ID: 1062571375

View in Genome Browser
Species Human (GRCh38)
Location 9:137187158-137187180
Sequence TCCTCCCCAGGATCGACAAA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 90
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 85}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1062571375 Original CRISPR TCCTCCCCAGGATCGACAAA AGG Intronic
906378519 1:45316571-45316593 TCCTCTCCAGTAGAGACAAAGGG + Intergenic
915971965 1:160361487-160361509 TTCTGCCCAGCATGGACAAAGGG + Intergenic
922612649 1:226941428-226941450 TTCTCCCGAGGAGAGACAAAAGG + Intronic
1067726244 10:48773442-48773464 TCCTTCCCAGGCTGGATAAAGGG - Intronic
1068571638 10:58636246-58636268 TTCTCCCCAGATTCAACAAATGG - Intronic
1070539653 10:77406903-77406925 TCCTCTCCAGGGTCTACCAAGGG - Intronic
1075022169 10:118959951-118959973 TCCTCCCCAAGTTCCCCAAAAGG - Intergenic
1076289778 10:129336255-129336277 TCCTCCCCTGGGTTGAAAAAGGG - Intergenic
1079045976 11:17103878-17103900 TCCTCACCAGGAATCACAAAAGG + Intronic
1079244742 11:18743919-18743941 TCCTCCCCAGGATGGCCACCTGG - Intronic
1082701996 11:56443429-56443451 TCCTCCCCAAGATAGAAAGAAGG - Intergenic
1083413077 11:62506877-62506899 TCCTCCCCAAAATGGGCAAATGG + Intronic
1086177734 11:83912686-83912708 TCCTCCCAAGGAAGGACAATGGG + Intronic
1088115204 11:106304990-106305012 TACTCCCCAGGGCAGACAAAAGG + Intergenic
1091044379 11:132312706-132312728 TCCTCCCCATGGTGGACGAATGG + Intronic
1100607744 12:96165712-96165734 CCCTCCCCAGAAATGACAAATGG - Intergenic
1101785915 12:107883357-107883379 CCCTCCCCAGGATGGACTAGAGG - Intergenic
1106296847 13:28421958-28421980 TCCTCCCAAGGATAGAGAATTGG - Intronic
1107422675 13:40263502-40263524 TCCTGCCCATGATGGACAACAGG + Intergenic
1109361176 13:61296976-61296998 TCCTCCCAAAGATACACAAATGG + Intergenic
1109817483 13:67604335-67604357 TCCACCCCAGGATCTAGGAATGG + Intergenic
1112822077 13:103349272-103349294 TCCTCTCCAGGCTAGACACATGG + Intergenic
1116023800 14:39491955-39491977 TCCTCCCCACCATTGCCAAAAGG + Intergenic
1117402738 14:55372481-55372503 TCTTCCCCAGGATCCCCCAAAGG + Intronic
1119866649 14:77980319-77980341 TCCTCCCCAGGTTGGACTGATGG - Intergenic
1125077185 15:35633157-35633179 TCCTTCCCAGGAACAAAAAAAGG - Intergenic
1125785037 15:42308944-42308966 TTCTCCCAAGGCTCCACAAAAGG - Intronic
1127883108 15:63175322-63175344 GCCTCCCCAGAATGGACCAAGGG + Intergenic
1133284058 16:4682529-4682551 TCCTCCCCAGGAACCACCAGCGG + Intronic
1143079644 17:4371907-4371929 TCGTCCCCAGAATCATCAAATGG - Intergenic
1147162879 17:38578290-38578312 TCCTCCCCAGGCTCCAGAAAAGG + Intronic
1150077633 17:62206742-62206764 TCCTCCCCAGGGGCACCAAAGGG - Intergenic
1150809521 17:68345527-68345549 TCCTGCCCAGGATGTGCAAAAGG - Intronic
1163572973 19:18093706-18093728 TCCACCCCAGGCTGGACTAAGGG + Intronic
1167851111 19:52203115-52203137 TCCTCCCCAGGATCATCACTAGG - Intronic
927719929 2:25376136-25376158 TCCTCGCCAGGATTGAGGAAAGG + Intergenic
927869225 2:26613231-26613253 TCCTCCCTAGGACCAACAGAAGG + Intronic
930364099 2:50417214-50417236 TCCTCCACAAGATTGAGAAAAGG + Intronic
933255414 2:80075128-80075150 ACCTTCCCAGGACAGACAAAAGG - Intronic
935832845 2:107018624-107018646 TCCTCCCCAGGGTCGCCTCAAGG - Intergenic
936465137 2:112741411-112741433 TCCTCCCCAGGATGACCACATGG + Intronic
938623506 2:133082961-133082983 TCCTCCCCAGAAACGAAGAAAGG + Intronic
