ID: 1062579054

View in Genome Browser
Species Human (GRCh38)
Location 9:137221621-137221643
Sequence GCGCCCTGTCCTGGAGCCAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 164
Summary {0: 1, 1: 0, 2: 2, 3: 20, 4: 141}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1062579054_1062579064 16 Left 1062579054 9:137221621-137221643 CCCATGGCTCCAGGACAGGGCGC 0: 1
1: 0
2: 2
3: 20
4: 141
Right 1062579064 9:137221660-137221682 GCCGAAGCGCTGGCTGCAGGAGG 0: 1
1: 0
2: 2
3: 8
4: 162
1062579054_1062579070 30 Left 1062579054 9:137221621-137221643 CCCATGGCTCCAGGACAGGGCGC 0: 1
1: 0
2: 2
3: 20
4: 141
Right 1062579070 9:137221674-137221696 TGCAGGAGGACCGGGGCGGCAGG 0: 1
1: 0
2: 0
3: 18
4: 304
1062579054_1062579063 13 Left 1062579054 9:137221621-137221643 CCCATGGCTCCAGGACAGGGCGC 0: 1
1: 0
2: 2
3: 20
4: 141
Right 1062579063 9:137221657-137221679 CTAGCCGAAGCGCTGGCTGCAGG 0: 1
1: 0
2: 0
3: 0
4: 61
1062579054_1062579068 23 Left 1062579054 9:137221621-137221643 CCCATGGCTCCAGGACAGGGCGC 0: 1
1: 0
2: 2
3: 20
4: 141
Right 1062579068 9:137221667-137221689 CGCTGGCTGCAGGAGGACCGGGG 0: 1
1: 0
2: 2
3: 20
4: 218
1062579054_1062579069 26 Left 1062579054 9:137221621-137221643 CCCATGGCTCCAGGACAGGGCGC 0: 1
1: 0
2: 2
3: 20
4: 141
Right 1062579069 9:137221670-137221692 TGGCTGCAGGAGGACCGGGGCGG 0: 1
1: 0
2: 3
3: 42
4: 429
1062579054_1062579067 22 Left 1062579054 9:137221621-137221643 CCCATGGCTCCAGGACAGGGCGC 0: 1
1: 0
2: 2
3: 20
4: 141
Right 1062579067 9:137221666-137221688 GCGCTGGCTGCAGGAGGACCGGG 0: 1
1: 1
2: 4
3: 48
4: 329
1062579054_1062579066 21 Left 1062579054 9:137221621-137221643 CCCATGGCTCCAGGACAGGGCGC 0: 1
1: 0
2: 2
3: 20
4: 141
Right 1062579066 9:137221665-137221687 AGCGCTGGCTGCAGGAGGACCGG 0: 1
1: 0
2: 2
3: 23
4: 337
1062579054_1062579062 6 Left 1062579054 9:137221621-137221643 CCCATGGCTCCAGGACAGGGCGC 0: 1
1: 0
2: 2
3: 20
4: 141
Right 1062579062 9:137221650-137221672 AAGGCAGCTAGCCGAAGCGCTGG 0: 1
1: 0
2: 0
3: 2
4: 60

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1062579054 Original CRISPR GCGCCCTGTCCTGGAGCCAT GGG (reversed) Intergenic
900464396 1:2818001-2818023 GGGCCTTGTCCTGGTGCTATAGG - Intergenic
900802305 1:4744986-4745008 CCTCCCTGTCCTGGGGCCAGTGG + Intronic
900806966 1:4773899-4773921 GTGCCCTGGCATGGAGGCATTGG + Intronic
901000653 1:6147316-6147338 GAGCCCTGTGCTGGAGCCCAGGG + Intronic
902097814 1:13960859-13960881 GCCCCCTGTCCTGAAGCCCCAGG - Intergenic
902436876 1:16403835-16403857 GCGTTCTGTTCTGGAGACATGGG + Exonic
903018305 1:20376192-20376214 GAGTCCTGTGCTGGAGTCATTGG + Intergenic
903381566 1:22900604-22900626 GCTCCGTCTCCTGGAGCCACTGG + Intronic
905284447 1:36870193-36870215 GCTCCCTGTCCTGGATCCAGAGG + Intronic
905539198 1:38746692-38746714 GCCCCCTGTCTGGGAGCCCTGGG + Intergenic
