ID: 1062576747

View in Genome Browser
Species Human (GRCh38)
Location 9:137212396-137212418
Sequence AACAGGCAGGTGGGTAGGAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 309
Summary {0: 1, 1: 0, 2: 1, 3: 25, 4: 282}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1062576747_1062576770 30 Left 1062576747 9:137212396-137212418 CCCATCCTACCCACCTGCCTGTT 0: 1
1: 0
2: 1
3: 25
4: 282
Right 1062576770 9:137212449-137212471 TGGGGCTAGCCTAGAGGTCGAGG 0: 1
1: 0
2: 1
3: 2
4: 78
1062576747_1062576769 24 Left 1062576747 9:137212396-137212418 CCCATCCTACCCACCTGCCTGTT 0: 1
1: 0
2: 1
3: 25
4: 282
Right 1062576769 9:137212443-137212465 CTGCTGTGGGGCTAGCCTAGAGG 0: 1
1: 0
2: 1
3: 9
4: 139
1062576747_1062576760 11 Left 1062576747 9:137212396-137212418 CCCATCCTACCCACCTGCCTGTT 0: 1
1: 0
2: 1
3: 25
4: 282
Right 1062576760 9:137212430-137212452 CTCCCCTCACCCCCTGCTGTGGG 0: 1
1: 0
2: 4
3: 45
4: 483
1062576747_1062576761 12 Left 1062576747 9:137212396-137212418 CCCATCCTACCCACCTGCCTGTT 0: 1
1: 0
2: 1
3: 25
4: 282
Right 1062576761 9:137212431-137212453 TCCCCTCACCCCCTGCTGTGGGG 0: 1
1: 3
2: 36
3: 582
4: 1337
1062576747_1062576759 10 Left 1062576747 9:137212396-137212418 CCCATCCTACCCACCTGCCTGTT 0: 1
1: 0
2: 1
3: 25
4: 282
Right 1062576759 9:137212429-137212451 CCTCCCCTCACCCCCTGCTGTGG 0: 1
1: 0
2: 8
3: 103
4: 747

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1062576747 Original CRISPR AACAGGCAGGTGGGTAGGAT GGG (reversed) Intronic
900229937 1:1551635-1551657 GAAAGGCTGGTGGGCAGGATGGG - Intronic
900247884 1:1647421-1647443 AATAGGCATGTGGGAAGGAACGG - Intronic
900259110 1:1714576-1714598 AATAGGCATGTGGGAAGGAACGG - Intronic
900430738 1:2602011-2602033 GGCAGGCAAGTGGGTAGGAGTGG - Intronic
900602518 1:3509272-3509294 AGCAGGCAGGTGGGTGGCAGGGG - Intronic
900766930 1:4512055-4512077 AACAGGGATGTGGGGAGGAATGG + Intergenic
900830776 1:4963716-4963738 AACAGTCCCCTGGGTAGGATGGG - Intergenic
901229615 1:7634464-7634486 AACAGGCAGGTAGGCAAGAGAGG + Intronic
902373452 1:16019092-16019114 AGCAAGCAGGTGGGTAGGGAGGG - Intronic
902978576 1:20107307-20107329 AAAACGAAGGTGGGTATGATTGG - Intergenic
903650052 1:24916702-24916724 AACAGGCAGGTCCTAAGGATGGG + Intronic
904469577 1:30728162-30728184 AACAACCAGGTGAGTAGCATGGG - Intergenic
904621008 1:31775312-31775334 CCCCGGCAGCTGGGTAGGATTGG - Intergenic
904696869 1:32335933-32335955 AACGGCCAGGTGGGTACGCTTGG - Exonic
905404725 1:37725074-37725096 AGCAGGCAGGTTTGTAGGTTTGG + Intronic
905686343 1:39911456-39911478 TAAAGGCAGGATGGTAGGATGGG - Intergenic
906126880 1:43432351-43432373 AACAGCCAGGTGGGTCCCATGGG + Exonic
908221690 1:62013645-62013667 CAAAGACAGGAGGGTAGGATAGG + Intronic
910927186 1:92409619-92409641 AACAAGCAGGATGATAGGATAGG + Intergenic
910981633 1:92964128-92964150 GGCAGGCAGGTGGGTAGGCATGG + Intergenic
911826629 1:102495088-102495110 ATCAGGTAGGTGGTTAGGGTAGG + Intergenic
