ID: 1062574486

View in Genome Browser
Species Human (GRCh38)
Location 9:137200014-137200036
Sequence TCGGCCCCTGAGCCCCGGGC CGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 405
Summary {0: 1, 1: 0, 2: 1, 3: 54, 4: 349}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1062574486_1062574500 27 Left 1062574486 9:137200014-137200036 CCGGCCCGGGGCTCAGGGGCCGA 0: 1
1: 0
2: 1
3: 54
4: 349
Right 1062574500 9:137200064-137200086 CGCGCCGCGGTGCAGACCCCGGG 0: 1
1: 0
2: 1
3: 9
4: 93
1062574486_1062574496 14 Left 1062574486 9:137200014-137200036 CCGGCCCGGGGCTCAGGGGCCGA 0: 1
1: 0
2: 1
3: 54
4: 349
Right 1062574496 9:137200051-137200073 GCAGGCGGGCGCCCGCGCCGCGG 0: 1
1: 0
2: 2
3: 17
4: 319
1062574486_1062574493 0 Left 1062574486 9:137200014-137200036 CCGGCCCGGGGCTCAGGGGCCGA 0: 1
1: 0
2: 1
3: 54
4: 349
Right 1062574493 9:137200037-137200059 GTGCCCGTTGGAGAGCAGGCGGG 0: 1
1: 0
2: 0
3: 7
4: 133
1062574486_1062574499 26 Left 1062574486 9:137200014-137200036 CCGGCCCGGGGCTCAGGGGCCGA 0: 1
1: 0
2: 1
3: 54
4: 349
Right 1062574499 9:137200063-137200085 CCGCGCCGCGGTGCAGACCCCGG 0: 1
1: 0
2: 0
3: 12
4: 108
1062574486_1062574501 28 Left 1062574486 9:137200014-137200036 CCGGCCCGGGGCTCAGGGGCCGA 0: 1
1: 0
2: 1
3: 54
4: 349
Right 1062574501 9:137200065-137200087 GCGCCGCGGTGCAGACCCCGGGG 0: 1
1: 0
2: 1
3: 4
4: 99
1062574486_1062574502 29 Left 1062574486 9:137200014-137200036 CCGGCCCGGGGCTCAGGGGCCGA 0: 1
1: 0
2: 1
3: 54
4: 349
Right 1062574502 9:137200066-137200088 CGCCGCGGTGCAGACCCCGGGGG 0: 1
1: 0
2: 0
3: 7
4: 86
1062574486_1062574492 -1 Left 1062574486 9:137200014-137200036 CCGGCCCGGGGCTCAGGGGCCGA 0: 1
1: 0
2: 1
3: 54
4: 349
Right 1062574492 9:137200036-137200058 AGTGCCCGTTGGAGAGCAGGCGG 0: 1
1: 0
2: 1
3: 14
4: 236
1062574486_1062574491 -4 Left 1062574486 9:137200014-137200036 CCGGCCCGGGGCTCAGGGGCCGA 0: 1
1: 0
2: 1
3: 54
4: 349
Right 1062574491 9:137200033-137200055 CCGAGTGCCCGTTGGAGAGCAGG 0: 1
1: 0
2: 0
3: 2
4: 63

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1062574486 Original CRISPR TCGGCCCCTGAGCCCCGGGC CGG (reversed) Exonic