ID: 1062575436

View in Genome Browser
Species Human (GRCh38)
Location 9:137205099-137205121
Sequence GATGCTGTTGTGCCAGAAGC TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 179
Summary {0: 1, 1: 0, 2: 2, 3: 13, 4: 163}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1062575436_1062575437 1 Left 1062575436 9:137205099-137205121 CCAGCTTCTGGCACAACAGCATC 0: 1
1: 0
2: 2
3: 13
4: 163
Right 1062575437 9:137205123-137205145 CGAAGACGAACTTGAGACTCAGG 0: 1
1: 0
2: 0
3: 8
4: 52
1062575436_1062575438 22 Left 1062575436 9:137205099-137205121 CCAGCTTCTGGCACAACAGCATC 0: 1
1: 0
2: 2
3: 13
4: 163
Right 1062575438 9:137205144-137205166 GGACCGTAAGTACCCAGAAAAGG 0: 1
1: 0
2: 1
3: 5
4: 66
1062575436_1062575440 25 Left 1062575436 9:137205099-137205121 CCAGCTTCTGGCACAACAGCATC 0: 1
1: 0
2: 2
3: 13
4: 163
Right 1062575440 9:137205147-137205169 CCGTAAGTACCCAGAAAAGGCGG 0: 1
1: 0
2: 1
3: 7
4: 78

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1062575436 Original CRISPR GATGCTGTTGTGCCAGAAGC TGG (reversed) Exonic
900352322 1:2241084-2241106 GATGCTGTGGGCCCAGAAGGTGG + Intronic
902131416 1:14264477-14264499 AATGCTGTTATTCCAGAAGTGGG + Intergenic
902585572 1:17437413-17437435 GATGCTGTGGCGGCAGATGCCGG + Intronic
905042510 1:34972285-34972307 GAGGCTGCTGTCCCTGAAGCTGG + Intergenic
905054993 1:35085633-35085655 GAGGCTATTGTCCCTGAAGCTGG - Intronic
905938226 1:41841585-41841607 TGTGCTGTTCTTCCAGAAGCTGG + Intronic
910818125 1:91314037-91314059 GATTCTGTTTTGCTAAAAGCTGG - Exonic
911181338 1:94863190-94863212 GATGCAGAGGTTCCAGAAGCTGG - Intronic
913075203 1:115336244-115336266 AATGCAGTGGTGCCAGCAGCTGG + Intronic
916383971 1:164246247-164246269 GATGCAGGTGTCTCAGAAGCAGG + Intergenic
919151160 1:193700711-193700733 GATGATGTAGTGACAAAAGCAGG - Intergenic
919771656 1:201164628-201164650 GATCCCATTGTGCCTGAAGCTGG - Intronic
920376957 1:205513924-205513946 GCTGCTGTTGGGCCACATGCTGG + Intronic
923287445 1:232509932-232509954 GGTGCTGTTGTGCCTGCAGATGG - Intronic
923822119 1:237456669-237456691 GATGTTGCTGGGCGAGAAGCAGG + Exonic
1071008746 10:80913127-80913149 GATGCTAGTCTTCCAGAAGCAGG - Intergenic
1071261391 10:83922623-83922645 GATGCTGCTGTGAAGGAAGCTGG + Intergenic
1073074422 10:100814883-100814905 GAGGCTGGTCTCCCAGAAGCTGG + Intronic
1075086056 10:119415217-119415239 GATGTGGTTATGTCAGAAGCAGG + Intronic
1077176733 11:1194515-1194537 GATGCCGTTTTTCCGGAAGCCGG - Intronic
1077563056 11:3277401-3277423 GAGGCTGTAGTGACAGAGGCTGG + Intergenic
1077568947 11:3323217-3323239 GAGGCTGTAGTGACAGAGGCTGG + Intergenic
1078388586 11:10915117-10915139 GTTGATGTGGTGACAGAAGCAGG - Intergenic
1081490145 11:43561348-43561370 GATGTTGCTGTGGAAGAAGCAGG + Intronic
