCAAGTGACCCTGGTGAGGGTGG + Intronic
1167002392 19:46753707-46753729 CCAGGAGACCAGGGGGAGGTTGG + Intronic
1167327215 19:48834160-48834182 CCAGCGGAGCCAGGAGAGGAAGG + Intronic
1167425072 19:49426033-49426055 CCGGGGGACCTCGGAGAGGAAGG + Intronic
1167561810 19:50230645-50230667 CCTGCTCACCCGGGAGAGGGTGG + Intronic
1167730015 19:51247092-51247114 GCAGGTGAACTGGGAGAGAAGGG - Intronic
1167829913 19:52011200-52011222 CCAGGTGGCCCTACAGAGGAAGG - Intergenic
1168204249 19:54837598-54837620 CCAGGTGACCTGGGAGGGCCAGG - Intronic
926731730 2:16040688-16040710 TCAGGAGACCCAGGAGAGGTGGG + Intergenic
927194608 2:20538898-20538920 CCAGATGACCGGGAAGGGGAGGG - Intergenic
927933233 2:27059150-27059172 CCAGTTAACCCGGGCCAGGAAGG - Intronic
929490532 2:42392270-42392292 CCAGGTGACCTGGCAGGGCAGGG - Intronic
930121559 2:47764973-47764995 CCAAATGTCCCGGGAGAGGGGGG + Intronic
931974630 2:67629704-67629726 CTAGGTGCCCAGGAAGAGGAGGG + Intergenic
932329315 2:70888649-70888671 CCAGGAGACGCGGGAGAGACTGG + Intergenic
932412601 2:71556098-71556120 CCAGTTGAGCCAGGAGAGGTGGG - Intronic
932621381 2:73266415-73266437 CCAGGTGTGCAGGTAGAGGAGGG + Intronic
932803967 2:74767363-74767385 CCAGGTGAACTGGGACAGGTTGG - Intergenic
933774667 2:85764920-85764942 CCAGGTCACCAGGCAGATGAAGG + Intronic
934856571 2:97733592-97733614 CCAGGTGAGCGGGCAGAGGTGGG + Exonic
935145823 2:100394654-100394676 TCAGGTGGCCCAGGAGAGCAAGG - Intronic
935656594 2:105428694-105428716 ACAGGTGACCAGGGAGAGCGTGG - Intronic
936245987 2:110827717-110827739 TCAGCTGACCCTGGAAAGGAAGG + Intronic
936516976 2:113187137-113187159 CCAGGAGAACCCCGAGAGGAAGG + Intronic
936517578 2:113192188-113192210 CCAGGAGAACCCCGAGAGGAAGG - Intronic
938308200 2:130268587-130268609 CCAGGAGTCCCTGGTGAGGAAGG - Intergenic
938447130 2:131388249-131388271 CCAGGAGTCCCTGGTGAGGAAGG + Intergenic
940360807 2:152793786-152793808 GCAGGTGAACTGGGAAAGGAGGG - Intergenic
945058019 2:205884973-205884995 CAAGGTGACCCAGATGAGGAGGG - Intergenic
945251680 2:207769907-207769929 GCAGGTGACCCGGGCGGGGCGGG - Intergenic
946223607 2:218249949-218249971 CTCGGTGACTCAGGAGAGGAAGG - Intronic
947741768 2:232487938-232487960 CCAGGTGGCCCGAGAGATGCAGG - Intergenic
948930587 2:241129314-241129336 CCAGGTGACTGTGGAGAGAACGG - Intronic
1170338442 20:15296993-15297015 CCAGGGGACCAGGGAAATGAAGG - Intronic
1170544917 20:17427711-17427733 CCAGCTGACCAGGGAGACAAGGG - Intronic
1170932816 20:20784091-20784113 CAAGGGGACCCTGGAGAGAAGGG + Intergenic
1171961337 20:31497054-31497076 CCAGGTCTCCTGGGAGAGGAGGG + Intergenic
