ID: 1062574466

View in Genome Browser
Species Human (GRCh38)
Location 9:137199968-137199990
Sequence CCCCGCCTGGGTCGGGACAG TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 170
Summary {0: 1, 1: 0, 2: 0, 3: 17, 4: 152}

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1062574466_1062574479 4 Left 1062574466 9:137199968-137199990 CCACTGTCCCGACCCAGGCGGGG 0: 1
1: 0
2: 0
3: 17
4: 152
Right 1062574479 9:137199995-137200017 CGCGAGGCGGTTGGCAGGGCCGG 0: 1
1: 0
2: 2
3: 14
4: 308
1062574466_1062574482 11 Left 1062574466 9:137199968-137199990 CCACTGTCCCGACCCAGGCGGGG 0: 1
1: 0
2: 0
3: 17
4: 152
Right 1062574482 9:137200002-137200024 CGGTTGGCAGGGCCGGCCCGGGG 0: 1
1: 0
2: 0
3: 22
4: 161
1062574466_1062574483 17 Left 1062574466 9:137199968-137199990 CCACTGTCCCGACCCAGGCGGGG 0: 1
1: 0
2: 0
3: 17
4: 152
Right 1062574483 9:137200008-137200030 GCAGGGCCGGCCCGGGGCTCAGG 0: 1
1: 0
2: 8
3: 80
4: 647
1062574466_1062574484 18 Left 1062574466 9:137199968-137199990 CCACTGTCCCGACCCAGGCGGGG 0: 1
1: 0
2: 0
3: 17
4: 152
Right 1062574484 9:137200009-137200031 CAGGGCCGGCCCGGGGCTCAGGG 0: 1
1: 0
2: 4
3: 37
4: 410
1062574466_1062574485 19 Left 1062574466 9:137199968-137199990 CCACTGTCCCGACCCAGGCGGGG 0: 1
1: 0
2: 0
3: 17
4: 152
Right 1062574485 9:137200010-137200032 AGGGCCGGCCCGGGGCTCAGGGG 0: 1
1: 0
2: 3
3: 46
4: 452
1062574466_1062574481 10 Left 1062574466 9:137199968-137199990 CCACTGTCCCGACCCAGGCGGGG 0: 1
1: 0
2: 0
3: 17
4: 152
Right 1062574481 9:137200001-137200023 GCGGTTGGCAGGGCCGGCCCGGG 0: 1
1: 0
2: 3
3: 30
4: 297
1062574466_1062574476 0 Left 1062574466 9:137199968-137199990 CCACTGTCCCGACCCAGGCGGGG 0: 1
1: 0
2: 0
3: 17
4: 152
Right 1062574476 9:137199991-137200013 AGCCCGCGAGGCGGTTGGCAGGG 0: 1
1: 0
2: 0
3: 6
4: 66
1062574466_1062574475 -1 Left 1062574466 9:137199968-137199990 CCACTGTCCCGACCCAGGCGGGG 0: 1
1: 0
2: 0
3: 17
4: 152
Right 1062574475 9:137199990-137200012 GAGCCCGCGAGGCGGTTGGCAGG 0: 1
1: 0
2: 0
3: 8
4: 82
1062574466_1062574480 9 Left 1062574466 9:137199968-137199990 CCACTGTCCCGACCCAGGCGGGG 0: 1
1: 0
2: 0
3: 17
4: 152
Right 1062574480 9:137200000-137200022 GGCGGTTGGCAGGGCCGGCCCGG 0: 1
1: 0
2: 3
3: 25
4: 345
1062574466_1062574473 -9 Left 1062574466 9:137199968-137199990 CCACTGTCCCGACCCAGGCGGGG 0: 1
1: 0
2: 0
3: 17
4: 152
Right 1062574473 9:137199982-137200004 CAGGCGGGGAGCCCGCGAGGCGG 0: 1
1: 0
2: 0
3: 28
4: 246
1062574466_1062574474 -5 Left 1062574466 9:137199968-137199990 CCACTGTCCCGACCCAGGCGGGG 0: 1
1: 0
2: 0
3: 17
4: 152
Right 1062574474 9:137199986-137200008 CGGGGAGCCCGCGAGGCGGTTGG 0: 1
1: 0
2: 0
3: 6
4: 145

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1062574466 Original CRISPR CCCCGCCTGGGTCGGGACAG TGG (reversed) Exonic