1083712453 11:64557568-64557590 GGTGCTGAGGGGCCAGAAGCAGG + Intronic
1083809521 11:65095986-65096008 GTTGCTGCTGTCCCAGAAGGGGG - Intronic
1084889736 11:72230780-72230802 GCTGCTGTTCCCCCAGAAGCGGG + Exonic
1087984328 11:104658702-104658724 CATGCTGTTGTGCCAGTGCCCGG - Intergenic
1088755900 11:112884912-112884934 GATGCTTTTGATCCAGAAGGAGG - Intergenic
1089114361 11:116082344-116082366 GATGCGGTGGGGCCAGAATCTGG - Intergenic
1089696655 11:120220040-120220062 GCTGCTCTTGAGCCAGAGGCAGG + Intronic
1091278685 11:134369810-134369832 GATGCTGTGCTGACAGAAGCCGG + Exonic
1091626591 12:2125555-2125577 GATGCTGATGCACCTGAAGCAGG + Intronic
1092049173 12:5455785-5455807 GATGCTGCCTTGCAAGAAGCTGG + Intronic
1092151230 12:6250399-6250421 GTTCCAGTTGTGCCAGGAGCAGG + Intergenic
1095562027 12:43576504-43576526 GATGTTGTGGTGTCAGCAGCAGG + Intergenic
1095616077 12:44190701-44190723 GATATGGTTGTGCCAGAAACTGG - Intronic
1103307370 12:119976002-119976024 GATGGTGTCTTGCCAGAAACAGG - Intergenic
1103405798 12:120674432-120674454 GATCCTGCTGTGCCTGTAGCAGG + Intergenic
1105603544 13:21908622-21908644 TAGGCTGTTCTGCCAGAATCTGG - Intergenic
1105794548 13:23838017-23838039 AATGATGCTGTGCCAGAAGCTGG + Intronic
1109073783 13:57806478-57806500 CCTGCTGTTGTGCCAGGAACAGG - Intergenic
1110416182 13:75255360-75255382 GATGGTGATATGTCAGAAGCAGG + Intergenic
1111866269 13:93772671-93772693 GATGCTGTCCTGATAGAAGCTGG + Intronic
1117835793 14:59804706-59804728 CATGCAGTTTTGCCAGAGGCTGG - Intronic
1118346318 14:64943708-64943730 GCTGCTGTGGTTCCAGACGCAGG + Intronic
1118473761 14:66098755-66098777 CAGGATGTTGTGCCAGCAGCGGG - Intergenic
1118610849 14:67538605-67538627 GAGGCTCTTCTGACAGAAGCAGG - Intronic
1118643640 14:67816941-67816963 GATGGTGTTTTGCCAGGCGCGGG + Intergenic
1122251395 14:100442329-100442351 GATGGTGGTGTACCAGAGGCAGG + Intronic
1122574476 14:102733001-102733023 TTTCCTGTTGTCCCAGAAGCAGG + Intergenic
1124055522 15:26237974-26237996 AAGGCTGTGGTGGCAGAAGCAGG + Intergenic
1127020207 15:54738240-54738262 GGTGATGTAGTACCAGAAGCAGG - Intergenic
1128064924 15:64758641-64758663 GAGGCAGTTGTGCCAAAAGTTGG - Intronic
1129898479 15:79126894-79126916 AATGCTGTTGTTTTAGAAGCAGG - Intergenic
1130572916 15:85064792-85064814 GTTGCTGTTGTTGCAGAAACTGG - Intronic
1133788207 16:8989316-8989338 GTTGGTGTTTTCCCAGAAGCAGG + Intergenic
1137596065 16:49724738-49724760 AATGCTGCTGTGCAACAAGCCGG - Intronic
1138944683 16:61834376-61834398 TATGCTGGTTTGCCAGAAGAAGG + Intronic
1139877701 16:70159622-70159644 AAAGCAGTTATGCCAGAAGCAGG - Exonic
1140467961 16:75197160-75197182 CAGGCTGCTGTGCCAGATGCAGG - Intergenic
1144422091 17:15107999-15108021 GATGCTGTTGGGTCAGAAGCAGG + Intergenic
