ID: 1062572473

View in Genome Browser
Species Human (GRCh38)
Location 9:137191952-137191974
Sequence GCTAGGGTGCCTCCTGCCAT CGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 154
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 145}

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1062572473_1062572489 27 Left 1062572473 9:137191952-137191974 CCGATGGCAGGAGGCACCCTAGC 0: 1
1: 0
2: 0
3: 8
4: 145
Right 1062572489 9:137192002-137192024 GGATACAGTGAGGCCAAACAAGG 0: 1
1: 0
2: 0
3: 17
4: 179
1062572473_1062572488 17 Left 1062572473 9:137191952-137191974 CCGATGGCAGGAGGCACCCTAGC 0: 1
1: 0
2: 0
3: 8
4: 145
Right 1062572488 9:137191992-137192014 GGGGTGGGTGGGATACAGTGAGG 0: 1
1: 1
2: 10
3: 53
4: 512
1062572473_1062572479 -4 Left 1062572473 9:137191952-137191974 CCGATGGCAGGAGGCACCCTAGC 0: 1
1: 0
2: 0
3: 8
4: 145
Right 1062572479 9:137191971-137191993 TAGCTGCTTCCAGGGCCAGGAGG 0: 1
1: 0
2: 0
3: 24
4: 273
1062572473_1062572481 -2 Left 1062572473 9:137191952-137191974 CCGATGGCAGGAGGCACCCTAGC 0: 1
1: 0
2: 0
3: 8
4: 145
Right 1062572481 9:137191973-137191995 GCTGCTTCCAGGGCCAGGAGGGG 0: 1
1: 0
2: 5
3: 69
4: 541
1062572473_1062572477 -7 Left 1062572473 9:137191952-137191974 CCGATGGCAGGAGGCACCCTAGC 0: 1
1: 0
2: 0
3: 8
4: 145
Right 1062572477 9:137191968-137191990 CCCTAGCTGCTTCCAGGGCCAGG 0: 1
1: 0
2: 1
3: 32
4: 394
1062572473_1062572483 2 Left 1062572473 9:137191952-137191974 CCGATGGCAGGAGGCACCCTAGC 0: 1
1: 0
2: 0
3: 8
4: 145
Right 1062572483 9:137191977-137191999 CTTCCAGGGCCAGGAGGGGTGGG 0: 1
1: 0
2: 3
3: 45
4: 435
1062572473_1062572485 5 Left 1062572473 9:137191952-137191974 CCGATGGCAGGAGGCACCCTAGC 0: 1
1: 0
2: 0
3: 8
4: 145
Right 1062572485 9:137191980-137192002 CCAGGGCCAGGAGGGGTGGGTGG 0: 1
1: 1
2: 12
3: 216
4: 1381
1062572473_1062572486 6 Left 1062572473 9:137191952-137191974 CCGATGGCAGGAGGCACCCTAGC 0: 1
1: 0
2: 0
3: 8
4: 145
Right 1062572486 9:137191981-137192003 CAGGGCCAGGAGGGGTGGGTGGG 0: 1
1: 0
2: 9
3: 124
4: 953
1062572473_1062572480 -3 Left 1062572473 9:137191952-137191974 CCGATGGCAGGAGGCACCCTAGC 0: 1
1: 0
2: 0
3: 8
4: 145
Right 1062572480 9:137191972-137191994 AGCTGCTTCCAGGGCCAGGAGGG 0: 1
1: 0
2: 6
3: 54
4: 388
1062572473_1062572482 1 Left 1062572473 9:137191952-137191974 CCGATGGCAGGAGGCACCCTAGC 0: 1
1: 0
2: 0
3: 8
4: 145
Right 1062572482 9:137191976-137191998 GCTTCCAGGGCCAGGAGGGGTGG 0: 1
1: 0
2: 8
3: 77
4: 802

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1062572473 Original CRISPR GCTAGGGTGCCTCCTGCCAT CGG (reversed) Exonic
900412672 1:2520026-2520048 CCGCGCGTGCCTCCTGCCATGGG - Intronic
914355735 1:146882644-146882666 GCTGGGGTCACTCCTGCCACTGG - Intergenic