1172624379 20:36338848-36338870 CCAGGTGAAGAGGGAGAGAAGGG + Intronic
1172650240 20:36497397-36497419 CCAGCTGACCCGTGGGAGGCGGG + Intronic
1172759555 20:37312413-37312435 CCAGGAAACCTGGGAGAGGCTGG + Intronic
1172778662 20:37422991-37423013 TCATGTGGCCCGGGAGATGAGGG + Intergenic
1175173768 20:57097422-57097444 CCATGTGACCAGAGGGAGGACGG - Intergenic
1175390669 20:58625452-58625474 CCCAGTGACACGGGAGAGGTAGG + Intergenic
1175401256 20:58701221-58701243 CCAGGGCACCCGGGAGAGCCGGG - Intronic
1175592075 20:60201106-60201128 CCCGGAGACCCGGGGGACGAAGG + Intergenic
1175872302 20:62214272-62214294 CCAGGGGCCCCAGGAGAGGGAGG - Intergenic
1176173263 20:63706001-63706023 TCAGGTGACCAGTGAGAGAAGGG - Intronic
1176229267 20:64023466-64023488 CCCGAGGACCTGGGAGAGGACGG - Intronic
1176370354 21:6058573-6058595 CCAGGTGACCACTGAGAGCAAGG - Intergenic
1178960996 21:37064793-37064815 CCAGGTGAGCCTGGAGAGACCGG - Exonic
1179177598 21:39020621-39020643 ACAGGTGACCCAGGAGAAGAAGG - Intergenic
1179646242 21:42778078-42778100 ACAGGTGACACAGGAGGGGACGG - Intergenic
1179753165 21:43479968-43479990 CCAGGTGACCACTGAGAGCAAGG + Intergenic
1179796802 21:43789692-43789714 GCAGGTGACCCGGGACCGGGCGG + Exonic
1179887062 21:44318730-44318752 CCAGGTCTCCAGGGAGGGGAGGG + Intronic
1180073080 21:45448050-45448072 CCAGGTGACTCAGCAGAGGGTGG - Intronic
1181174084 22:21026238-21026260 AAAGGTGACCTGGGAGAGGCAGG - Exonic
1181424303 22:22823014-22823036 CCAGGAGACCCGGACGCGGAGGG - Intronic
1181460812 22:23084989-23085011 CCAAGGGACCCAGGACAGGATGG - Intronic
1181464534 22:23103794-23103816 CCAGCTGACCTGAGGGAGGAAGG - Intronic
1181759995 22:25051696-25051718 CAGGGTGACCCAGCAGAGGAGGG + Intronic
1182125839 22:27815404-27815426 AGAGGAGACCCTGGAGAGGAAGG + Intergenic
1182554091 22:31119658-31119680 CAGGGTGACCAGGGAGAGAAAGG + Intronic
1183306244 22:37084649-37084671 CCTGGTGACCCGGGATGAGAGGG - Intronic
1183389068 22:37533625-37533647 CCAGGGGCCCCGGGGAAGGAGGG + Intergenic
1184728841 22:46362207-46362229 CCAGGTGGCCCGGGAGCTGCAGG - Exonic
1185363615 22:50424075-50424097 CCAGGTGGCTGAGGAGAGGAAGG + Intronic
950492578 3:13314916-13314938 CCAGGTGATCCGGGATTGGCAGG + Intergenic
951677787 3:25261732-25261754 GTAGGTGACCAGGGAGATGAAGG - Intronic
953099862 3:39813262-39813284 CCAAGTGACCCGGGAGATGTGGG + Intronic
953256608 3:41296858-41296880 ACAAGTGAACCTGGAGAGGAAGG + Intronic
953793304 3:45964855-45964877 CCAGGTGTCCAGGGAATGGATGG + Intronic
954134799 3:48576999-48577021 CCTGGGGACCCTGGAGAAGACGG - Exonic
