ID: 1062574497

View in Genome Browser
Species Human (GRCh38)
Location 9:137200062-137200084
Sequence CGGGGTCTGCACCGCGGCGC GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 142
Summary {0: 1, 1: 0, 2: 1, 3: 11, 4: 129}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1062574497_1062574506 -6 Left 1062574497 9:137200062-137200084 CCCGCGCCGCGGTGCAGACCCCG 0: 1
1: 0
2: 1
3: 11
4: 129
Right 1062574506 9:137200079-137200101 ACCCCGGGGGTGGACGGTGAAGG 0: 1
1: 0
2: 0
3: 11
4: 145
1062574497_1062574512 17 Left 1062574497 9:137200062-137200084 CCCGCGCCGCGGTGCAGACCCCG 0: 1
1: 0
2: 1
3: 11
4: 129
Right 1062574512 9:137200102-137200124 AGTTGCTGCCGGTCTTCTGGAGG 0: 1
1: 0
2: 0
3: 7
4: 102
1062574497_1062574511 14 Left 1062574497 9:137200062-137200084 CCCGCGCCGCGGTGCAGACCCCG 0: 1
1: 0
2: 1
3: 11
4: 129
Right 1062574511 9:137200099-137200121 AGGAGTTGCTGCCGGTCTTCTGG 0: 1
1: 0
2: 0
3: 8
4: 99
1062574497_1062574510 6 Left 1062574497 9:137200062-137200084 CCCGCGCCGCGGTGCAGACCCCG 0: 1
1: 0
2: 1
3: 11
4: 129
Right 1062574510 9:137200091-137200113 GACGGTGAAGGAGTTGCTGCCGG 0: 1
1: 0
2: 1
3: 15
4: 192

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1062574497 Original CRISPR CGGGGTCTGCACCGCGGCGC GGG (reversed) Exonic
900562358 1:3313617-3313639 CGGGGTCCGCACGGCCTCGCAGG - Intronic
900633959 1:3652682-3652704 CGGGGGCTGGAGCGCAGCGCTGG + Intronic
900658136 1:3770279-3770301 AGGGGTCTGCACCAGGGCCCTGG - Intronic
902323570 1:15684307-15684329 CGGGCTGTGCGCCGCGGCGGCGG - Intergenic
902358937 1:15931343-15931365 CGGGGTCTGCTCCTGGGGGCAGG - Exonic
903952915 1:27006447-27006469 CGGGGACTTCACCGAGGCCCTGG - Exonic
904199825 1:28812403-28812425 CGGGGGCTGCAGCTCGGCGCCGG - Exonic
905819758 1:40980112-40980134 CGGGGCCTGCGCTGCCGCGCTGG + Intronic
905867029 1:41382123-41382145 CTGGGCCTGCACGGCGGCGGCGG + Exonic
906056914 1:42924751-42924773 CGGGGTCTGAACCTCTGGGCCGG + Intergenic
916666957 1:166975426-166975448 CGGGGGCTGGATCGCGCCGCCGG + Intronic
920313266 1:205060961-205060983 CGGGGTCTGCACCCTGAAGCTGG - Intronic
1064764760 10:18659563-18659585 CGGGTCCCCCACCGCGGCGCGGG - Exonic
1065099549 10:22320702-22320724 CAGGTTCCGCGCCGCGGCGCCGG + Intronic
1065687772 10:28302980-28303002 CGGGCTCGGCACCGCCGCGGCGG + Intronic
1067216942 10:44311053-44311075 CGGGGTCTGCGCGGCTGCGGTGG + Intergenic
1067980032 10:51074295-51074317 CGCGGTGGGCGCCGCGGCGCGGG - Exonic
1071527057 10:86365117-86365139 CGCGGTCAGCATTGCGGCGCCGG - Intronic
1075031060 10:119025182-119025204 CAGGGTTTGCACCCTGGCGCTGG - Intergenic
1075501727 10:122980711-122980733 CGGGGCCTGGGCCGCGGGGCGGG + Intronic
1076750006 10:132537764-132537786 CGGGCTCGGCTCCGCGGGGCGGG + Intergenic
1080503790 11:32893208-32893230 GGGGGGCTGCGCAGCGGCGCTGG - Exonic