917863376 1:179170129-179170151 CATATGATGCCTCCTGCCATGGG - Intronic
919788509 1:201275409-201275431 GCTAGGGTGCCAGCTGCCCTGGG + Intergenic
921179090 1:212617516-212617538 GCTGGGGTGCCACCTGCAAGTGG - Intronic
923686100 1:236154833-236154855 GCCCGGGACCCTCCTGCCATAGG + Intronic
1065396484 10:25244325-25244347 CCTAAGGTGGCTCCTGCCTTAGG - Intronic
1065780593 10:29162907-29162929 GCCAGGCTGCCTCCTGTCTTAGG - Intergenic
1067561468 10:47307634-47307656 GCTTGAATGCCTCCTGCCAGAGG - Intronic
1069644123 10:69979747-69979769 GCTAGAGTGCATCCTGCCCTAGG + Intergenic
1069728041 10:70593836-70593858 GCTTCTGTGCTTCCTGCCATTGG + Intergenic
1069878135 10:71575626-71575648 GCCAGGGTGCGACCTGCCAAGGG - Intronic
1070766759 10:79061263-79061285 GCTAGTTTGCCTTCTGCCTTTGG - Intergenic
1071256162 10:83873718-83873740 GCTGGGATGATTCCTGCCATGGG - Intergenic
1075346250 10:121683920-121683942 CCTAGGGCACCTCCTGCCCTGGG - Intergenic
1076916879 10:133427394-133427416 CCAAGGGTGGCTCCTGCCATCGG + Intergenic
1076936980 10:133572194-133572216 CCGAGGGTGGCTCCTGACATCGG + Intergenic
1081526930 11:43933872-43933894 GCCAGGGTGCCTCCTCCGGTGGG + Intronic
1081719513 11:45277628-45277650 GTTAGGCTTCCTCCTGCCACAGG + Intronic
1083033992 11:59619740-59619762 GCTAGGTTGCGTGCTGTCATGGG - Intergenic
1084459690 11:69289669-69289691 GCTTGGGTTCCTCCTGGGATGGG - Intergenic
1085610606 11:77945395-77945417 ACTAGTGTGCATCCTGCCCTGGG + Intronic
1091595431 12:1875562-1875584 GATAGGGAGCTCCCTGCCATGGG - Intronic
1100504209 12:95204212-95204234 GCTATGGTTTCTCCAGCCATGGG + Intronic
1103596373 12:122026677-122026699 GCTAGGGTGAGGCCAGCCATGGG + Intronic
1103811103 12:123614590-123614612 GCCAGGGAGCCTCCTTCCCTGGG - Intronic
1103895817 12:124272458-124272480 GCTAGTCTGCCTCCTCCCAAGGG - Intronic
1104216598 12:126739984-126740006 GGTAGGGGGCCTCCTGGCATAGG + Intergenic
1104973218 12:132540769-132540791 GCTGGGAGTCCTCCTGCCATCGG - Intronic
1104975869 12:132551736-132551758 GCCAAGGAGCCTCCTGCCAAGGG - Intronic
1107484581 13:40813638-40813660 GGCAGGGTGCCTCCTGGCTTGGG + Intergenic
1109547058 13:63843969-63843991 GCGGGGGTGCCTCCCGCCCTGGG - Intergenic
1113609699 13:111635379-111635401 GCTTGGGCGGCTCCTGCGATTGG - Intronic
1116986483 14:51225228-51225250 GCTCTGGGGCCTCCAGCCATTGG + Intergenic
1119650774 14:76381333-76381355 GCCAGCCTGCCTCCTGCCACTGG + Intronic
1120708229 14:87766845-87766867 GCTTGGATGCCTTGTGCCATTGG - Intergenic
1126480165 15:49110497-49110519 ACCAGACTGCCTCCTGCCATGGG + Intronic
1126819576 15:52488932-52488954 GCTATAATGCCTCCTCCCATGGG - Intronic
1127661606 15:61104693-61104715 GGTAGAGTTCCTCCTGCCACAGG + Intronic