1147119600 17:38328209-38328231 GATGCTGATGGACCAAAAGCTGG - Exonic
1148083125 17:44978362-44978384 GCTGCTGCTCTGCCAGAGGCTGG - Intergenic
1149519969 17:57311317-57311339 GGTGCTTCTTTGCCAGAAGCAGG + Intronic
1150204233 17:63389517-63389539 GGTGCTGCTGTGCAAGAAACGGG + Exonic
1150584846 17:66508146-66508168 TATTATGTTGTACCAGAAGCTGG + Intronic
1152377338 17:79925574-79925596 CAGGCTGTTGGGCCAGAGGCAGG + Intergenic
1153446232 18:5175935-5175957 GGTGCTGTTGTTCAAAAAGCAGG - Intronic
1156702930 18:39846044-39846066 GCTGCTCTGGTGCCAGAAGCTGG + Intergenic
1159600813 18:70427084-70427106 TATGCTGTTGTCCCAGACGCAGG + Intergenic
1160584314 18:79904180-79904202 GATGCTGTGGAGACACAAGCAGG + Exonic
1162412221 19:10513375-10513397 GATGCTGGTGTGCCTGGAGCAGG - Exonic
1162654433 19:12117761-12117783 GGTGGGGTTGTGCCAGCAGCCGG + Intronic
1162793273 19:13073902-13073924 GATGCTGTTGCAACAGGAGCTGG - Exonic
1163683504 19:18697074-18697096 GTGGCTGTGGTGCCAGCAGCTGG + Intronic
1165077277 19:33286867-33286889 GATGCTGAGGCCCCAGAAGCTGG + Intergenic
1165530822 19:36399334-36399356 GAAGCTGCTGAGCAAGAAGCAGG + Intronic
1166883118 19:45940831-45940853 GGTGCAGCTGTCCCAGAAGCCGG - Exonic
1167788105 19:51652319-51652341 GAACCTGCTGTGCCTGAAGCCGG + Intergenic
925190382 2:1877512-1877534 GATGCATTTGTGCCAGAAGCAGG + Intronic
926385882 2:12335415-12335437 GATGCAGATGTGCCAGATGTGGG + Intergenic
934090915 2:88549833-88549855 GATCCTCTTGTGACAGATGCAGG - Intergenic
934167007 2:89302913-89302935 AATGCTGTTGTGGCAGAATGGGG + Intergenic
934200270 2:89879541-89879563 AATGCTGTTGTGGCAGAATGGGG - Intergenic
934962156 2:98685843-98685865 GATGCTGATGTGCCAGTCCCAGG + Intronic
935234125 2:101123866-101123888 TATGCTGATGTGCCAGGAGGGGG - Intronic
935247459 2:101231607-101231629 GAATCTGTTGTGCCACAAACTGG + Intronic
935502428 2:103857641-103857663 GATTCTCCTGTGCTAGAAGCTGG - Intergenic
937244471 2:120483685-120483707 GAAGCTGGTGCTCCAGAAGCTGG + Intergenic
940868959 2:158843878-158843900 GATGCATTAGAGCCAGAAGCAGG - Intronic
941234751 2:162957135-162957157 GATACTGTTGTAGCAGAAGCTGG - Intergenic
941872299 2:170398696-170398718 GATGCTTTTGTGCCAGGAACTGG + Intronic
944402915 2:199348880-199348902 GATGCTGGTGAGCCAGGAGCCGG + Exonic
1169189551 20:3649413-3649435 GATGTTTTTGTGCCATATGCTGG + Exonic
1169207109 20:3746787-3746809 GATACGGATGTGCAAGAAGCCGG - Intronic
1170933127 20:20787075-20787097 GCTGCTGTGGTGGCAGAAGTGGG - Intergenic
1171026267 20:21633116-21633138 GAGGCTGCTGAGACAGAAGCAGG + Intergenic
1171253994 20:23672482-23672504 GATGCTTTACTGCCCGAAGCTGG + Intergenic
1171355594 20:24543351-24543373 GATGATGTTGGGCCGGTAGCGGG - Exonic
1172390264 20:34560811-34560833 GGGGCTGTGGGGCCAGAAGCTGG - Exonic
1172890304 20:38259781-38259803 GATGCGTTTGTGCCAGTATCTGG - Intronic