938902576 2:135810421-135810443 TCCTCCTCAGAATGGATAAAAGG + Intronic
943041282 2:182808472-182808494 TGATCCCCAGGAAAGACAAATGG + Intergenic
1169603285 20:7286721-7286743 TCCTCCCCAGGACCAGGAAAGGG + Intergenic
1171190890 20:23158647-23158669 TCCTCCTCAGCATGGAGAAATGG - Intergenic
1172689095 20:36778278-36778300 CCCTCCCCAGGCTCTACTAATGG + Exonic
1175890421 20:62313504-62313526 TCCCCTCCAGGATGGACCAAGGG + Intronic
1178121100 21:29470952-29470974 TGCCCCCCATGAACGACAAAGGG - Intronic
1180742108 22:18061053-18061075 TCTTCCCTAGGATGGAAAAAGGG - Intergenic
1182996347 22:34816477-34816499 TCCTCCCCAAGATCTCCACATGG - Intergenic
950995891 3:17495167-17495189 TCCTCCACAGGAGCCACAGATGG + Intronic
954610946 3:51944243-51944265 TACTCCCCAGGGTCCTCAAAAGG + Intronic
957249493 3:77755379-77755401 TCTTCCACAGGTTAGACAAAAGG - Intergenic
968671285 4:1853135-1853157 TCCTCCCCAGTTTCAACAAATGG + Intronic
976480305 4:85535497-85535519 TCATCACCAGAATTGACAAATGG - Intronic
981068131 4:140506929-140506951 TCTTCCCAAGAATGGACAAAAGG - Intergenic
981348510 4:143701085-143701107 TCTTCCCCAGGTGCCACAAAGGG + Intergenic
986814615 5:11394731-11394753 TCATCACCAGGATCTACAACAGG - Intronic
988518381 5:31924375-31924397 TTCTCCCCATCATGGACAAAAGG - Intronic
992023571 5:72649386-72649408 TCCTCCCCTGCACAGACAAATGG + Intergenic
993013169 5:82507070-82507092 TCCTGCCCAGGATCAAGGAAAGG + Intergenic
994749304 5:103719153-103719175 TAGTCCTCAGGATGGACAAAAGG - Intergenic
1001184116 5:169551115-169551137 TCCTCACCTGGATATACAAAGGG - Intergenic
1001695876 5:173669433-173669455 TCCTCTCCAGGAGCTCCAAAAGG + Intergenic
1001998465 5:176181103-176181125 TCCTCCCCAGAATCCACCAGTGG + Intergenic
1002431124 5:179204589-179204611 TCCTCCCCAAGACCACCAAAGGG + Intronic
1003283120 6:4711412-4711434 TCCCCCTCAGGAGCGACAGAAGG + Intronic
1006519960 6:34565520-34565542 CCCTCCCCAGGATCCACATGTGG + Intergenic
1009923930 6:70097466-70097488 TCCTCCTCAGGATCAAGAAGTGG - Intronic
1012321338 6:97850591-97850613 TTCTCCCCAGGATCAAGCAATGG + Intergenic
1015754807 6:136596525-136596547 TCCTTCCCCTGATCTACAAATGG - Intronic
1017180988 6:151551725-151551747 TCCTCCCCAGGATTGACCAGGGG - Intronic
1023929807 7:44698372-44698394 AGCTCCCCAGGATGGAGAAAGGG - Intronic
1026368754 7:69676654-69676676 TCCTCCCCAAGATGGACATATGG - Intronic
1031925730 7:127636538-127636560 TCCTAGCCAGGACAGACAAATGG - Intergenic
1034885452 7:154795042-154795064 TCCGCCCCAGGTTAGATAAAAGG - Intronic
1037605441 8:20434071-20434093 TCCGCCCCAGAATCCACAATGGG + Intergenic
1042843146 8:73145005-73145027 TCCTCCTCTTGATTGACAAAAGG + Intergenic
1045722892 8:105134571-105134593 TCCTCCTCAGGCCCAACAAAAGG + Intronic
1054763761 9:69025946-69025968 TCTTGCCCAGGGTCGACCAATGG + Intergenic
1056269748 9:84935592-84935614 ATCTCCCCAAGATGGACAAATGG + Intronic
1058426770 9:104882213-104882235 TCCTCCCCATCATGGACCAATGG - Intronic
1059533935 9:115063740-115063762 TCCTCCCGAGCAGAGACAAAGGG + Intronic
1059651909 9:116322979-116323001 TCCCTCCCATGATTGACAAAAGG + Intronic
1062571375 9:137187158-137187180 TCCTCCCCAGGATCGACAAAAGG + Intronic
1186964817 X:14775800-14775822 TCCTACCCAGCATCCACAATTGG + Intergenic
1191692657 X:63957066-63957088 TCCACACCAGGATAGGCAAATGG - Intergenic
1198164038 X:134035986-134036008 TTCTCCCCAGGATGTTCAAAAGG - Intergenic
1202057446 Y:20849820-20849842 CCCACCCCAGGATCCACAACAGG - Intergenic