912411541 1:109483854-109483876 GAAAGGCAGGTGGGGAGGAGGGG + Intronic
912469401 1:109896140-109896162 CACAGGCGGGTGGGCAGCATGGG - Intergenic
915528802 1:156491634-156491656 CACAAGCAGGTGGGTCTGATAGG - Intronic
915594111 1:156886768-156886790 AGCAGGCAGGAGGGTGGGGTTGG - Intergenic
916944393 1:169711417-169711439 TAGAGGCAGGTGGCAAGGATAGG - Intronic
917028182 1:170664185-170664207 AAGAGGGGGGTGGGTGGGATCGG + Exonic
917474750 1:175359567-175359589 ATCAGGCAGGTGGGAATGGTGGG - Intronic
920389425 1:205589848-205589870 AAGAGGGAGGTGGCTGGGATGGG + Intronic
920494941 1:206447905-206447927 AAGAAACAGGTGGGTAGGTTGGG - Intronic
921831403 1:219731955-219731977 CAAAGGCAGATGGGTAGCATTGG - Intronic
922979466 1:229813453-229813475 ATCAGTCTGGTGGGTTGGATTGG + Intergenic
923251156 1:232180603-232180625 AAGAGAGAGGTGGGTAGGAGAGG + Intergenic
923312296 1:232746922-232746944 AACAGGGAGGTTAGTGGGATGGG - Intergenic
924214841 1:241810326-241810348 CACAGACAGGTGGGTGGGCTTGG - Intergenic
1063021043 10:2127840-2127862 AACAGGTAGGTGGGTGGGCCTGG - Intergenic
1066072579 10:31834859-31834881 AATAGGCAGATGGGTAATATAGG + Intronic
1067832792 10:49620057-49620079 AACAGGCAGGTGGCATGGATTGG + Intronic
1068925381 10:62530389-62530411 AACAGGCAGTTGTCTAGGCTAGG - Intronic
1070800405 10:79242016-79242038 CACAGGCAGGTGGGTGGGGCTGG + Intronic
1072537039 10:96371700-96371722 CCCAGGCAGGTGGGGAGGGTGGG - Intronic
1074495073 10:113973028-113973050 AACTGGGAGGTGGGAAGGAGAGG - Intergenic
1077155516 11:1089232-1089254 TACAGGCAGCTGGGGAGGACGGG + Intergenic
1077504765 11:2924831-2924853 AGCTGGCAGGTGGAAAGGATGGG + Intronic
1079868512 11:25765337-25765359 AACAGGGAGTTGGGGAGGGTAGG + Intergenic
1082695293 11:56356231-56356253 AAGAGGGAGGTGCATAGGATGGG + Intergenic
1082791342 11:57348425-57348447 AGGAGGCAGGTGGGTGGGCTGGG - Intronic
1082799828 11:57406356-57406378 AGATGGCAGGTGGGTGGGATGGG - Intronic
1083558403 11:63651589-63651611 GGGAGGCCGGTGGGTAGGATTGG - Intronic
1083955733 11:65981978-65982000 CACAGCCAGGTGTGAAGGATGGG + Intergenic
1085176076 11:74489234-74489256 CACAGACAGATGGGCAGGATGGG + Intergenic
1085464857 11:76716532-76716554 AACAGACAGGTGGGTAGGGCAGG - Intergenic
1086253364 11:84844547-84844569 AGCAGACAGGTGAGAAGGATGGG - Intronic
1087375357 11:97332894-97332916 ATCAGAAAGGTGAGTAGGATCGG + Intergenic
1089311807 11:117563043-117563065 AGCAAGCAGTTGGCTAGGATGGG - Intronic
1089411925 11:118251222-118251244 CACAGGCAGCTGGGAGGGATCGG + Intronic
1091283748 11:134396831-134396853 AAGAGGCAGGTGGAGAGGAGAGG + Intronic
1091563197 12:1629965-1629987 AACAGGCAGGTGTGTGGGGCCGG - Intronic
1091962747 12:4712325-4712347 AACTGGCAGGGTGGTAGGGTAGG + Intronic
1093015293 12:14148976-14148998 AGCAGGCAGGTGACTTGGATGGG + Intergenic
1095198764 12:39357230-39357252 AGCAGGTATGTGGGTAGGGTGGG - Exonic
1095946825 12:47758537-47758559 AACATGAAGGTGGGTAAGGTGGG - Exonic