906288618 1:44604600-44604622 GTGCCTTGGCCTGGAGCCTTTGG + Intronic
916108482 1:161447342-161447364 GCGCCCAGTGCTGGGGCCAGAGG - Intergenic
916110069 1:161454722-161454744 GCGCCCAGTGCTGGGGCCAGAGG - Intergenic
916111655 1:161462133-161462155 GCGCCCAGTGCTGGGGCCAGAGG - Intergenic
916113241 1:161469513-161469535 GCGCCCAGTGCTGGGGCCAGAGG - Intergenic
916457044 1:164981699-164981721 GAGCCATGTCATGGAGCCATAGG - Intergenic
919822592 1:201482397-201482419 ACCCCCTGTGCTGGAGCCAGAGG + Intergenic
921317191 1:213903776-213903798 GTGTCCTGTCCTGGAGCTTTAGG - Intergenic
922210601 1:223483667-223483689 GCACACTGTCCTGGAGCCTGGGG - Intergenic
922250730 1:223846314-223846336 GCGCCCTGTTCTGAAGGCAAAGG - Intergenic
923682620 1:236130565-236130587 TTGCCCTGCCCTGGGGCCATAGG + Intergenic
1064274087 10:13891246-13891268 ACGCCCTGTCCTGCACCCAAAGG + Intronic
1064334145 10:14423281-14423303 GCGCCCTGGGGTGGAGCCTTTGG + Intronic
1066483284 10:35818827-35818849 GAGCCCTGTCCTGTAGTCAGTGG - Intergenic
1067725772 10:48769699-48769721 GCGCTGGGTCCTGGAGCAATAGG - Intronic
1067776387 10:49167636-49167658 GAGCCCTGTCCCACAGCCATGGG - Intronic
1069535510 10:69249998-69250020 GAGCCCTGGCCTGGAGTCAAGGG - Intronic
1075088187 10:119428116-119428138 ACGCCCGGTTCTGGAGCCCTGGG + Intronic
1076312290 10:129517188-129517210 CCTCGCTGTCCAGGAGCCATGGG - Intronic
1076529074 10:131132693-131132715 GGGCTCTTTCCTGGAGCCCTTGG + Intronic
1076872037 10:133199022-133199044 GCGCCCGGGCCAGGAGCCAGAGG + Exonic
1077141747 11:1027852-1027874 GCACCCTGCCCTGGGGACATGGG + Intronic
1077322568 11:1948832-1948854 GAGCCCTGTCCTGGGGCCCTGGG + Intronic
1078465892 11:11550036-11550058 GAGTCCTGTCCTGGAGGCACAGG - Intronic
1079173669 11:18119761-18119783 GAGCCCTGTCCTGTAACAATAGG + Intronic
1081874884 11:46401692-46401714 GTGGCCAGGCCTGGAGCCATAGG - Intronic
1083160327 11:60850424-60850446 GGTCCCTGTTCTGGAGCCATGGG - Exonic
1084710788 11:70842717-70842739 GAGCCCTGTCCTGAAGCTAAAGG + Intronic
1087307984 11:96506575-96506597 CAGCCCTGTCATGGAGCCTTAGG - Intronic
1087859247 11:103133209-103133231 GCGCCCTGTCCTGGATGTATAGG + Intronic
1088419998 11:109635537-109635559 GGGGCCTGGCCTGGAGCCCTGGG + Intergenic
1091314050 11:134598329-134598351 GAGGCCCGTGCTGGAGCCATCGG - Intergenic
1202805585 11_KI270721v1_random:4145-4167 GAGCCCTGTCCTGGGGCCCTGGG + Intergenic
1092051070 12:5470586-5470608 GCCCCCTGCCCTGCAGCCATGGG - Intronic
1093987363 12:25551328-25551350 GAAACCTGTCCTGGAGCTATAGG + Intronic
1101427416 12:104599358-104599380 CCGCGCGGTCCCGGAGCCATGGG + Intronic
1103488065 12:121296356-121296378 GCGCCCTGTCCGGGTGGCAGGGG - Intronic
1105533939 13:21246450-21246472 GAGCACTGTGCTGGAGCCAAAGG + Intergenic
1106478674 13:30119851-30119873 GAGCACTGCCCAGGAGCCATGGG + Intergenic
