ID: 1062574494

View in Genome Browser
Species Human (GRCh38)
Location 9:137200040-137200062
Sequence GCGCCCGCCTGCTCTCCAAC GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 99
Summary {0: 1, 1: 0, 2: 0, 3: 19, 4: 79}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1062574494_1062574500 1 Left 1062574494 9:137200040-137200062 CCCGTTGGAGAGCAGGCGGGCGC 0: 1
1: 0
2: 0
3: 19
4: 79
Right 1062574500 9:137200064-137200086 CGCGCCGCGGTGCAGACCCCGGG 0: 1
1: 0
2: 1
3: 9
4: 93
1062574494_1062574502 3 Left 1062574494 9:137200040-137200062 CCCGTTGGAGAGCAGGCGGGCGC 0: 1
1: 0
2: 0
3: 19
4: 79
Right 1062574502 9:137200066-137200088 CGCCGCGGTGCAGACCCCGGGGG 0: 1
1: 0
2: 0
3: 7
4: 86
1062574494_1062574501 2 Left 1062574494 9:137200040-137200062 CCCGTTGGAGAGCAGGCGGGCGC 0: 1
1: 0
2: 0
3: 19
4: 79
Right 1062574501 9:137200065-137200087 GCGCCGCGGTGCAGACCCCGGGG 0: 1
1: 0
2: 1
3: 4
4: 99
1062574494_1062574505 10 Left 1062574494 9:137200040-137200062 CCCGTTGGAGAGCAGGCGGGCGC 0: 1
1: 0
2: 0
3: 19
4: 79
Right 1062574505 9:137200073-137200095 GTGCAGACCCCGGGGGTGGACGG 0: 1
1: 0
2: 1
3: 24
4: 244
1062574494_1062574506 16 Left 1062574494 9:137200040-137200062 CCCGTTGGAGAGCAGGCGGGCGC 0: 1
1: 0
2: 0
3: 19
4: 79
Right 1062574506 9:137200079-137200101 ACCCCGGGGGTGGACGGTGAAGG 0: 1
1: 0
2: 0
3: 11
4: 145
1062574494_1062574510 28 Left 1062574494 9:137200040-137200062 CCCGTTGGAGAGCAGGCGGGCGC 0: 1
1: 0
2: 0
3: 19
4: 79
Right 1062574510 9:137200091-137200113 GACGGTGAAGGAGTTGCTGCCGG 0: 1
1: 0
2: 1
3: 15
4: 192
1062574494_1062574499 0 Left 1062574494 9:137200040-137200062 CCCGTTGGAGAGCAGGCGGGCGC 0: 1
1: 0
2: 0
3: 19
4: 79
Right 1062574499 9:137200063-137200085 CCGCGCCGCGGTGCAGACCCCGG 0: 1
1: 0
2: 0
3: 12
4: 108
1062574494_1062574504 6 Left 1062574494 9:137200040-137200062 CCCGTTGGAGAGCAGGCGGGCGC 0: 1
1: 0
2: 0
3: 19
4: 79
Right 1062574504 9:137200069-137200091 CGCGGTGCAGACCCCGGGGGTGG 0: 1
1: 0
2: 0
3: 16
4: 135

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1062574494 Original CRISPR GCGCCCGCCTGCTCTCCAAC GGG (reversed) Exonic