1096981473 12:55729983-55730005 AACAGGCCGGAGAGTAGGACCGG + Intergenic
1099477241 12:83122231-83122253 AGCTGGGAGGTGGGTAGCATGGG - Intronic
1101316433 12:103633086-103633108 CAAAGGCAAGTGGGTAGGACAGG + Intronic
1101968436 12:109296263-109296285 AACAGGTTGGAGGGCAGGATGGG - Intronic
1102418867 12:112788146-112788168 ACCAGGGAGGTGGGCAGGATGGG + Intronic
1102609152 12:114095949-114095971 AGCAGGCAGGTGAGCAGGATTGG - Intergenic
1102845038 12:116171561-116171583 AAGAGGAAGGTGGTTGGGATGGG - Intronic
1104472861 12:129044621-129044643 AACAGGCAGGTGGGAAGGTGTGG + Intergenic
1104735468 12:131133540-131133562 CAGACGCAGGTGGGAAGGATGGG - Intronic
1105263243 13:18795548-18795570 AAAAAGCAAGTGGGTAGGGTGGG - Intergenic
1106194247 13:27479865-27479887 AACAGGCAGGGGAGTAGGGTGGG - Intergenic
1110602946 13:77396999-77397021 AACAGGGAGGTAGGTAGGGAAGG - Intergenic
1111315578 13:86554265-86554287 AATAGGGAGGTGGGTTGGAAAGG - Intergenic
1111924021 13:94443682-94443704 AACAGTCAGGTTGGTGTGATCGG - Intronic
1112898661 13:104333369-104333391 AACTGGAAGGTGGGTAGGGTTGG + Intergenic
1113031955 13:106003267-106003289 AACATCCAGGTGGGTTGGGTTGG - Intergenic
1113242647 13:108355487-108355509 AACAGGCAGAGGGGCAGGACTGG + Intergenic
1114668898 14:24398697-24398719 AAGAGGAAGGAGGGGAGGATTGG - Intergenic
1114671483 14:24414055-24414077 AACTGGCAGGTGGGCAGCAGAGG - Intronic
1115010789 14:28542217-28542239 AAGAGGCAGCTGGATAGAATTGG - Intergenic
1118223621 14:63878378-63878400 TACAGGGAGCTGGGGAGGATTGG + Intronic
1118499505 14:66345841-66345863 AAATGGGAGGTGGGTCGGATTGG - Intergenic
1119024560 14:71142260-71142282 ATCAGGCAGTTGGGTAGGAATGG - Intergenic
1123020230 14:105394486-105394508 GGCAGGCAGGTGGATAGGGTGGG + Intronic
1124336500 15:28861270-28861292 CACAGCCAGCTGGGTAGGCTGGG - Intergenic
1124908437 15:33894482-33894504 CACAGGCAGTTGGGGTGGATAGG + Intronic
1126438770 15:48664521-48664543 AGCAGGCAGGTGTGAAGGGTAGG + Intergenic
1126663622 15:51055819-51055841 TGCAGGCAGGTGGGAAGGAAGGG + Intergenic
1126775171 15:52094230-52094252 GACAGGCAGATGGGGAGGAGAGG - Intergenic
1128217991 15:65947444-65947466 AACAAGCTGTTGGGAAGGATGGG + Intronic
1128481600 15:68045056-68045078 AACATGCATGTTGGTAGGAAAGG - Intergenic
1128543111 15:68550740-68550762 AAGAGGCAGGTGGGTGGCTTGGG + Intergenic
1130611919 15:85369122-85369144 AACAGCCAGGTGAGTAAGCTTGG + Intergenic
1130911917 15:88276757-88276779 AACCGGCAGGGGGGTAGGACAGG + Intergenic
1131047760 15:89326898-89326920 ATCAGGAAGGTGGGGAGCATGGG - Exonic
1132619279 16:856688-856710 AACTGGCAGGTTGGTGGGAAGGG + Intronic
1134308701 16:13056936-13056958 ATCTGGCAGGTGTGTAGGTTTGG + Intronic
1134492071 16:14703037-14703059 AAGCGGCAGGTGGGAAGGAGCGG - Intergenic
1134497452 16:14742159-14742181 AAGCGGCAGGTGGGAAGGAGCGG - Intronic
1135381022 16:21996268-21996290 TGCAGGCAGATGGGCAGGATGGG + Intronic