1113631946 13:111893969-111893991 GACCCCAGCCCTGGAGCCATGGG + Intergenic
1119522110 14:75294138-75294160 GCGACCTGCCCTGGAGCAAAGGG - Intergenic
1119770001 14:77214569-77214591 GCCCCCTGTCTTGGACCCACAGG + Intronic
1121101391 14:91252968-91252990 GAGCCCTGCCTTGGAGCCAGAGG - Intronic
1122432699 14:101666024-101666046 TCGCCTTGTTCTGGAGCCCTTGG + Intergenic
1122552278 14:102556477-102556499 GGGCCCAGTCCTGGGTCCATGGG - Intergenic
1122719480 14:103714297-103714319 CTGCCCTCTCCTGGGGCCATTGG - Intronic
1124355691 15:28993247-28993269 GCCCTCTGTCCAGGAGACATAGG + Intronic
1129514911 15:76151466-76151488 GGGCCCTGTTCTGGAGCCCTGGG + Intronic
1129712062 15:77825495-77825517 GGGCCCTGTGCTGGGCCCATGGG + Intergenic
1132971539 16:2691643-2691665 GCCCACTGTCCTGGAGGCACTGG + Intronic
1136496820 16:30650184-30650206 GCGCCTTGTCCTGGAGAGATGGG - Intergenic
1136774789 16:32866168-32866190 GTGCCCTGTCCTGGGGGCCTGGG + Intergenic
1136895824 16:33995344-33995366 GTGCCCTGTCCTGGGGGCCTGGG - Intergenic
1138555969 16:57771428-57771450 GGGCGCTCTCCTGCAGCCATTGG + Exonic
1141487824 16:84352712-84352734 GGGCCATGTACTGGAGCCTTGGG - Intergenic
1203077213 16_KI270728v1_random:1128283-1128305 GTGCCCTGTCCTGGGGGCCTGGG + Intergenic
1144070924 17:11670571-11670593 GCTCCCTGATCTGGAGCCATAGG + Intronic
1144882881 17:18439630-18439652 GCTCCCGTTCCTGGAGCCCTTGG - Intergenic
1145149350 17:20504756-20504778 GCTCCCGTTCCTGGAGCCCTTGG + Intergenic
1145248674 17:21285586-21285608 GCACCCTGTCCTGCAGCCCTGGG + Intronic
1145940382 17:28740513-28740535 GCTTCCTGTCCTGGGGGCATGGG - Exonic
1147335338 17:39724053-39724075 GAGCCCAGACCTGCAGCCATGGG - Intronic
1147577883 17:41613022-41613044 GCTCCCTTTCCTGGAGCCCTCGG + Intronic
1147888174 17:43698545-43698567 CAGCCCTGTCTTGGAGCCCTGGG - Intergenic
1152744433 17:82032300-82032322 GCCCCCTCTCCCGGAGCCAGAGG - Intronic
1153641593 18:7162491-7162513 GCTCCCTGTCCTGCCACCATGGG + Intergenic
1153730312 18:8004618-8004640 GCTCCCTTTCCTGATGCCATCGG - Intronic
1160482774 18:79257700-79257722 GCGCCCTGTGCTGGAGGCTGGGG - Intronic
1161261590 19:3340776-3340798 GCTCCCTGGCCTGGAGCCCCAGG + Intergenic
1162501337 19:11055669-11055691 ACGCCCTGCCCTGTGGCCATGGG - Intronic
1163832295 19:19552862-19552884 GGCCCTTGTCCTGGAGCCAGTGG - Intergenic
1164729765 19:30494602-30494624 GGGTCCTGTTCTTGAGCCATAGG - Intronic
1164895460 19:31873533-31873555 GGGCCAGATCCTGGAGCCATAGG - Intergenic
1165040622 19:33065217-33065239 GCACCCTGCCCTGGAGCCCGGGG + Intergenic
1166103652 19:40586801-40586823 GCCCCCTGAGCTGGTGCCATAGG - Exonic
1166415972 19:42595244-42595266 GCACCCCGACCTGGAGACATAGG - Intronic
1166555863 19:43699596-43699618 GCGCCCTGGACTGGACCCACGGG + Intergenic
927178936 2:20430161-20430183 GCGCTCTGACCTTGTGCCATGGG - Intergenic
928429582 2:31206281-31206303 GCACCCTGTGCTGGAGCCTGGGG - Intronic