1084419605 11:69053721-69053743 CGGGCTCTGAACCCCGACGCTGG + Intronic
1084489683 11:69471637-69471659 CGGTGGCTGCCCGGCGGCGCGGG - Intergenic
1090273885 11:125406189-125406211 CGGGGTTTCCACCGCTGCTCTGG + Intronic
1092445717 12:8555014-8555036 CGGAGTCTGCAGGGCGGTGCAGG + Intergenic
1097225568 12:57475284-57475306 CGGGGTCTGCTCCGAGGTGAGGG - Exonic
1097675995 12:62603128-62603150 CGGGTTCGACAGCGCGGCGCGGG + Exonic
1100632313 12:96400635-96400657 CGGGGCCTGCAGGGCGGGGCGGG + Intergenic
1101606007 12:106248042-106248064 CGGGGTCGGCGCCGCGGCGGCGG - Intronic
1102520681 12:113476062-113476084 CCGGGTCTGCGCGGCGGCGGCGG + Intergenic
1105278451 13:18949529-18949551 CGGGGTCTGCACCCAGCCACGGG + Intergenic
1105557245 13:21459017-21459039 CGGGGACTGCGGCGGGGCGCGGG - Intronic
1106246534 13:27954528-27954550 CTGGGTCTGCGCCGCTGCCCGGG - Intergenic
1106956334 13:34942688-34942710 CGGGCCCGGCGCCGCGGCGCTGG + Exonic
1111396301 13:87672624-87672646 CGCGGTCGCCACCGCGGCGGCGG + Exonic
1112402189 13:99086689-99086711 CGGGGTGTCCGGCGCGGCGCGGG + Intergenic
1117920790 14:60723760-60723782 CGGGGTCTGCGCGGCGGCGGCGG + Exonic
1118610163 14:67533432-67533454 CTGGGGCTGCGCCGCGGCGGAGG + Intronic
1120334852 14:83141956-83141978 GGGGGTCTGCACAGCTGCTCAGG - Intergenic
1123017207 14:105381104-105381126 TGGGGGCTGCACGGCGGGGCGGG + Intronic
1124922437 15:34039296-34039318 GGGGGTCTGCAGCGGGGCGGGGG + Intronic
1126668263 15:51094142-51094164 CCGGGACTGCGCTGCGGCGCAGG - Intronic
1128345964 15:66852596-66852618 CGGGATTTGGACCGCGGAGCCGG - Intergenic
1128987129 15:72230209-72230231 AGGGGACGGCACCGCGCCGCAGG + Intronic
1132105464 15:99059485-99059507 GAGGGTCTGCACCGGGGCGAGGG - Intergenic
1133285530 16:4688880-4688902 TGGGGTCAGCTCGGCGGCGCTGG - Exonic
1138247655 16:55479384-55479406 TGGAGCCTGCTCCGCGGCGCAGG - Exonic
1140377001 16:74452598-74452620 CGTGGTCTTCACCGAGGCGTGGG - Intronic
1142371782 16:89686648-89686670 CGCGGACGGCCCCGCGGCGCAGG - Exonic
1142631418 17:1228932-1228954 GGGGGTCTCCTCCGCGGCGAGGG + Intronic
1144339219 17:14298602-14298624 CGCGGTGCGCACCGCGCCGCGGG - Intergenic
1147587015 17:41658609-41658631 TGGGGTCTGCACGGTGGAGCAGG - Intergenic
1148178404 17:45586316-45586338 CGCGGGCTGCAGCGCGGTGCGGG - Intergenic
1148559518 17:48597857-48597879 CGGGGGCTGCTCGTCGGCGCCGG + Exonic
1152430512 17:80246175-80246197 GGGGGTGTGCACCCCGGCGGGGG + Exonic
1152683745 17:81683657-81683679 CGGGGACGGGACCGGGGCGCGGG - Intronic
1152963655 18:96461-96483 CGAGGTCTACACCGCGGCCTTGG - Intergenic
1155053959 18:22169567-22169589 CGGGGTCTGCGCCGCGCTGCTGG - Exonic
1160566143 18:79787935-79787957 CGGGGTCCGCGCCGCGGGGCGGG + Intergenic
1160770733 19:829568-829590 CGGGGTTAGCACCGTGGTGCTGG + Exonic
1160773407 19:843804-843826 CTGGGGCTGCACCGCGGCCTCGG + Intronic
