ID: 1062574485

View in Genome Browser
Species Human (GRCh38)
Location 9:137200010-137200032
Sequence AGGGCCGGCCCGGGGCTCAG GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 502
Summary {0: 1, 1: 0, 2: 3, 3: 46, 4: 452}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1062574472_1062574485 6 Left 1062574472 9:137199981-137200003 CCAGGCGGGGAGCCCGCGAGGCG 0: 1
1: 0
2: 2
3: 32
4: 153
Right 1062574485 9:137200010-137200032 AGGGCCGGCCCGGGGCTCAGGGG 0: 1
1: 0
2: 3
3: 46
4: 452
1062574469_1062574485 11 Left 1062574469 9:137199976-137199998 CCGACCCAGGCGGGGAGCCCGCG 0: 1
1: 0
2: 0
3: 8
4: 131
Right 1062574485 9:137200010-137200032 AGGGCCGGCCCGGGGCTCAGGGG 0: 1
1: 0
2: 3
3: 46
4: 452
1062574471_1062574485 7 Left 1062574471 9:137199980-137200002 CCCAGGCGGGGAGCCCGCGAGGC 0: 1
1: 0
2: 0
3: 26
4: 356
Right 1062574485 9:137200010-137200032 AGGGCCGGCCCGGGGCTCAGGGG 0: 1
1: 0
2: 3
3: 46
4: 452
1062574477_1062574485 -6 Left 1062574477 9:137199993-137200015 CCCGCGAGGCGGTTGGCAGGGCC 0: 1
1: 0
2: 0
3: 9
4: 111
Right 1062574485 9:137200010-137200032 AGGGCCGGCCCGGGGCTCAGGGG 0: 1
1: 0
2: 3
3: 46
4: 452
1062574468_1062574485 12 Left 1062574468 9:137199975-137199997 CCCGACCCAGGCGGGGAGCCCGC 0: 1
1: 0
2: 0
3: 15
4: 194
Right 1062574485 9:137200010-137200032 AGGGCCGGCCCGGGGCTCAGGGG 0: 1
1: 0
2: 3
3: 46
4: 452
1062574462_1062574485 29 Left 1062574462 9:137199958-137199980 CCTTTGGCTTCCACTGTCCCGAC 0: 1
1: 0
2: 0
3: 12
4: 126
Right 1062574485 9:137200010-137200032 AGGGCCGGCCCGGGGCTCAGGGG 0: 1
1: 0
2: 3
3: 46
4: 452
1062574466_1062574485 19 Left 1062574466 9:137199968-137199990 CCACTGTCCCGACCCAGGCGGGG 0: 1
1: 0
2: 0
3: 17
4: 152
Right 1062574485 9:137200010-137200032 AGGGCCGGCCCGGGGCTCAGGGG 0: 1
1: 0
2: 3
3: 46
4: 452
1062574478_1062574485 -7 Left 1062574478 9:137199994-137200016 CCGCGAGGCGGTTGGCAGGGCCG 0: 1
1: 0
2: 1
3: 10
4: 78
Right 1062574485 9:137200010-137200032 AGGGCCGGCCCGGGGCTCAGGGG 0: 1
1: 0
2: 3
3: 46
4: 452

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1062574485 Original CRISPR AGGGCCGGCCCGGGGCTCAG GGG Exonic