1175913197 20:62414261-62414283 GCTGCTGCTGGGCCAGGAGCAGG + Exonic
1175962722 20:62645303-62645325 GAGTCTGTTGTCCCAGCAGCAGG - Intronic
1176553349 21:8240477-8240499 GATGGTGTTGAGGCAGAAGTAGG + Intergenic
1176572271 21:8423501-8423523 GATGGTGTTGAGGCAGAAGTAGG + Intergenic
1176580180 21:8468061-8468083 GATGGTGTTGAGGCAGAAGTAGG + Intergenic
1178278634 21:31261781-31261803 GATGCTGCTGTGTCTGAAACTGG + Intronic
1180049968 21:45326604-45326626 GATGCTGTGGGGGCAGGAGCAGG - Intergenic
1180076042 21:45463372-45463394 GCTGCTATTGTGCCAAGAGCTGG + Intronic
1181891998 22:26071346-26071368 GATACTGTTATCCCAGAAACAGG + Intergenic
1184296013 22:43526102-43526124 GAACTTGTTTTGCCAGAAGCTGG + Intergenic
1203258347 22_KI270733v1_random:157505-157527 GATGGTGTTGAGGCAGAAGTAGG + Intergenic
949534575 3:4986155-4986177 CAGGCTGTTGTGCAAGGAGCCGG + Intergenic
951283357 3:20779681-20779703 GATGCCTTTGGGCCAGCAGCAGG + Intergenic
952210762 3:31227008-31227030 CATGATGTTGTGGCAGAAGATGG + Intergenic
956356688 3:68401456-68401478 GATGCCACTGTGCCTGAAGCAGG - Intronic
961432720 3:126894460-126894482 GATGCTATTGTGCAAGGAACAGG + Intronic
961506333 3:127372593-127372615 GAGGCTGTTAGGCCAGAGGCTGG + Intergenic
963225586 3:142858466-142858488 TATGTTGCTGTGCCAGCAGCTGG - Intronic
963741708 3:149087401-149087423 GAGGCTGCTGTCCCCGAAGCTGG + Intergenic
968725765 4:2247188-2247210 GATGCTGTGGCGCCTGGAGCTGG - Intergenic
971942461 4:33233431-33233453 GATGTTGTAAAGCCAGAAGCAGG + Intergenic
972091875 4:35296837-35296859 GATGCTGGTGTGGCAGAATAAGG + Intergenic
975986195 4:80203001-80203023 GCTGGTGCTGGGCCAGAAGCTGG + Exonic
979684568 4:123497024-123497046 GAGGATGTTGTGCTAGAAGAGGG + Intergenic
981297375 4:143147341-143147363 GCTGCTTTGGTGCCAGCAGCAGG - Intergenic
985706702 5:1405731-1405753 GATGCTGCTGAGCCAGAGGGAGG + Intronic
988684328 5:33513139-33513161 GAGGCTGATGGGCCAGAAGTGGG + Intergenic
992162354 5:74015638-74015660 GATGTTATATTGCCAGAAGCAGG + Intergenic
992502768 5:77358111-77358133 GATCATGGTTTGCCAGAAGCTGG - Intronic
993592776 5:89815310-89815332 GATTCTGTTGTCCCCGAAGGTGG + Intergenic
998463065 5:142323705-142323727 GCTGCTCTTGTGCAAGAAGACGG - Intronic
1000378511 5:160606941-160606963 GAAGCTGTGGTTCCAGAAGCTGG - Exonic
1002393273 5:178933255-178933277 GATGCTCTTGTTCCACAATCTGG + Intergenic
1003546359 6:7062729-7062751 GATGCTCTTGAGCCAGAGGAGGG + Intergenic
1003556685 6:7146185-7146207 GAGCCTGTTGTGTGAGAAGCAGG + Intronic
1005928044 6:30461015-30461037 GATCCTGTTCTGCCAAAATCAGG - Intergenic
1006190472 6:32204480-32204502 GATGCTGTTGAGCTGGAAGGTGG - Intronic
1009034927 6:58105596-58105618 CATGCTGTTGTTTCAGAAGAGGG + Intergenic
