ID: 1062574490

View in Genome Browser
Species Human (GRCh38)
Location 9:137200033-137200055
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 169
Summary {0: 1, 1: 0, 2: 0, 3: 14, 4: 154}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1062574490_1062574504 13 Left 1062574490 9:137200033-137200055 CCGAGTGCCCGTTGGAGAGCAGG 0: 1
1: 0
2: 0
3: 14
4: 154
Right 1062574504 9:137200069-137200091 CGCGGTGCAGACCCCGGGGGTGG 0: 1
1: 0
2: 0
3: 16
4: 135
1062574490_1062574506 23 Left 1062574490 9:137200033-137200055 CCGAGTGCCCGTTGGAGAGCAGG 0: 1
1: 0
2: 0
3: 14
4: 154
Right 1062574506 9:137200079-137200101 ACCCCGGGGGTGGACGGTGAAGG 0: 1
1: 0
2: 0
3: 11
4: 145
1062574490_1062574501 9 Left 1062574490 9:137200033-137200055 CCGAGTGCCCGTTGGAGAGCAGG 0: 1
1: 0
2: 0
3: 14
4: 154
Right 1062574501 9:137200065-137200087 GCGCCGCGGTGCAGACCCCGGGG 0: 1
1: 0
2: 1
3: 4
4: 99
1062574490_1062574500 8 Left 1062574490 9:137200033-137200055 CCGAGTGCCCGTTGGAGAGCAGG 0: 1
1: 0
2: 0
3: 14
4: 154
Right 1062574500 9:137200064-137200086 CGCGCCGCGGTGCAGACCCCGGG 0: 1
1: 0
2: 1
3: 9
4: 93
1062574490_1062574496 -5 Left 1062574490 9:137200033-137200055 CCGAGTGCCCGTTGGAGAGCAGG 0: 1
1: 0
2: 0
3: 14
4: 154
Right 1062574496 9:137200051-137200073 GCAGGCGGGCGCCCGCGCCGCGG 0: 1
1: 0
2: 2
3: 17
4: 319
1062574490_1062574499 7 Left 1062574490 9:137200033-137200055 CCGAGTGCCCGTTGGAGAGCAGG 0: 1
1: 0
2: 0
3: 14
4: 154
Right 1062574499 9:137200063-137200085 CCGCGCCGCGGTGCAGACCCCGG 0: 1
1: 0
2: 0
3: 12
4: 108
1062574490_1062574502 10 Left 1062574490 9:137200033-137200055 CCGAGTGCCCGTTGGAGAGCAGG 0: 1
1: 0
2: 0
3: 14
4: 154
Right 1062574502 9:137200066-137200088 CGCCGCGGTGCAGACCCCGGGGG 0: 1
1: 0
2: 0
3: 7
4: 86
1062574490_1062574505 17 Left 1062574490 9:137200033-137200055 CCGAGTGCCCGTTGGAGAGCAGG 0: 1
1: 0
2: 0
3: 14
4: 154
Right 1062574505 9:137200073-137200095 GTGCAGACCCCGGGGGTGGACGG 0: 1
1: 0
2: 1
3: 24
4: 244

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1062574490 Original CRISPR CCTGCTCTCCAACGGGCACT CGG (reversed) Exonic