955537676 3:59941731-59941753 TCAAGGGACCCAGGAGAGGAAGG + Intronic
955538518 3:59950344-59950366 ACATGTGAACAGGGAGAGGAAGG - Intronic
955671761 3:61409817-61409839 CCAGATGTCCCTGGACAGGAAGG + Intergenic
955687651 3:61562463-61562485 CCGGGAGACCCTGGAGAGGGTGG + Intronic
956471081 3:69567365-69567387 CCAGGTTACCCAGGAGAGAGTGG - Intergenic
956566459 3:70644167-70644189 CCAGGTGGCGAGGAAGAGGATGG - Intergenic
956755388 3:72380913-72380935 ACAGGTGACGCAGGAGAGGTAGG + Intronic
956851433 3:73231654-73231676 CTAGGTGACCTGGGAAAAGAGGG - Intergenic
957833231 3:85550776-85550798 CAAGGTGAGACGGGAGAGGAAGG - Intronic
959581886 3:107991077-107991099 CCAGGTCACCTGGGAGATAATGG - Intergenic
962196217 3:133365810-133365832 ACAGATGACCCTGGAGAGGCAGG - Intronic
962426026 3:135270220-135270242 GCAGGTGACTCAGGAGAGGGCGG + Intergenic
962702196 3:138010473-138010495 CCAGGTGAACCAGGTGAGCAGGG + Intronic
962748369 3:138414398-138414420 CCCGGGGACCCAGGAGAGGAGGG - Intergenic
965697690 3:171426666-171426688 CCTGGAGACTCTGGAGAGGATGG - Intronic
966911370 3:184562095-184562117 CCAGGAGATCCAGGAGAGGAGGG - Exonic
967946486 3:194807994-194808016 GCAGGAGACCCGGGAGCAGAAGG + Intergenic
968048204 3:195635552-195635574 CCAGGAGACCGGGCAGCGGACGG - Intergenic
968099200 3:195954068-195954090 CCAGGAGACCGGGCAGCGGACGG + Intergenic
968306407 3:197654369-197654391 CCAGGAGACCGGGCAGCGGACGG + Intergenic
968693293 4:2008143-2008165 CCTGGTGACCTGGGCGAGGGCGG - Intronic
968978937 4:3836383-3836405 CCAGGTGACCCGACAGCGGTGGG + Intergenic
969477823 4:7431376-7431398 ACAGGTCACCTGGGAGAGGCCGG - Intronic
969714272 4:8860940-8860962 CCAGGTGAGCCGGGCGGGGGCGG + Intronic
972420003 4:38878211-38878233 CCAGCTGACCCCAGAGGGGAGGG + Exonic
972524267 4:39892741-39892763 CCAGGTAACTAGGTAGAGGAGGG + Intronic
973601778 4:52549434-52549456 CCAGGGAACCAGGAAGAGGATGG + Intergenic
976789243 4:88859281-88859303 ACTGGTGACCCAGGAGAGGGAGG + Intronic
984634635 4:182097635-182097657 CAGGGTGACCCAGGAGAGAAGGG - Intergenic
984639253 4:182144516-182144538 CCCGGGGACGCGGGAGGGGAGGG - Intronic
984852519 4:184166851-184166873 CCTGGTCACTGGGGAGAGGAGGG - Intronic
985493313 5:191595-191617 CCAGGTGGCCCGGCAGAGCCTGG + Exonic
985504696 5:272045-272067 CCAGGAGACCGGGCAGCGGACGG - Intronic
985743417 5:1633550-1633572 CCAGGAGACCGGGCAGCGGACGG + Intergenic
985814674 5:2117747-2117769 CCAGGTCCCCCGGGAGTAGATGG + Intergenic
986307303 5:6525194-6525216 CCAGGTGTCCCTGCAGAGAAGGG + Intergenic
986350925 5:6878675-6878697 CCAGGAAACCCAGGAAAGGAAGG - Intergenic
