ID: 1062574496

View in Genome Browser
Species Human (GRCh38)
Location 9:137200051-137200073
Sequence GCAGGCGGGCGCCCGCGCCG CGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 339
Summary {0: 1, 1: 0, 2: 2, 3: 17, 4: 319}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1062574488_1062574496 9 Left 1062574488 9:137200019-137200041 CCGGGGCTCAGGGGCCGAGTGCC 0: 1
1: 0
2: 1
3: 12
4: 239
Right 1062574496 9:137200051-137200073 GCAGGCGGGCGCCCGCGCCGCGG 0: 1
1: 0
2: 2
3: 17
4: 319
1062574486_1062574496 14 Left 1062574486 9:137200014-137200036 CCGGCCCGGGGCTCAGGGGCCGA 0: 1
1: 0
2: 1
3: 54
4: 349
Right 1062574496 9:137200051-137200073 GCAGGCGGGCGCCCGCGCCGCGG 0: 1
1: 0
2: 2
3: 17
4: 319
1062574487_1062574496 10 Left 1062574487 9:137200018-137200040 CCCGGGGCTCAGGGGCCGAGTGC 0: 1
1: 0
2: 1
3: 21
4: 264
Right 1062574496 9:137200051-137200073 GCAGGCGGGCGCCCGCGCCGCGG 0: 1
1: 0
2: 2
3: 17
4: 319
1062574490_1062574496 -5 Left 1062574490 9:137200033-137200055 CCGAGTGCCCGTTGGAGAGCAGG 0: 1
1: 0
2: 0
3: 14
4: 154
Right 1062574496 9:137200051-137200073 GCAGGCGGGCGCCCGCGCCGCGG 0: 1
1: 0
2: 2
3: 17
4: 319

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1062574496 Original CRISPR GCAGGCGGGCGCCCGCGCCG CGG Exonic