ID: 1062578370

View in Genome Browser
Species Human (GRCh38)
Location 9:137218873-137218895
Sequence CACAGACTTTCCTGCTGGGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1062578370_1062578384 27 Left 1062578370 9:137218873-137218895 CCAGCCCAGCAGGAAAGTCTGTG No data
Right 1062578384 9:137218923-137218945 ACGGGCACCGTACTGGCCACGGG No data
1062578370_1062578377 8 Left 1062578370 9:137218873-137218895 CCAGCCCAGCAGGAAAGTCTGTG No data
Right 1062578377 9:137218904-137218926 CCCATTCACCCTGCGGCAGACGG No data
1062578370_1062578383 26 Left 1062578370 9:137218873-137218895 CCAGCCCAGCAGGAAAGTCTGTG No data
Right 1062578383 9:137218922-137218944 GACGGGCACCGTACTGGCCACGG No data
1062578370_1062578374 1 Left 1062578370 9:137218873-137218895 CCAGCCCAGCAGGAAAGTCTGTG No data
Right 1062578374 9:137218897-137218919 GCAGGACCCCATTCACCCTGCGG No data
1062578370_1062578382 20 Left 1062578370 9:137218873-137218895 CCAGCCCAGCAGGAAAGTCTGTG No data
Right 1062578382 9:137218916-137218938 GCGGCAGACGGGCACCGTACTGG No data
1062578370_1062578379 9 Left 1062578370 9:137218873-137218895 CCAGCCCAGCAGGAAAGTCTGTG No data
Right 1062578379 9:137218905-137218927 CCATTCACCCTGCGGCAGACGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1062578370 Original CRISPR CACAGACTTTCCTGCTGGGC TGG (reversed) Intergenic
No off target data available for this crispr