1135647797 16:24178478-24178500 AGCAGGCAGCTGGGTAGACTAGG - Intronic
1136403550 16:30030879-30030901 ACCAGGCAGGTGGGGAGGGGAGG + Exonic
1139685045 16:68596938-68596960 AAAAGGAAGGTGGGGAGCATGGG - Intergenic
1139824839 16:69748904-69748926 GCCATGCAGGTGGGTAGGGTGGG - Exonic
1139965896 16:70745209-70745231 AGCAGGCAGGTGGTCAGGCTGGG - Intronic
1144818558 17:18054513-18054535 GACAAACAGGTGGGAAGGATGGG - Intronic
1145207461 17:20992183-20992205 AAAAGGCAGGAGGGCAGGCTGGG - Intergenic
1149454844 17:56779547-56779569 ATCTGCCAAGTGGGTAGGATTGG + Intergenic
1149559215 17:57596138-57596160 AAGGGGCAGGAGGGTAGGAGAGG + Intronic
1149685208 17:58531231-58531253 TACAGGCAGGTGGCAGGGATGGG + Intronic
1151305187 17:73258650-73258672 TCCAGGCAGATGGGAAGGATGGG - Intronic
1151480810 17:74369216-74369238 AAGAGGCAGGATGGCAGGATGGG - Intronic
1152134351 17:78495141-78495163 GACAGGCAGGGGTGTAGGTTGGG - Intronic
1152626651 17:81390717-81390739 TACAGGCAGATGGGTGGGGTGGG + Intergenic
1152769503 17:82158390-82158412 GAAAGGCAGGTGGATAGGCTGGG + Intronic
1153260974 18:3224515-3224537 AACTGGCAGGTAAGTGGGATAGG + Intergenic
1153990900 18:10399330-10399352 AACAGGAAGCGGGGGAGGATAGG - Intergenic
1154179948 18:12127448-12127470 AACAGGTATGTGGGTGGGACTGG - Intronic
1155712682 18:28902881-28902903 AACGGGAAGGTCAGTAGGATGGG - Intergenic
1155736261 18:29226339-29226361 AACAATCAGGTGGGTGGGGTTGG + Intergenic
1155989953 18:32270108-32270130 AACAGGCAGGGTGGTGGGAGAGG - Intronic
1156093928 18:33506656-33506678 AAAAGGCAGGTGTGTAAGTTGGG - Intergenic
1156481668 18:37440256-37440278 AACAACCAGGTGGGGAGGAGGGG + Intronic
1157505996 18:48227103-48227125 AAGAGGCAGGTTGGTAGGAGAGG - Intronic
1158669993 18:59466039-59466061 AGCAGGCAAGTGGGCAGGAAGGG - Intronic
1159049856 18:63410167-63410189 AACAGGCAGCTGGGCAGCTTTGG + Intronic
1159277642 18:66241932-66241954 ATCATGGAGGTGGGAAGGATTGG - Intergenic
1159699269 18:71604163-71604185 AGCAGGCAGGAGTGTAGGAAGGG + Intergenic
1160055669 18:75477577-75477599 AACAGGCAGTAGAGGAGGATGGG - Intergenic
1160778548 19:867776-867798 AGCAGGCCGGTGGATGGGATGGG - Intronic
1163611881 19:18305934-18305956 AACAGGCAGGTGGGTGCCGTGGG + Intergenic
1163765334 19:19160610-19160632 GAGAGGCAGGTGGGTTGGGTGGG + Intronic
1165334023 19:35156636-35156658 AGCAGGCAGGTGGGGTGGCTGGG + Intronic
1166195620 19:41203798-41203820 AAGATGCAGGGGGGTAGGAGTGG - Intronic
1166377709 19:42336966-42336988 AGCAGGCAGGCAGGCAGGATTGG - Intronic
1166863651 19:45823549-45823571 AGCAGGCAGGTGTGCAGGAAGGG + Intronic
1167199261 19:48052902-48052924 AACAGGCAGGAGGGTTGCATGGG - Intronic
1167207342 19:48111544-48111566 AGTAGGCAGGAGGGTAGTATGGG - Intergenic
925882735 2:8366436-8366458 TACAGACAGGTGGGGATGATAGG + Intergenic
927180782 2:20445558-20445580 AGCAGGAAGGTGGGAAGGAGCGG - Intergenic
928380591 2:30814358-30814380 AACACGAAGGTAGGTAGGAAAGG + Intronic
929097944 2:38281693-38281715 AACAGGCAGGTAGGAATGTTTGG + Intergenic