991410228 5:66338471-66338493 CCAGGTGAACCTGGAGGAGAGGG - Intergenic
994753754 5:103769659-103769681 CCAGGTGACCAAGGACAGGTGGG + Intergenic
997396284 5:133562582-133562604 TGAGGGAACCCGGGAGAGGAGGG - Intronic
997626671 5:135335887-135335909 CCAGGGGACCCCGGAGGAGATGG + Intronic
999256195 5:150211160-150211182 CCAGGAGAGCCGGGGAAGGAGGG - Intronic
1000447038 5:161334792-161334814 GAAGGAGACCCAGGAGAGGATGG + Exonic
1001473877 5:172035586-172035608 CCTGGTGACCATGGAGAGCAGGG - Intergenic
1001512860 5:172336010-172336032 CCAGCTGACCCCCGGGAGGAAGG + Exonic
1001676359 5:173520266-173520288 CCTGGTGATGGGGGAGAGGAAGG - Intergenic
1002164394 5:177335591-177335613 CCAGGCAACCCGGGGCAGGAGGG + Intronic
1002200413 5:177524687-177524709 CCAGATCACCCGGGATAGGTTGG + Exonic
1002493806 5:179598535-179598557 GCAGGTGACCCTGGAGGAGAGGG + Intronic
1002710090 5:181190177-181190199 CCAGGTGACCCGTGAGTGTACGG + Intergenic
1003521854 6:6864983-6865005 TCAGGTGAAACAGGAGAGGAAGG + Intergenic
1003860464 6:10318016-10318038 CCATGTGCCCTGTGAGAGGAGGG + Intergenic
1006295101 6:33166772-33166794 CCGGGTGAGCAGGGAGAGAAGGG - Exonic
1006296276 6:33171474-33171496 CCAGGTGTGGCTGGAGAGGATGG - Exonic
1006887805 6:37397010-37397032 CCATGTGTCCCAGGGGAGGAAGG - Intergenic
1007368424 6:41410160-41410182 CCAAGTGTCCCTGGTGAGGAGGG + Intergenic
1007380615 6:41488144-41488166 ACAGGAGAGCCGGGAGAAGAAGG - Intergenic
1007476701 6:42124117-42124139 CCAGAGGCCCAGGGAGAGGAAGG + Intronic
1008427050 6:51370985-51371007 CCAGGTGACCTTGGAGGGAATGG + Intergenic
1012585977 6:100923079-100923101 GCAAGTGACCCAAGAGAGGAAGG + Intergenic
1013237340 6:108208845-108208867 CAAGGTTAACCAGGAGAGGATGG - Intergenic
1016404593 6:143716830-143716852 CTGGGTGAGCAGGGAGAGGAGGG + Intronic
1019270976 7:149093-149115 CCAGGAGACGCGAGAGAGGTGGG + Intergenic
1019444562 7:1064687-1064709 CCAGGTGACTCGGCCGAGGGAGG - Intronic
1019514937 7:1435390-1435412 ACAGGTGACCTGGGACAGAAGGG + Intronic
1019514964 7:1435477-1435499 ACCGGTGACCTGGGACAGGAGGG + Intronic
1019891914 7:3954264-3954286 AGAGGTGATGCGGGAGAGGAGGG - Intronic
1021174679 7:17437553-17437575 CTAGGTGACCAAGGAAAGGAGGG + Intergenic
1022720974 7:32942119-32942141 CCAGATGACCCGGGAGAGTGTGG - Intergenic
1022739595 7:33108908-33108930 CCAAATGACCCGGGAGAGTGTGG - Intronic
1022762143 7:33366151-33366173 CCAGGGAACCCCAGAGAGGAAGG - Intronic
1026665760 7:72338231-72338253 ACTGGGGACCCGGGAGAGGAGGG - Intronic
1026737788 7:72960080-72960102 CCAGGGAACCCGGGAGCGGCTGG - Exonic
1026788823 7:73318881-73318903 CCAGGGAACCCGGGAGCGGCTGG - Exonic