1129270123 15:74415183-74415205 GATGGGGTTCCTCCTGCCTTGGG - Intronic
1129725039 15:77897412-77897434 GCTCGGGTGCCTCATGCCTGTGG + Intergenic
1130834125 15:87632665-87632687 GCTAAGCTGGCTCCTGCCTTGGG + Intergenic
1131080038 15:89527079-89527101 GCCAGGTTGCCACCTGCCCTGGG + Intergenic
1132953550 16:2578557-2578579 GCTGGGGTTCCTCCTGCCCCAGG + Intronic
1132960801 16:2621610-2621632 GCTGGGGTTCCTCCTGCCCCGGG - Intergenic
1133054350 16:3138138-3138160 GCTGGGGACCCTCCTGCCAAAGG - Intronic
1135043443 16:19135673-19135695 CCAAGGGTGCCTCTTGCCTTTGG - Intronic
1135188562 16:20335799-20335821 GCCAGGCTCCCTCCTGCCACAGG + Intronic
1135189073 16:20340018-20340040 GCTGGGCTGCCTGCTGCCCTGGG + Intronic
1138414774 16:56865342-56865364 GCTGGGGTGGCTGCTGTCATAGG - Exonic
1138715541 16:59017931-59017953 TTTAGGGTGACTCCAGCCATGGG - Intergenic
1139978282 16:70832800-70832822 GCTGGGGTCACTCCTGCCACTGG + Intronic
1141445571 16:84055617-84055639 GCCAGGGCGGCTGCTGCCATTGG + Intronic
1144675577 17:17159315-17159337 GCTCGCGCCCCTCCTGCCATCGG - Intronic
1145055770 17:19703201-19703223 GCAAGGGTGCTTCCTGGCTTGGG - Intronic
1146833954 17:36094879-36094901 CCTGGGGTGCCTGCTGCCAAAGG - Intergenic
1152534747 17:80943944-80943966 GCTGGGCTGCCTCCTGGCCTTGG - Intronic
1152639966 17:81445270-81445292 GCTTGGGTTCATCCTGCCAGAGG - Intronic
1156300566 18:35832754-35832776 CTTAGGGTGGATCCTGCCATGGG + Intergenic
1156467444 18:37356776-37356798 GCTAGGCTGCCTTCTGACCTTGG + Intronic
1157299531 18:46469512-46469534 CCTAGGGAGCCTTCTGCCATGGG + Intergenic
1158472681 18:57751704-57751726 GCTAGGGTGGGGCCTGCAATGGG - Intronic
1160600797 18:80011017-80011039 GCTAGGGTTCCTCCTGGGGTTGG + Intronic
1163102686 19:15107644-15107666 ACTGGGGTGCCTCCAGCCAGGGG + Intronic
1163435280 19:17291917-17291939 GATAAGTTGCCTCCTGCCCTGGG + Intergenic
1164741927 19:30582244-30582266 TATAGGGTGCCTACTGCCAAGGG + Intronic
1165657852 19:37549597-37549619 GCTAGGGTCCGTCCAGCCTTGGG - Intergenic
1166897637 19:46033786-46033808 GCAAAGGTGCCACCAGCCATGGG + Intergenic
1168101657 19:54144658-54144680 GCCAGGAGGCCTCTTGCCATGGG - Intronic
925160657 2:1681260-1681282 GATAGTGTGTTTCCTGCCATGGG - Intronic
926205702 2:10833231-10833253 GCCAGGCTGGCTCCTGCCCTCGG + Intronic
926632199 2:15146858-15146880 GGTTGTGTGCCACCTGCCATGGG + Intergenic
927191304 2:20519043-20519065 GATAGGGGTTCTCCTGCCATGGG - Intergenic
937468570 2:122155902-122155924 GTTGGGCTGCCTCCTGCCGTGGG + Intergenic
938722383 2:134078144-134078166 GGTTGGGTGCCTCCTGCCCATGG - Intergenic
940991174 2:160098153-160098175 GCTGGGGTAACTCCTGGCATAGG + Intergenic
944131791 2:196354492-196354514 GACAGGGTGCCTCCTGCTGTGGG + Intronic