930724572 2:54670221-54670243 AACAGGCAAGAGGTTAGGTTTGG + Intronic
931106621 2:59063716-59063738 AACAGGCAGTGGGGTAGATTTGG - Intergenic
931622507 2:64225142-64225164 CACAGGCAGGTTGGTAGAAAAGG - Intergenic
931761395 2:65420294-65420316 AACACGGAGGTGGGTACAATGGG - Intronic
932571082 2:72938709-72938731 AGGAGGCAGGTGGGGAGGAAGGG - Intergenic
932744290 2:74319208-74319230 AAAAGGTAGGAGGGTAGGAAGGG + Intronic
934490072 2:94756448-94756470 AACGGGCAGGTGGGGATGGTGGG - Intergenic
934570890 2:95372684-95372706 TGCAGGCAGGTGGGTAGGTGTGG + Intronic
935158939 2:100512264-100512286 GACAGACAGCTGGGTAGTATGGG - Intergenic
935351599 2:102155664-102155686 AACAGTCAGGGGGGTGGGAGTGG - Intronic
935511802 2:103985037-103985059 AACAGGCAGTGGGGCAGAATTGG - Intergenic
937054992 2:118927133-118927155 AAAAGGCAGGTAGGGAGGGTGGG + Intergenic
938163981 2:129010077-129010099 AACAGGAGGGTTGGGAGGATGGG + Intergenic
938968953 2:136414889-136414911 GACAGGCAGGGTGGGAGGATAGG + Intergenic
940347319 2:152641202-152641224 ATCAGGCAGGTGGCTAGGTGTGG - Intronic
941745443 2:169081901-169081923 GACATGGAAGTGGGTAGGATGGG + Intronic
942643885 2:178090460-178090482 AAAAGGCAGGCGGGTAGAAATGG - Intronic
944624972 2:201561424-201561446 AACAGGCAGGAGGATGAGATAGG + Intronic
945653256 2:212591192-212591214 AAGAGGGAGGTGAATAGGATTGG - Intergenic
946209017 2:218132297-218132319 AATAGGCAAATGGGTAGAATTGG - Intronic
946353968 2:219173295-219173317 AGCAGGCCGGTGTGTAGGGTGGG - Intronic
946560445 2:220906436-220906458 AACAGTCAGGAGGGTATGATGGG + Intergenic
947148211 2:227087846-227087868 AACTGGCAGGAGGTTAGGAAGGG - Intronic
947526209 2:230878236-230878258 TACAGGGAGGTGGGCAGGGTTGG - Exonic
948364780 2:237447825-237447847 AACAGCCTGATGGGTTGGATGGG - Intergenic
948903653 2:240967942-240967964 AAGAGGCAGGAGGGAAGGATGGG + Intronic
1168766914 20:388131-388153 AACAGGCAGGGGGGCAGTCTGGG - Exonic
1169431839 20:5543303-5543325 AATAGAAATGTGGGTAGGATGGG - Intergenic
1169784524 20:9344877-9344899 AACAGGCAGTTGTTTAGGAGAGG - Intronic
1171186069 20:23125330-23125352 AACAGGCAGTGGGGTGGGTTCGG + Intergenic
1171202716 20:23255023-23255045 AGCAGGGAGGGGGGTGGGATGGG - Intergenic
1173582682 20:44158774-44158796 ACCAGGCGGGTGGGTGGGAGTGG + Intronic
1175657329 20:60782416-60782438 AAGAGCAAGGTGGGTAGGAAAGG - Intergenic
1178891824 21:36526308-36526330 AACAGGCAGCAGGGCAGGTTTGG + Intronic
1179254415 21:39702767-39702789 ATCAAGCAGGTGGGTGGGATTGG - Intergenic
1180002923 21:45003193-45003215 AGCAGGCAGGTGGGGAGGGCAGG - Intergenic
1180566689 22:16674031-16674053 AACAGGTATGTGGGTGGGACTGG + Intergenic
1182125890 22:27815662-27815684 AAGAGGCAGGTGTGGGGGATGGG + Intergenic
1182168634 22:28203699-28203721 CAGAGGCAGGTGGGTGGGAGTGG - Intronic
1182806093 22:33071872-33071894 AACAGCCAGGTAGGAAGGCTGGG - Intergenic
1184093476 22:42304347-42304369 CACAGGGAGGTGGGGAGGCTGGG + Intronic