1026907183 7:74069208-74069230 CAAGTGGACCCAGGAGAGGAGGG - Intronic
1027105946 7:75404988-75405010 CCAGGGAACCCGGGAGCGGCTGG + Exonic
1027287728 7:76666123-76666145 ACAGGTGACACGGGAGGGGTGGG - Intergenic
1027332008 7:77106999-77107021 AGAGGTGACAGGGGAGAGGAAGG + Intergenic
1027340194 7:77199417-77199439 ACAGGAGCCCCGGGAGAGGTTGG - Exonic
1028541976 7:91952545-91952567 CCAGGTGAGAAGGGAGTGGAAGG + Intronic
1032645942 7:133824209-133824231 ACAGGTGACCCGGGGTAGGAAGG - Intronic
1033543203 7:142376132-142376154 GAGGGTGACCCAGGAGAGGACGG + Intergenic
1033548087 7:142420781-142420803 GAGGGTGACCCAGGAGAGGAGGG + Intergenic
1033550722 7:142445248-142445270 GCAGGTGACCCAGAAGAGGAAGG + Intergenic
1034282715 7:149864994-149865016 CCGGTTTACCCAGGAGAGGATGG + Exonic
1034860193 7:154588177-154588199 CCCAGTGACCAGGGATAGGATGG - Intronic
1034969523 7:155410414-155410436 CCAGGTGACGCAGGGCAGGAAGG - Intergenic
1034972292 7:155426830-155426852 CCACGAGACACAGGAGAGGAAGG - Intergenic
1035179498 7:157078655-157078677 CCAGGTGTCCTTGTAGAGGAGGG + Intergenic
1035321245 7:158030627-158030649 CCTGGTGACCCAGCAGAGGTGGG + Intronic
1035436952 7:158866451-158866473 CCAGGAGACCCAGGAGACCAGGG - Intronic
1035749391 8:1985177-1985199 GCAGGTGACCCGGCAGGAGAAGG + Intronic
1037811933 8:22091677-22091699 GCAGGAGACACGGGAGAGGCAGG - Intronic
1038139070 8:24822745-24822767 CTAGGGGACCCGTGAGAAGAGGG + Intergenic
1038583697 8:28771299-28771321 CCAGGTGACCAGTGGCAGGAAGG + Intronic
1038646955 8:29369952-29369974 GCAAGTGACCAGGCAGAGGAGGG + Intergenic
1038661300 8:29499321-29499343 GCAGGTGACGCTGGTGAGGAAGG + Intergenic
1038741801 8:30223129-30223151 CTAGATGCCCAGGGAGAGGAAGG - Intergenic
1039808653 8:41025409-41025431 CCAGGAGAGTCGGGAGAGCAAGG + Intergenic
1041514752 8:58688649-58688671 CCAGCTGGACAGGGAGAGGAAGG + Intergenic
1046485367 8:114880748-114880770 CCAGGTGACCCTAGAAAGTAAGG - Intergenic
1047264026 8:123288720-123288742 CCAAGTGACCCTGGAAAGCATGG + Intergenic
1047436484 8:124839327-124839349 CCAGGTGCCCAGGGAGAGGCAGG - Intergenic
1049037831 8:140090539-140090561 CCAGGTCACCCGGGAGACCAGGG + Intronic
1049162145 8:141104481-141104503 CCAGGTTAGGCGGGAGAGGGAGG - Intergenic
1049614501 8:143570224-143570246 CCAGGTGAGGAGGGTGAGGAGGG - Exonic
1049615051 8:143572402-143572424 CCAGGTGACGGGGGAGGGAAGGG - Exonic
1049619341 8:143590957-143590979 CCAGGTGGCCGGGCAGAGGGTGG + Intronic
1049668337 8:143858761-143858783 CTCGATGACCCGGGTGAGGACGG + Exonic
1049668753 8:143860360-143860382 CTCGATGACCCGGGTGAGGACGG + Exonic