946135723 2:217645406-217645428 GCTAGGGTCCCTCCTTCCAGAGG - Intronic
946374673 2:219300886-219300908 GCAAGGGGGCGTGCTGCCATGGG + Intronic
946445247 2:219733868-219733890 GCTGGGCTGCTTCCTGCCTTGGG + Intergenic
947716957 2:232345635-232345657 GTTGGGGTGTCTCCTGCCTTGGG + Intergenic
947735399 2:232451956-232451978 GTTGGGGTGTCTCCTGCCTTGGG + Intergenic
947764064 2:232624506-232624528 ACAAGGGTGCCCCCTGGCATAGG - Intronic
948142898 2:235687137-235687159 GCTAGGGTGCATCCCTTCATTGG - Intronic
1168892913 20:1306265-1306287 GCTGGTGTACCTCCTGCCTTGGG - Exonic
1169688695 20:8305991-8306013 GCTAGGATGCCTCCAGAAATGGG + Intronic
1174065362 20:47860729-47860751 GCCTGGGTGCCTCCAGCCCTGGG + Intergenic
1177871389 21:26577258-26577280 GCTATGTGGCCTCTTGCCATGGG - Intergenic
1182571241 22:31240086-31240108 GCTAGAGTCCCTTCTCCCATGGG + Intronic
1182712532 22:32331830-32331852 CCTGGGGTTCCTCCTGCCACGGG + Intergenic
1182963620 22:34501366-34501388 GAACAGGTGCCTCCTGCCATGGG + Intergenic
1185277917 22:49957737-49957759 GCATGGGTGCCTCCTTCCCTTGG - Intergenic
953068764 3:39499206-39499228 GCTAGAGTTTCTCCTCCCATGGG - Intronic
953412530 3:42698382-42698404 ACTAGGGTGCCTCCTGTCTCTGG + Intronic
960907469 3:122615836-122615858 CCTTGGGTATCTCCTGCCATGGG - Exonic
963968573 3:151402568-151402590 GCTAGGGTCCTTCCCGCCCTAGG - Intronic
965140623 3:164829330-164829352 CCTAGTGAGCCTCCTTCCATGGG + Intergenic
969337364 4:6519520-6519542 GCCATGCTGCCTCCTGCCACAGG + Intronic
969511813 4:7622407-7622429 GGTAGGGAGCCTCTTGCCACTGG + Intronic
979206406 4:118043647-118043669 GCTACGGTGCCACCTTCCACAGG + Intronic
983934586 4:173492481-173492503 GCTTGGGTGCCTCATGCCTGAGG - Intergenic
985818578 5:2144849-2144871 TGTAGGGAGCCTCCTACCATAGG - Intergenic
985919328 5:2957238-2957260 GCTAGAATGCATCCTGCCCTAGG - Intergenic
985941589 5:3140708-3140730 GCCAAGGTCCCTCCTGCCTTGGG + Intergenic
987577755 5:19752634-19752656 TCTAGGGCCCCACCTGCCATGGG + Intronic
990317910 5:54601533-54601555 GCTAGGCTGCTTCCTGCCTCAGG - Intergenic
990760608 5:59125530-59125552 GCTAGGGTGCCTGGTGCAAAGGG + Intronic
993972952 5:94442375-94442397 GCTAGGAAACCTCCTGCCTTGGG + Intronic
999381534 5:151124641-151124663 GCTAGGCTCCCGCCTGCCACGGG + Intronic
999718342 5:154379980-154380002 GCTGGGGTGCCTACTGCTTTGGG + Intronic
1000481132 5:161775722-161775744 GCTAAGGTCCCACCTGTCATGGG - Intergenic
1002044043 5:176532261-176532283 GCCAGGGTGACTCCCCCCATGGG + Intronic
1002511466 5:179721478-179721500 GCTAGGGTTGCTTCAGCCATAGG + Intronic
1002581985 5:180214703-180214725 GCTAGGGTCCCTTCACCCATAGG + Intergenic
1005704373 6:28436824-28436846 GGTAGAGTCCCTCCAGCCATAGG + Intronic
1006658224 6:35615288-35615310 GCTAGGTTTGCTCCTGCTATGGG - Intronic
