ID: 1062574478

View in Genome Browser
Species Human (GRCh38)
Location 9:137199994-137200016
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 90
Summary {0: 1, 1: 0, 2: 1, 3: 10, 4: 78}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1062574478_1062574483 -9 Left 1062574478 9:137199994-137200016 CCGCGAGGCGGTTGGCAGGGCCG 0: 1
1: 0
2: 1
3: 10
4: 78
Right 1062574483 9:137200008-137200030 GCAGGGCCGGCCCGGGGCTCAGG 0: 1
1: 0
2: 8
3: 80
4: 647
1062574478_1062574491 16 Left 1062574478 9:137199994-137200016 CCGCGAGGCGGTTGGCAGGGCCG 0: 1
1: 0
2: 1
3: 10
4: 78
Right 1062574491 9:137200033-137200055 CCGAGTGCCCGTTGGAGAGCAGG 0: 1
1: 0
2: 0
3: 2
4: 63
1062574478_1062574489 8 Left 1062574478 9:137199994-137200016 CCGCGAGGCGGTTGGCAGGGCCG 0: 1
1: 0
2: 1
3: 10
4: 78
Right 1062574489 9:137200025-137200047 CTCAGGGGCCGAGTGCCCGTTGG 0: 1
1: 0
2: 0
3: 2
4: 81
1062574478_1062574493 20 Left 1062574478 9:137199994-137200016 CCGCGAGGCGGTTGGCAGGGCCG 0: 1
1: 0
2: 1
3: 10
4: 78
Right 1062574493 9:137200037-137200059 GTGCCCGTTGGAGAGCAGGCGGG 0: 1
1: 0
2: 0
3: 7
4: 133
1062574478_1062574492 19 Left 1062574478 9:137199994-137200016 CCGCGAGGCGGTTGGCAGGGCCG 0: 1
1: 0
2: 1
3: 10
4: 78
Right 1062574492 9:137200036-137200058 AGTGCCCGTTGGAGAGCAGGCGG 0: 1
1: 0
2: 1
3: 14
4: 236
1062574478_1062574485 -7 Left 1062574478 9:137199994-137200016 CCGCGAGGCGGTTGGCAGGGCCG 0: 1
1: 0
2: 1
3: 10
4: 78
Right 1062574485 9:137200010-137200032 AGGGCCGGCCCGGGGCTCAGGGG 0: 1
1: 0
2: 3
3: 46
4: 452
1062574478_1062574484 -8 Left 1062574478 9:137199994-137200016 CCGCGAGGCGGTTGGCAGGGCCG 0: 1
1: 0
2: 1
3: 10
4: 78
Right 1062574484 9:137200009-137200031 CAGGGCCGGCCCGGGGCTCAGGG 0: 1
1: 0
2: 4
3: 37
4: 410

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1062574478 Original CRISPR CGGCCCTGCCAACCGCCTCG CGG (reversed) Exonic