1049669168 8:143861962-143861984 CTCGATGACCCGGGTGAGGACGG + Exonic
1049669583 8:143863564-143863586 CTCGATGACCCGGGTGAGGACGG + Exonic
1049669993 8:143865157-143865179 CTCGATGACCCGGGTGAGGACGG + Exonic
1049870621 8:144972536-144972558 CCAGGAGACCTGGGAAATGAGGG - Intergenic
1051437711 9:17051002-17051024 ACAGGGGACCAGGAAGAGGAAGG - Intergenic
1052683959 9:31730760-31730782 CCACGTGTCCCTGGAGGGGATGG + Intergenic
1053360278 9:37481658-37481680 AGAGGTGACCAGGAAGAGGAGGG + Intergenic
1056873505 9:90306183-90306205 CCAGGGGACCAAGGAGAGAAGGG - Intergenic
1056938686 9:90937160-90937182 CCTGGTGTCCCAGGTGAGGAAGG + Intergenic
1057583118 9:96305255-96305277 CCAGGTGAGCCTGGAGATGACGG - Intergenic
1058818134 9:108704391-108704413 CCTGGTGACCCTGGAGAGACAGG - Intergenic
1058835511 9:108855869-108855891 CAGGGTGACCCTGGAGAGGCAGG - Exonic
1059615517 9:115946711-115946733 CCAGGTGACCAGGAAGGGGGAGG + Intergenic
1060440674 9:123636253-123636275 CCAGGTGACCAGGAACACGACGG + Intronic
1060518411 9:124280069-124280091 CCAGCTGACCCTGGACAGGCAGG - Intronic
1060794991 9:126507326-126507348 CCAGGTGGCCCCGGTGGGGAGGG + Intergenic
1060824025 9:126677287-126677309 CCAGGGGAGCTCGGAGAGGAGGG - Intronic
1061514236 9:131079319-131079341 GCAGGGGACCTGGGAGAGGTTGG + Intronic
1061880874 9:133568254-133568276 CCACCTGCCCCGGGAGCGGATGG - Exonic
1062133840 9:134914402-134914424 CCAGGAGACCGAGGAGAGAAGGG - Exonic
1062171312 9:135136377-135136399 TCAGGAGACCAGGGAGAGGTGGG + Intergenic
1062571223 9:137186277-137186299 CCAGGTGACCCGGGAGAGGATGG - Exonic
1062729632 9:138101802-138101824 TCAGGTGGCCCAGGAGAGAAAGG - Intronic
1185473671 X:400331-400353 CAAGGCGCCCCAGGAGAGGAAGG - Intergenic
1185793125 X:2942821-2942843 GCAGATGAACTGGGAGAGGAGGG - Intronic
1186717868 X:12272417-12272439 GAGGGTGACCAGGGAGAGGACGG + Intronic
1186779625 X:12899752-12899774 CCAGGTGTCCAGGAAGAGAAGGG + Intergenic
1187137060 X:16558260-16558282 CCTGGTCACCAGGTAGAGGAGGG - Intergenic
1187404744 X:18993174-18993196 CCAGGGGAGCGGGGAGAAGAAGG - Intronic
1187490239 X:19744491-19744513 CCAGGTGACCCAGGAGGTCAGGG + Intronic
1190324349 X:49197671-49197693 CCAACAGACCTGGGAGAGGAAGG - Intronic
1190745365 X:53319232-53319254 CCAGCTGAGCAGTGAGAGGAGGG + Intronic
1200052957 X:153444521-153444543 CCAGGCCAGCCGGGAGAGCACGG + Intergenic
1200074870 X:153545953-153545975 CGGGGTGAGCCTGGAGAGGACGG + Intronic
1200211113 X:154346908-154346930 CTGGGTGACTCGGGACAGGAGGG + Intergenic
1200219739 X:154385184-154385206 CTGGGTGACTCGGGACAGGAGGG - Intergenic