1184309478 22:43631931-43631953 GAGAGGCATGTGGGGAGGATGGG - Intronic
1184600176 22:45538839-45538861 TACAGGCAGGAGGCTCGGATGGG - Intronic
949962225 3:9322022-9322044 AAAAGGCAAGTAAGTAGGATAGG + Intronic
950028133 3:9834597-9834619 AACAGGTACGTGTGGAGGATGGG - Intronic
950528155 3:13536610-13536632 GACAGGAAGGAGGGAAGGATGGG - Intergenic
952236196 3:31482512-31482534 GACAGGCAGGAGTGTAGGAGAGG - Intergenic
953031616 3:39183677-39183699 CACAGGCGTGGGGGTAGGATGGG - Exonic
953358406 3:42273797-42273819 ACCAGGCAGGTTGGTAAGGTAGG - Intergenic
954280417 3:49573250-49573272 AATAGGTAGGTGGGGAGGAAAGG + Intronic
955215551 3:56982510-56982532 AACAGGCAAGAGGGGTGGATAGG - Intronic
956266537 3:67402917-67402939 AACAGGCAGGAGTGAGGGATAGG + Intronic
956276521 3:67507880-67507902 GAATGGCAGGTGGATAGGATAGG - Intronic
956698384 3:71937589-71937611 ACCCTGGAGGTGGGTAGGATGGG + Intergenic
958146251 3:89629361-89629383 AACAGTCAGCTGGGGAGGAGAGG - Intergenic
960053974 3:113263318-113263340 AACAGGCAGGAGGGTAGGACAGG + Intronic
961778981 3:129310473-129310495 CACAGGCAGGTGGTCAGGAGGGG - Intergenic
962754803 3:138459148-138459170 AAAAGGAAGGTGGGGAGGAGGGG - Intronic
962894726 3:139704142-139704164 GACAGGCAGGTGGGTAAGGTGGG + Intergenic
962958538 3:140288886-140288908 AACTGGGAGGTGGGTATGAAGGG - Intronic
963295145 3:143537800-143537822 AGCAGGCAGGTGGGTTGGGAGGG + Intronic
964081226 3:152760461-152760483 AACAGGCAGCTGGGTAGATTTGG - Intergenic
965792503 3:172404754-172404776 AACAGACAGGAGTGAAGGATGGG - Intergenic
966172246 3:177095229-177095251 AACTCGCAGGCGGGTAGGAGAGG + Intronic
967308313 3:188081491-188081513 AACAGGAAAGTGGGTGAGATAGG - Intergenic
968076384 3:195817853-195817875 AGCAGGGAGGTGGGTGGGCTGGG + Intergenic
969219723 4:5751886-5751908 ACCAGGCAGGTGTGCAGGACAGG + Intronic
971104294 4:23505727-23505749 AAAAGTCAGGAGGGTAGGAAGGG - Intergenic
972043589 4:34636502-34636524 AACATGCAGGTTTGTAGGAATGG - Intergenic
972056495 4:34809030-34809052 TACAGGTAAGTGGGTAGTATAGG - Intergenic
975233033 4:71957011-71957033 AGCAGCCAGGTGGGTAGGTGTGG - Intergenic
975300713 4:72787584-72787606 AACAGGCAGGTGAGAAGAGTAGG - Intergenic
975966005 4:79973116-79973138 AAGAGGAAGGTGGGGAGGAAGGG + Intronic
977667338 4:99655945-99655967 AATAGGCATGTGGGTAGGTATGG + Intergenic
978746789 4:112203885-112203907 AACAGAAAGCTGGGTAGGAGAGG + Intergenic
979767106 4:124475328-124475350 AATAATCAGGTGGATAGGATGGG + Intergenic
980967999 4:139542242-139542264 AGAAGGCAGGAGGGAAGGATGGG + Intronic
982303167 4:153900817-153900839 AAGAGGCAGGTGTGTAGAAGTGG - Intergenic
983922266 4:173358576-173358598 ACCAGGCAGATGGGAAGGAAGGG + Intergenic
985091208 4:186364249-186364271 AACAAACAGGTGGTGAGGATGGG - Intergenic
985532265 5:440981-441003 AGCAGGCAGGTGGGTGGGTAGGG - Intergenic
985588614 5:753484-753506 CACAGGCAGGTGGCAAGGAGAGG - Intronic
985603283 5:845923-845945 CACAGGCAGGTGGCAAGGAGAGG - Intronic