1009210443 6:60856313-60856335 CATGCTGTTGTTTCAGAAGAGGG + Intergenic
1012859408 6:104541477-104541499 AATGCTGTTATTCCAGAAGTGGG - Intergenic
1019062109 6:169263892-169263914 CATGCTGGTGGGCAAGAAGCCGG - Intergenic
1019169447 6:170123970-170123992 GCTGCTGTGGTGCCAGCAGCAGG - Intergenic
1019821734 7:3248858-3248880 GATGAGGCTGGGCCAGAAGCAGG + Intergenic
1023075999 7:36483247-36483269 GGGACTGTTGGGCCAGAAGCTGG + Intergenic
1023191274 7:37585606-37585628 GCTGGTGTTGTGACAGGAGCAGG + Intergenic
1029227183 7:99036726-99036748 GATGCTCTTGTGGGAGAACCTGG + Intronic
1029566080 7:101339012-101339034 GAAACTGTTTTGCCCGAAGCAGG - Intergenic
1030538653 7:110801773-110801795 AATTCTGTTGTGCCAGCAGTGGG - Intronic
1036750875 8:11443189-11443211 GAGGCTGTCGTGCCAGACACGGG + Intronic
1037355359 8:18013526-18013548 GATGATGTTGGGGCAGGAGCTGG - Intronic
1038602091 8:28954943-28954965 GATACTGTATTGCCAGAAGGTGG - Intronic
1045830696 8:106457198-106457220 AATGCTGTTGTCCCAGAAGTGGG + Intronic
1045856361 8:106769769-106769791 GATGCTGGTGTGCTTGAACCTGG - Exonic
1048292616 8:133192106-133192128 TAGGCTGTTCTGCCAGGAGCAGG - Intronic
1052954294 9:34241390-34241412 GATGCTGTTGTGCTGCAAGCTGG - Exonic
1056014024 9:82363312-82363334 GATGCAGGGGTGCCAGAAGAGGG + Intergenic
1056809105 9:89750490-89750512 GATGCCGCAGTCCCAGAAGCTGG + Intergenic
1057186480 9:93060008-93060030 CAGGCTGTTGTGCCAGTAGAAGG - Intronic
1060546751 9:124466355-124466377 GGTGCTGTGGTTGCAGAAGCAGG - Exonic
1060597430 9:124856736-124856758 GATGGTCTTGTCCCAGGAGCCGG - Exonic
1061410346 9:130417655-130417677 AATGCTGGTGGGGCAGAAGCTGG + Intronic
1061473568 9:130846761-130846783 GCTGGTGCTGTGCCAGACGCTGG - Intronic
1062575436 9:137205099-137205121 GATGCTGTTGTGCCAGAAGCTGG - Exonic
1203474541 Un_GL000220v1:139521-139543 GATGGTGTTGAGGCAGAAGTAGG + Intergenic
1190069380 X:47266827-47266849 TGTGCTGTTGTCCCAGGAGCCGG + Intergenic
1190077448 X:47328242-47328264 TGTGCTGTTGTCCCAGGAGCCGG - Intergenic
1190299624 X:49049392-49049414 GCTGCTGCTGTGACAGAAGCTGG + Intergenic
1190556870 X:51644709-51644731 GATTCTGTTCTACCAGGAGCTGG - Intergenic
1191920076 X:66246370-66246392 GAGACCATTGTGCCAGAAGCTGG + Intronic
1192394244 X:70762493-70762515 GCTGCTGATCTGCCAGAAGGTGG - Intronic
1195461205 X:105126898-105126920 GATGCTCTTCTGGCAGAAACTGG - Intronic
1195739581 X:108050068-108050090 GCTGCTTTCCTGCCAGAAGCTGG - Intronic
1196286819 X:113892455-113892477 GATTTTGATGGGCCAGAAGCAGG - Intergenic
1196950907 X:120875145-120875167 GCTGCTGCTGTCCCAGAGGCTGG - Exonic
1198339509 X:135700235-135700257 CACGCTGTTGTTCCAGATGCTGG - Intergenic
1199045583 X:143167446-143167468 GCAGGTGTTGGGCCAGAAGCAGG + Intergenic
1200931654 Y:8702317-8702339 GAAGTAGTTGAGCCAGAAGCAGG + Intergenic