1161443460 19:4305100-4305122 TGGGGTCCGCACTGCGGAGCTGG - Intronic
1161809634 19:6464548-6464570 CGGGGTGGGGACCCCGGCGCAGG - Intronic
1163797333 19:19345208-19345230 CGGGGCCTGCACGGCTGCCCTGG - Intronic
1165255975 19:34577501-34577523 CCGGGGCTGCAGCGCGGCCCGGG + Intergenic
1166959128 19:46487517-46487539 CGGGGTGGGCACCGCTGCCCTGG - Intronic
1167586118 19:50376886-50376908 CGGGACCTGCAGCGCGGTGCGGG + Intronic
925730732 2:6917964-6917986 GCGGGTCTGCGCTGCGGCGCGGG + Intronic
931587282 2:63841729-63841751 TGGGGCCTGGACGGCGGCGCGGG + Exonic
935926722 2:108077757-108077779 TGGGGTCTGCACCACTGCACAGG + Intergenic
944547500 2:200812203-200812225 CCGGGTGTGCGCCGCGGCGCTGG + Intronic
946404172 2:219483878-219483900 CGGGGCCGGCACCGCCGAGCGGG + Exonic
1169143493 20:3238663-3238685 CGGGGCTCCCACCGCGGCGCCGG + Intronic
1175482326 20:59320555-59320577 CGGGTTCTGCTCCTCGGCTCTGG - Intronic
1175722224 20:61294247-61294269 TGGGGTCTGCACCGGGGCCAGGG + Intronic
1175888054 20:62303264-62303286 GCGGGTCTGCCCCGCGGAGCGGG + Intronic
1176042375 20:63072334-63072356 CGGGGGCAGCAGCGGGGCGCGGG + Intergenic
1176221225 20:63970073-63970095 CGGGGGCGGAACCGCGGAGCGGG - Intronic
1176386110 21:6139238-6139260 CGAGGCCTGCACCACGTCGCCGG + Intergenic
1179737363 21:43399014-43399036 CGAGGCCTGCACCACGTCGCCGG - Intergenic
1179882666 21:44300043-44300065 CGGGGACGGCGACGCGGCGCAGG + Exonic
1181085565 22:20437928-20437950 TGGGGTCTGGAGCGCGGGGCGGG - Intronic
1181330659 22:22088096-22088118 CGGGGTCTGCACAGGGGCAGTGG + Intergenic
950462951 3:13136003-13136025 CTGGGTCTGCACCGCCCAGCAGG - Intergenic
952451775 3:33440106-33440128 CGGGGGCTGGGCGGCGGCGCCGG - Exonic
954389252 3:50260302-50260324 CGGGGTCGGCGCCGCGGAGGCGG + Intergenic
956809239 3:72848329-72848351 CGGGGTCAGCATCGCCGCACCGG + Exonic
966592113 3:181695351-181695373 CGTGGGCTGCTCCGAGGCGCAGG - Intergenic
968653133 4:1767764-1767786 CGGGGTCGGGAGCGGGGCGCGGG - Intergenic
968923135 4:3532850-3532872 CGGGGTTGGCACTGCGGCCCGGG + Intergenic
969378917 4:6782193-6782215 CGGGGGCTGCACCGGGCCGCGGG + Intronic
969536063 4:7756731-7756753 CGGGGACTGCGCCGAGGAGCCGG + Intergenic
973684380 4:53354417-53354439 CCAGGCCTGCACTGCGGCGCTGG - Intronic
976199088 4:82561785-82561807 CGGGGGCTGCAGCGCGGCTGGGG - Intronic
984964278 4:185127491-185127513 CGCGGTCCTCACCGCGGTGCCGG - Intergenic
985777383 5:1851843-1851865 CGGGGTCTGCACGGTGGCGCGGG + Intergenic
992042367 5:72848539-72848561 CGGGGGCTGGGCCGCAGCGCGGG - Intronic
994072900 5:95621135-95621157 CAGGCTCTGCACCTTGGCGCGGG - Exonic
994353904 5:98774139-98774161 CGGGCTCTGCCCCCCGCCGCTGG + Exonic
995140294 5:108728134-108728156 CGGCGTCTGCAGCGAGGAGCGGG - Intergenic
998166698 5:139848403-139848425 CGGGGCCCGGACCGCGGCGCGGG - Exonic
