ID: 1062574489

View in Genome Browser
Species Human (GRCh38)
Location 9:137200025-137200047
Sequence CTCAGGGGCCGAGTGCCCGT TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 84
Summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 81}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1062574478_1062574489 8 Left 1062574478 9:137199994-137200016 CCGCGAGGCGGTTGGCAGGGCCG 0: 1
1: 0
2: 1
3: 10
4: 78
Right 1062574489 9:137200025-137200047 CTCAGGGGCCGAGTGCCCGTTGG 0: 1
1: 0
2: 0
3: 2
4: 81
1062574468_1062574489 27 Left 1062574468 9:137199975-137199997 CCCGACCCAGGCGGGGAGCCCGC 0: 1
1: 0
2: 0
3: 15
4: 194
Right 1062574489 9:137200025-137200047 CTCAGGGGCCGAGTGCCCGTTGG 0: 1
1: 0
2: 0
3: 2
4: 81
1062574472_1062574489 21 Left 1062574472 9:137199981-137200003 CCAGGCGGGGAGCCCGCGAGGCG 0: 1
1: 0
2: 2
3: 32
4: 153
Right 1062574489 9:137200025-137200047 CTCAGGGGCCGAGTGCCCGTTGG 0: 1
1: 0
2: 0
3: 2
4: 81
1062574469_1062574489 26 Left 1062574469 9:137199976-137199998 CCGACCCAGGCGGGGAGCCCGCG 0: 1
1: 0
2: 0
3: 8
4: 131
Right 1062574489 9:137200025-137200047 CTCAGGGGCCGAGTGCCCGTTGG 0: 1
1: 0
2: 0
3: 2
4: 81
1062574477_1062574489 9 Left 1062574477 9:137199993-137200015 CCCGCGAGGCGGTTGGCAGGGCC 0: 1
1: 0
2: 0
3: 9
4: 111
Right 1062574489 9:137200025-137200047 CTCAGGGGCCGAGTGCCCGTTGG 0: 1
1: 0
2: 0
3: 2
4: 81
1062574471_1062574489 22 Left 1062574471 9:137199980-137200002 CCCAGGCGGGGAGCCCGCGAGGC 0: 1
1: 0
2: 0
3: 26
4: 356
Right 1062574489 9:137200025-137200047 CTCAGGGGCCGAGTGCCCGTTGG 0: 1
1: 0
2: 0
3: 2
4: 81

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1062574489 Original CRISPR CTCAGGGGCCGAGTGCCCGT TGG Exonic