ID: 1062574468

View in Genome Browser
Species Human (GRCh38)
Location 9:137199975-137199997
Sequence GCGGGCTCCCCGCCTGGGTC GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 210
Summary {0: 1, 1: 0, 2: 0, 3: 15, 4: 194}

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1062574468_1062574482 4 Left 1062574468 9:137199975-137199997 CCCGACCCAGGCGGGGAGCCCGC 0: 1
1: 0
2: 0
3: 15
4: 194
Right 1062574482 9:137200002-137200024 CGGTTGGCAGGGCCGGCCCGGGG 0: 1
1: 0
2: 0
3: 22
4: 161
1062574468_1062574485 12 Left 1062574468 9:137199975-137199997 CCCGACCCAGGCGGGGAGCCCGC 0: 1
1: 0
2: 0
3: 15
4: 194
Right 1062574485 9:137200010-137200032 AGGGCCGGCCCGGGGCTCAGGGG 0: 1
1: 0
2: 3
3: 46
4: 452
1062574468_1062574480 2 Left 1062574468 9:137199975-137199997 CCCGACCCAGGCGGGGAGCCCGC 0: 1
1: 0
2: 0
3: 15
4: 194
Right 1062574480 9:137200000-137200022 GGCGGTTGGCAGGGCCGGCCCGG 0: 1
1: 0
2: 3
3: 25
4: 345
1062574468_1062574479 -3 Left 1062574468 9:137199975-137199997 CCCGACCCAGGCGGGGAGCCCGC 0: 1
1: 0
2: 0
3: 15
4: 194
Right 1062574479 9:137199995-137200017 CGCGAGGCGGTTGGCAGGGCCGG 0: 1
1: 0
2: 2
3: 14
4: 308
1062574468_1062574476 -7 Left 1062574468 9:137199975-137199997 CCCGACCCAGGCGGGGAGCCCGC 0: 1
1: 0
2: 0
3: 15
4: 194
Right 1062574476 9:137199991-137200013 AGCCCGCGAGGCGGTTGGCAGGG 0: 1
1: 0
2: 0
3: 6
4: 66
1062574468_1062574489 27 Left 1062574468 9:137199975-137199997 CCCGACCCAGGCGGGGAGCCCGC 0: 1
1: 0
2: 0
3: 15
4: 194
Right 1062574489 9:137200025-137200047 CTCAGGGGCCGAGTGCCCGTTGG 0: 1
1: 0
2: 0
3: 2
4: 81
1062574468_1062574484 11 Left 1062574468 9:137199975-137199997 CCCGACCCAGGCGGGGAGCCCGC 0: 1
1: 0
2: 0
3: 15
4: 194
Right 1062574484 9:137200009-137200031 CAGGGCCGGCCCGGGGCTCAGGG 0: 1
1: 0
2: 4
3: 37
4: 410
1062574468_1062574481 3 Left 1062574468 9:137199975-137199997 CCCGACCCAGGCGGGGAGCCCGC 0: 1
1: 0
2: 0
3: 15
4: 194
Right 1062574481 9:137200001-137200023 GCGGTTGGCAGGGCCGGCCCGGG 0: 1
1: 0
2: 3
3: 30
4: 297
1062574468_1062574483 10 Left 1062574468 9:137199975-137199997 CCCGACCCAGGCGGGGAGCCCGC 0: 1
1: 0
2: 0
3: 15
4: 194
Right 1062574483 9:137200008-137200030 GCAGGGCCGGCCCGGGGCTCAGG 0: 1
1: 0
2: 8
3: 80
4: 647
1062574468_1062574475 -8 Left 1062574468 9:137199975-137199997 CCCGACCCAGGCGGGGAGCCCGC 0: 1
1: 0
2: 0
3: 15
4: 194
Right 1062574475 9:137199990-137200012 GAGCCCGCGAGGCGGTTGGCAGG 0: 1
1: 0
2: 0
3: 8
4: 82

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1062574468 Original CRISPR GCGGGCTCCCCGCCTGGGTC GGG (reversed) Exonic