1014479020 6:121912067-121912089 ACTAGAGTGCTTCCTGCCCTGGG - Intergenic
1019604165 7:1900240-1900262 GCAAGGGCGCTGCCTGCCATGGG + Intronic
1019882610 7:3876009-3876031 GCTTGGTAGCCTCTTGCCATAGG + Intronic
1022220825 7:28311902-28311924 GCTGGTGTGGCTCCTCCCATAGG + Intronic
1022706536 7:32807187-32807209 GCTAGGATGCTCGCTGCCATAGG - Intergenic
1023848606 7:44138375-44138397 GCTTGGGTGCCTCCCTGCATGGG - Intergenic
1025842498 7:65163651-65163673 ACTAGTGTGCATCCTGCCCTGGG - Intergenic
1025880547 7:65532318-65532340 ACTAGTGTGCATCCTGCCCTGGG + Intergenic
1025892890 7:65670286-65670308 ACTAGTGTGCATCCTGCCCTGGG - Intergenic
1026066930 7:67082899-67082921 GCTAGAGTGTATCCTGCCCTGGG - Intronic
1026709995 7:72729441-72729463 GCTAGAGTGTATCCTGCCCTGGG + Intronic
1026912047 7:74096705-74096727 GCTATGGCGAGTCCTGCCATGGG + Exonic
1028949589 7:96619879-96619901 GCTAGGCTTCCCCCTGCCCTTGG - Intronic
1029206019 7:98869798-98869820 GCTTGCCTGCCTCCTGCCCTGGG - Exonic
1029434701 7:100556438-100556460 CTTTGGGTGCCTTCTGCCATTGG + Intronic
1032412692 7:131709613-131709635 GCTAGGGTGCTCATTGCCATGGG + Intergenic
1033607759 7:142939883-142939905 GCTAGGGTGAGACCTGACATAGG + Intronic
1034564176 7:151900099-151900121 GCCAGGCTCCCTCCTGCCTTGGG + Intergenic
1036696954 8:10981285-10981307 GCTAGAGTTAATCCTGCCATGGG - Intronic
1038010835 8:23474770-23474792 TCAAGAGAGCCTCCTGCCATAGG + Intergenic
1041484453 8:58359144-58359166 GCTAGAGTGCATCTTGCCCTGGG + Intergenic
1044184966 8:89240041-89240063 CTTAGGGTGGATCCTGCCATGGG - Intergenic
1046611951 8:116435643-116435665 GCTTGGGTTCCTCCTCCCAGTGG - Intergenic
1046797041 8:118384588-118384610 GAAATGGTGCCTCCAGCCATTGG - Intronic
1048186168 8:132243045-132243067 GCTAGGGTTCCTTCTGCAATGGG - Intronic
1049317434 8:141976827-141976849 GCAAGGCTGCCTCCTTCCACAGG - Intergenic
1049796283 8:144498644-144498666 TCTGGTGTGCCTCCTGCCATCGG + Intronic
1057303146 9:93897887-93897909 GTTGGGGTGCCGGCTGCCATTGG + Intergenic
1057707971 9:97411798-97411820 GCGAGGGTGGCTCCTTCTATGGG - Intergenic
1060732388 9:126046844-126046866 GCAAGGGTCACTCCTGCCCTGGG + Intergenic
1060780305 9:126407338-126407360 GCCAGGGTCCCTCCTGCTTTGGG - Intronic
1061653511 9:132069817-132069839 GCTATGTGGCCTCCTGCCAGTGG - Intronic
1061809652 9:133154913-133154935 GCAAGGGGGCCTCCTGACAAAGG + Intronic
1062572473 9:137191952-137191974 GCTAGGGTGCCTCCTGCCATCGG - Exonic
1188427666 X:30067739-30067761 GCTGGGCTGCACCCTGCCATTGG + Intergenic
1195491935 X:105480770-105480792 GCTAGAGTGCATGCTGCCACAGG - Intronic
1196968875 X:121087111-121087133 GCTAGAGTGCATCATGCCCTGGG - Intergenic
1202095385 Y:21243992-21244014 GCCAGGTTGGCCCCTGCCATGGG + Intergenic