ID: 1062574472

View in Genome Browser
Species Human (GRCh38)
Location 9:137199981-137200003
Sequence CGCCTCGCGGGCTCCCCGCC TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 188
Summary {0: 1, 1: 0, 2: 2, 3: 32, 4: 153}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1062574472_1062574482 -2 Left 1062574472 9:137199981-137200003 CCAGGCGGGGAGCCCGCGAGGCG 0: 1
1: 0
2: 2
3: 32
4: 153
Right 1062574482 9:137200002-137200024 CGGTTGGCAGGGCCGGCCCGGGG 0: 1
1: 0
2: 0
3: 22
4: 161
1062574472_1062574491 29 Left 1062574472 9:137199981-137200003 CCAGGCGGGGAGCCCGCGAGGCG 0: 1
1: 0
2: 2
3: 32
4: 153
Right 1062574491 9:137200033-137200055 CCGAGTGCCCGTTGGAGAGCAGG 0: 1
1: 0
2: 0
3: 2
4: 63
1062574472_1062574483 4 Left 1062574472 9:137199981-137200003 CCAGGCGGGGAGCCCGCGAGGCG 0: 1
1: 0
2: 2
3: 32
4: 153
Right 1062574483 9:137200008-137200030 GCAGGGCCGGCCCGGGGCTCAGG 0: 1
1: 0
2: 8
3: 80
4: 647
1062574472_1062574481 -3 Left 1062574472 9:137199981-137200003 CCAGGCGGGGAGCCCGCGAGGCG 0: 1
1: 0
2: 2
3: 32
4: 153
Right 1062574481 9:137200001-137200023 GCGGTTGGCAGGGCCGGCCCGGG 0: 1
1: 0
2: 3
3: 30
4: 297
1062574472_1062574485 6 Left 1062574472 9:137199981-137200003 CCAGGCGGGGAGCCCGCGAGGCG 0: 1
1: 0
2: 2
3: 32
4: 153
Right 1062574485 9:137200010-137200032 AGGGCCGGCCCGGGGCTCAGGGG 0: 1
1: 0
2: 3
3: 46
4: 452
1062574472_1062574479 -9 Left 1062574472 9:137199981-137200003 CCAGGCGGGGAGCCCGCGAGGCG 0: 1
1: 0
2: 2
3: 32
4: 153
Right 1062574479 9:137199995-137200017 CGCGAGGCGGTTGGCAGGGCCGG 0: 1
1: 0
2: 2
3: 14
4: 308
1062574472_1062574480 -4 Left 1062574472 9:137199981-137200003 CCAGGCGGGGAGCCCGCGAGGCG 0: 1
1: 0
2: 2
3: 32
4: 153
Right 1062574480 9:137200000-137200022 GGCGGTTGGCAGGGCCGGCCCGG 0: 1
1: 0
2: 3
3: 25
4: 345
1062574472_1062574489 21 Left 1062574472 9:137199981-137200003 CCAGGCGGGGAGCCCGCGAGGCG 0: 1
1: 0
2: 2
3: 32
4: 153
Right 1062574489 9:137200025-137200047 CTCAGGGGCCGAGTGCCCGTTGG 0: 1
1: 0
2: 0
3: 2
4: 81
1062574472_1062574484 5 Left 1062574472 9:137199981-137200003 CCAGGCGGGGAGCCCGCGAGGCG 0: 1
1: 0
2: 2
3: 32
4: 153
Right 1062574484 9:137200009-137200031 CAGGGCCGGCCCGGGGCTCAGGG 0: 1
1: 0
2: 4
3: 37
4: 410

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1062574472 Original CRISPR CGCCTCGCGGGCTCCCCGCC TGG (reversed) Exonic