985900806 5:2789088-2789110 AACAGCCAGGTGAGTGGGCTTGG + Intergenic
985945211 5:3177102-3177124 CACAGGAAGGTGGGGAGGGTTGG + Intergenic
987257880 5:16175398-16175420 AACATGAAGGTGGCTAGGATGGG + Intronic
987686231 5:21206649-21206671 GACAGGCAGGCTGGTAGGAAAGG - Intergenic
987915807 5:24212473-24212495 AAAAGGCAGGTAGATAGAATGGG - Intergenic
989224834 5:39014405-39014427 AACAGGGAGGTGGGTGGGAAGGG + Intronic
989435582 5:41409518-41409540 AACAGGCAGCAGGGGAGGGTTGG - Intronic
990166174 5:52995716-52995738 AACAGGCAGGAAAGTAAGATGGG + Intronic
993730884 5:91421351-91421373 AAAAGGAAGGAGGGTAGGACGGG - Intergenic
995456036 5:112353512-112353534 CACAGGTAGGTGGGTAGCGTTGG + Intronic
995540251 5:113178793-113178815 AGAAGGCAGGAGGGTAGGATAGG - Intronic
996277341 5:121682854-121682876 AAGTGGCAGGTGGGTAGGACAGG + Intergenic
996504834 5:124257427-124257449 AACTGGGAGGTGGGTAGCCTGGG - Intergenic
997700512 5:135894935-135894957 AACAGGGTGGTGGGGAGGAAGGG + Intronic
998004289 5:138647012-138647034 AACAGGCAGTGGGGTGGGAGGGG + Intronic
1002641838 5:180634123-180634145 AACAGGCACTTTGGGAGGATGGG - Intronic
1003274816 6:4640482-4640504 AACAGCCAGGTGGGAAAGAAAGG + Intergenic
1003499632 6:6693923-6693945 ATCAGGCTGGTGGGTGGGGTAGG + Intergenic
1004517705 6:16334808-16334830 CAAAGGCACGTGGGAAGGATGGG + Intronic
1004784462 6:18951117-18951139 AGCAGGAAGGTGGGGAGGATGGG + Intergenic
1006437066 6:34031210-34031232 AAGAGGCAGGTGGGTGGGAGAGG - Intronic
1007010839 6:38416132-38416154 CACTGGGAGGTGGGTAGGGTAGG + Intronic
1007284207 6:40736173-40736195 TAGAGGCAGGTGGGTAGTCTGGG - Intergenic
1007426035 6:41746738-41746760 AACAGGCAGGATGGCAGGCTGGG + Intronic
1007782855 6:44264239-44264261 AAAAGGCAGTTGTGTGGGATGGG - Intronic
1009027513 6:58017439-58017461 AACAGGGAGATGGGTGGGGTAGG + Intergenic
1009203046 6:60768915-60768937 AACAGGGAGATGGGTGGGGTAGG + Intergenic
1011557605 6:88586798-88586820 AACAGGCAGCTGGGAAGGGCGGG - Intergenic
1015387594 6:132642346-132642368 AACAGACAGGTGGGTAGTTCTGG + Intergenic
1016172964 6:141041925-141041947 TACAGGGAGGTGTGGAGGATGGG - Intergenic
1016559365 6:145378018-145378040 ATCATGCAGGTGGTTAGGGTTGG - Intergenic
1016997405 6:149970176-149970198 AAGAGGCAGATGGGTGAGATGGG + Intronic
1017255584 6:152329716-152329738 ACCAGACAGGTGGGTATAATAGG - Exonic
1017362804 6:153595716-153595738 AACAGCCATGTGGGTAAAATTGG - Intergenic
1018683674 6:166284911-166284933 TACACGCAGCTGGGTAGGAGGGG + Intergenic
1018736170 6:166688573-166688595 AAGAAGCAGGTGGCTAGGAGAGG + Intronic
1018851441 6:167643435-167643457 AACAGCCGGGTGGGAAGGAAGGG + Intergenic
1020874831 7:13679393-13679415 AACAGCCTGGAGGGTGGGATGGG + Intergenic
1022301523 7:29106641-29106663 AACAGGGAAGAGGGTAGAATTGG + Intronic
1023901821 7:44487478-44487500 AAGAGGCAGATGAGTAGGAGTGG + Intronic
1024474391 7:49794850-49794872 ATAAGTCAGGTGGGAAGGATTGG - Intronic
