ID: 1062574491

View in Genome Browser
Species Human (GRCh38)
Location 9:137200033-137200055
Sequence CCGAGTGCCCGTTGGAGAGC AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 66
Summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 63}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1062574487_1062574491 -8 Left 1062574487 9:137200018-137200040 CCCGGGGCTCAGGGGCCGAGTGC 0: 1
1: 0
2: 1
3: 21
4: 264
Right 1062574491 9:137200033-137200055 CCGAGTGCCCGTTGGAGAGCAGG 0: 1
1: 0
2: 0
3: 2
4: 63
1062574477_1062574491 17 Left 1062574477 9:137199993-137200015 CCCGCGAGGCGGTTGGCAGGGCC 0: 1
1: 0
2: 0
3: 9
4: 111
Right 1062574491 9:137200033-137200055 CCGAGTGCCCGTTGGAGAGCAGG 0: 1
1: 0
2: 0
3: 2
4: 63
1062574471_1062574491 30 Left 1062574471 9:137199980-137200002 CCCAGGCGGGGAGCCCGCGAGGC 0: 1
1: 0
2: 0
3: 26
4: 356
Right 1062574491 9:137200033-137200055 CCGAGTGCCCGTTGGAGAGCAGG 0: 1
1: 0
2: 0
3: 2
4: 63
1062574478_1062574491 16 Left 1062574478 9:137199994-137200016 CCGCGAGGCGGTTGGCAGGGCCG 0: 1
1: 0
2: 1
3: 10
4: 78
Right 1062574491 9:137200033-137200055 CCGAGTGCCCGTTGGAGAGCAGG 0: 1
1: 0
2: 0
3: 2
4: 63
1062574486_1062574491 -4 Left 1062574486 9:137200014-137200036 CCGGCCCGGGGCTCAGGGGCCGA 0: 1
1: 0
2: 1
3: 54
4: 349
Right 1062574491 9:137200033-137200055 CCGAGTGCCCGTTGGAGAGCAGG 0: 1
1: 0
2: 0
3: 2
4: 63
1062574488_1062574491 -9 Left 1062574488 9:137200019-137200041 CCGGGGCTCAGGGGCCGAGTGCC 0: 1
1: 0
2: 1
3: 12
4: 239
Right 1062574491 9:137200033-137200055 CCGAGTGCCCGTTGGAGAGCAGG 0: 1
1: 0
2: 0
3: 2
4: 63
1062574472_1062574491 29 Left 1062574472 9:137199981-137200003 CCAGGCGGGGAGCCCGCGAGGCG 0: 1
1: 0
2: 2
3: 32
4: 153
Right 1062574491 9:137200033-137200055 CCGAGTGCCCGTTGGAGAGCAGG 0: 1
1: 0
2: 0
3: 2
4: 63

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1062574491 Original CRISPR CCGAGTGCCCGTTGGAGAGC AGG Exonic