ID: 1062574500

View in Genome Browser
Species Human (GRCh38)
Location 9:137200064-137200086
Sequence CGCGCCGCGGTGCAGACCCC GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 104
Summary {0: 1, 1: 0, 2: 1, 3: 9, 4: 93}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1062574490_1062574500 8 Left 1062574490 9:137200033-137200055 CCGAGTGCCCGTTGGAGAGCAGG 0: 1
1: 0
2: 0
3: 14
4: 154
Right 1062574500 9:137200064-137200086 CGCGCCGCGGTGCAGACCCCGGG 0: 1
1: 0
2: 1
3: 9
4: 93
1062574495_1062574500 0 Left 1062574495 9:137200041-137200063 CCGTTGGAGAGCAGGCGGGCGCC 0: 1
1: 0
2: 0
3: 3
4: 79
Right 1062574500 9:137200064-137200086 CGCGCCGCGGTGCAGACCCCGGG 0: 1
1: 0
2: 1
3: 9
4: 93
1062574494_1062574500 1 Left 1062574494 9:137200040-137200062 CCCGTTGGAGAGCAGGCGGGCGC 0: 1
1: 0
2: 0
3: 19
4: 79
Right 1062574500 9:137200064-137200086 CGCGCCGCGGTGCAGACCCCGGG 0: 1
1: 0
2: 1
3: 9
4: 93
1062574488_1062574500 22 Left 1062574488 9:137200019-137200041 CCGGGGCTCAGGGGCCGAGTGCC 0: 1
1: 0
2: 1
3: 12
4: 239
Right 1062574500 9:137200064-137200086 CGCGCCGCGGTGCAGACCCCGGG 0: 1
1: 0
2: 1
3: 9
4: 93
1062574487_1062574500 23 Left 1062574487 9:137200018-137200040 CCCGGGGCTCAGGGGCCGAGTGC 0: 1
1: 0
2: 1
3: 21
4: 264
Right 1062574500 9:137200064-137200086 CGCGCCGCGGTGCAGACCCCGGG 0: 1
1: 0
2: 1
3: 9
4: 93
1062574486_1062574500 27 Left 1062574486 9:137200014-137200036 CCGGCCCGGGGCTCAGGGGCCGA 0: 1
1: 0
2: 1
3: 54
4: 349
Right 1062574500 9:137200064-137200086 CGCGCCGCGGTGCAGACCCCGGG 0: 1
1: 0
2: 1
3: 9
4: 93

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1062574500 Original CRISPR CGCGCCGCGGTGCAGACCCC GGG Exonic