998517568 5:142770150-142770172 CGGGGTCTGCAACGCTGGGAGGG + Intergenic
1001577096 5:172771465-172771487 CTGGGCCTGGAGCGCGGCGCGGG - Intergenic
1002330169 5:178435471-178435493 CGTGGTCTGCACCCCAGGGCTGG - Intronic
1002505804 5:179678433-179678455 CGGGGACTGCCCCTCGGTGCTGG - Intergenic
1003640110 6:7869149-7869171 GGGAGGCTGCACCGCGGGGCTGG - Intronic
1005987602 6:30884326-30884348 CGGGGCCTGGAGCTCGGCGCCGG + Intronic
1006117136 6:31781406-31781428 CGGGGTCTGCGCTGCAGCACAGG + Intronic
1007444532 6:41895056-41895078 AGGGGGCGGGACCGCGGCGCCGG - Intronic
1010249857 6:73696254-73696276 CTGCGTGTGCACCGCCGCGCTGG + Exonic
1010703244 6:79077577-79077599 CGGGGTCCCCGCCGGGGCGCGGG - Intronic
1015773592 6:136792483-136792505 CTTGAGCTGCACCGCGGCGCAGG - Exonic
1017324578 6:153130961-153130983 CGGGGGCGGCTGCGCGGCGCTGG - Intronic
1019437128 7:1028103-1028125 CGGGGTCTGCAGGGCGGAGCGGG + Intronic
1019437229 7:1028439-1028461 CGGGGACTGGACCTCGGCGCGGG + Intronic
1019562653 7:1666149-1666171 CGGGGCCCGCACCCCGGCCCAGG + Intergenic
1021600048 7:22356336-22356358 CTGGGTCTGCCCCTCGGCGGTGG + Intronic
1034243179 7:149624876-149624898 CGGGGTCAGCTCCCGGGCGCGGG - Intergenic
1034262458 7:149765360-149765382 CAGTGTCTGCACCGCAGCGAGGG - Exonic
1038266574 8:26043251-26043273 CGGGAGCTGCCCTGCGGCGCTGG + Intronic
1039484266 8:37899086-37899108 CGGGATCTGCACCGCGACCAGGG - Exonic
1042784983 8:72537019-72537041 GGGGCTCTGCCTCGCGGCGCCGG - Intergenic
1049637060 8:143694754-143694776 CGGGGGCTGCGCCCCGGCGCCGG + Exonic
1051289114 9:15527709-15527731 CGGCGGCTGCTGCGCGGCGCTGG + Intergenic
1052494652 9:29212192-29212214 CGAGCTCCGCACCGCGCCGCGGG - Intergenic
1052824988 9:33167687-33167709 CTGGGCCTGCAGCGCGGCGGCGG + Intergenic
1054798647 9:69325446-69325468 CGGGGGCTGCAGCGCGCCCCGGG - Intronic
1057432232 9:95004943-95004965 CGGGGCCTGGGCGGCGGCGCGGG - Intronic
1059115993 9:111600162-111600184 GGGTGTCTGCACCGCAGCCCTGG - Intergenic
1060979925 9:127786003-127786025 CGGGGTCGGCGCCGCGAGGCCGG + Intronic
1062162601 9:135088295-135088317 CAGGGTCGCCACCGCTGCGCCGG - Intronic
1062291727 9:135798349-135798371 CGGAGACTGCAGCGCGGAGCTGG - Intergenic
1062341411 9:136095305-136095327 CGGCGGCCGCACCGCGGCGGGGG + Intergenic
1062349987 9:136133794-136133816 CCGGGTGTGCACCGGGGCTCAGG + Intergenic
1062498423 9:136842379-136842401 TGGGGGCTGCACCGTGGAGCTGG - Intronic
1062574497 9:137200062-137200084 CGGGGTCTGCACCGCGGCGCGGG - Exonic
1062734445 9:138127265-138127287 CGAGGTCTACACCGCGGCCTTGG + Intergenic
1185790951 X:2928311-2928333 CGGGGTAGGCACGGCGGTGCTGG + Intronic
1186512804 X:10143163-10143185 CGGGGCCTGCCCAGCAGCGCTGG - Exonic
1196888579 X:120270800-120270822 CGGGGTCTGCAGGGAGGCCCGGG - Intronic
1201291167 Y:12421524-12421546 CGGGGGCTGCAGCGGGGTGCAGG - Intergenic