1026416641 7:70188330-70188352 AAGAGGCAGGTAGCTAGGAAGGG + Intronic
1026511846 7:71033913-71033935 AATAGGCAGGTGAGGAGGAGAGG + Intergenic
1027141043 7:75657736-75657758 AAAAGGCAGGAGGGAAGGAGGGG + Intronic
1028970647 7:96854929-96854951 ATCTGGCAGGTGGGTGGGGTGGG - Intergenic
1029266342 7:99344215-99344237 CACAGGCAGGTGGGTGGCACTGG - Intronic
1029704711 7:102270200-102270222 AACACGCAGGTGGGGAAGCTGGG - Intronic
1029706329 7:102278208-102278230 AGCAGGCAGGTGGGTGGGTGGGG - Intronic
1031756124 7:125645295-125645317 ATCAGGCAGGTAGGTAGGCAGGG + Intergenic
1035318983 7:158016191-158016213 ACAAGGGAGGTGGGGAGGATGGG + Intronic
1035911602 8:3572361-3572383 AGCAGGGAGGTGGGCAGGAGAGG + Intronic
1036912825 8:12772110-12772132 AAGAGGCAGCGGGGTGGGATGGG - Intergenic
1037149207 8:15615471-15615493 AGTAGGCAGGAGGGGAGGATAGG + Intronic
1038473669 8:27846286-27846308 ACCAGGCAAGAGGATAGGATGGG + Intergenic
1041670333 8:60485382-60485404 CACAGGTAGGTAGGTAGGAAGGG + Intergenic
1043418057 8:80071690-80071712 ACTAGGCAGGAGGGCAGGATTGG - Intronic
1043817537 8:84820581-84820603 AACATGCAGGTGTGTTGCATAGG + Intronic
1047359618 8:124156163-124156185 TAGAGGGAGGAGGGTAGGATGGG - Intergenic
1047531849 8:125684150-125684172 AAGAGGCAGGAGGGTTGCATGGG - Intergenic
1047778541 8:128092982-128093004 AAGAGGCATCTGGGCAGGATGGG - Intergenic
1055105239 9:72505296-72505318 AAAAGGCAAGTTGGTAGGTTTGG - Intergenic
1055189450 9:73499292-73499314 AAAAGGCAGGTGGACAGGTTTGG - Intergenic
1056282674 9:85057173-85057195 CACAGGGAGGTGGGCAGCATGGG + Intergenic
1057186967 9:93062453-93062475 GAACAGCAGGTGGGTAGGATGGG + Intronic
1057266861 9:93622928-93622950 GACAGGCAGGTGTGTGTGATGGG + Intronic
1059972892 9:119685757-119685779 AAAAGGAGGGTGGTTAGGATAGG - Intergenic
1060292273 9:122314925-122314947 AACAGGCATGTGGGCTGGATAGG + Intronic
1060981370 9:127794320-127794342 GACAGGCAGGTGGGTGGGAGGGG - Intergenic
1061132307 9:128714870-128714892 AACATGAAGGTGCGCAGGATGGG - Intronic
1061220968 9:129251811-129251833 GACTGGCAGGAGGGCAGGATGGG + Intergenic
1061257170 9:129459821-129459843 ATCAGGGAGGTGGGAAGGCTGGG + Intergenic
1061373683 9:130211999-130212021 GTCAGGCAGGTGGGGAGGAGGGG + Intronic
1062576747 9:137212396-137212418 AACAGGCAGGTGGGTAGGATGGG - Intronic
1189000443 X:36938456-36938478 AGAAGGCAGAGGGGTAGGATGGG - Intergenic
1191143215 X:57136996-57137018 AACAGGGAAGTGGTTAGGATAGG - Exonic
1193369453 X:80676980-80677002 AAGAGGCAGATGGGGAAGATGGG - Exonic
1194258048 X:91658499-91658521 AAAAAGCAGGTGGTGAGGATAGG + Intergenic
1194883366 X:99282116-99282138 AATAGGCAGCTGGGTAGGGATGG + Intergenic
1196508109 X:116473549-116473571 AACAGGCAGGTGTGTTACATAGG + Intergenic
1197476349 X:126929853-126929875 AACTGGGAGGTGGGTAGCCTGGG - Intergenic
1199915391 X:152334848-152334870 AGCTGGCAGGTGGGTGGGAATGG - Intronic
1200066367 X:153505974-153505996 ACCAGGGAGCTGGGTAGGTTGGG - Exonic