930015588 2:46968339-46968361 GCGCCCAGTCCTTGAGGCATCGG - Intronic
930065319 2:47323443-47323465 TCGCCCTGTCCTGGGGACAGTGG - Intergenic
934651108 2:96091865-96091887 ACCCCCTCTCCTGGAGCCATGGG + Intergenic
936350599 2:111709856-111709878 GCCCCCTCTGCTGCAGCCATGGG - Intergenic
937915533 2:127097075-127097097 GGGGTCTGTCCTGGAGCCAGGGG + Intronic
941211590 2:162646829-162646851 GGGCTCTTTCCTGGAGCCTTTGG - Intronic
948555289 2:238805984-238806006 GCTACCTGTCCTGGAGTCACAGG + Intergenic
948897192 2:240933004-240933026 GGGCCCCTCCCTGGAGCCATGGG - Intronic
1169699692 20:8432312-8432334 GCGCACTGGCATGGAGCCACGGG - Intronic
1170088824 20:12567521-12567543 GCGTCCTGTCTTGGGGCCATAGG - Intergenic
1170792972 20:19522754-19522776 GCAGCCTCTCCTGGAGCCCTGGG - Intronic
1175897472 20:62345768-62345790 CCGGCCTGCCCTGGAGCCATGGG - Intronic
1176100641 20:63362925-63362947 GAACTCTTTCCTGGAGCCATGGG + Intronic
1179545005 21:42107867-42107889 GAGCCCTCTCCTGGAGCAATGGG - Intronic
1180080629 21:45486115-45486137 GAGGCATGTGCTGGAGCCATCGG - Intronic
1180177292 21:46097266-46097288 GAGCCCTGTCCCGGAGCCCAGGG + Intergenic
1180189072 21:46154075-46154097 GAGCCCTGTCCTGGTGTCCTGGG - Intronic
1181055700 22:20259633-20259655 GTGGCCTGTCCTGCAGCCACTGG + Intronic
1181273192 22:21672872-21672894 GCTCCCTGTGCTGGAGCCGCTGG + Intronic
1181463889 22:23100563-23100585 GTCCCTTGTCCTGGGGCCATTGG + Intronic
1181494008 22:23277797-23277819 GAGCACAGCCCTGGAGCCATGGG - Intronic
1181521676 22:23451983-23452005 GCCCCGTGCCCTGGTGCCATCGG - Intergenic
1185023498 22:48394392-48394414 GGGCTCTGTCCTGGGGCAATCGG + Intergenic
1185196061 22:49470228-49470250 GCCCCATGTCCAGGAGCCAGCGG + Intronic
951333919 3:21398690-21398712 ACGCACTGTCCTGGACCCAGTGG + Intergenic
954621569 3:51999121-51999143 GGGACCTGTCCAGGAGCCAAAGG + Intergenic
961717740 3:128870287-128870309 GCTGCTTGTCCTGGTGCCATCGG - Intergenic
961745699 3:129062289-129062311 GCCCCCTGGCCTGGAGCCAGGGG - Exonic
962240055 3:133744588-133744610 GCCCCTTGTGCTTGAGCCATAGG - Intergenic
962284771 3:134076504-134076526 GGGCCCGGTCCTGGAGCCTGTGG - Intronic
963222194 3:142825201-142825223 GCGCCCTTTCCCGGGCCCATTGG + Intronic
967116885 3:186349650-186349672 GTGCCTTGTGCTGGGGCCATGGG - Intronic
968702218 4:2062498-2062520 GCCCCCTGTCCTGGAGCCCCTGG - Intronic
968870716 4:3240749-3240771 GCTCCCTCTCCTGTAGCCACTGG + Exonic
979487271 4:121283550-121283572 GAGGCCTGACCTGGAGCCTTGGG - Intergenic
1001866403 5:175109533-175109555 GTGACCTGTCCTGGCTCCATGGG - Intergenic
1003201639 6:3966557-3966579 GCAGCCTGTCCAGGAGGCATAGG - Intergenic
1007336247 6:41157140-41157162 GCTCCCTGTCCTGGAGCCTTGGG - Intergenic
1011590445 6:88965886-88965908 GCACCCTGTGGTGGAGCCTTGGG + Intergenic
1013773672 6:113654580-113654602 GTGCCCTGGCCTCCAGCCATGGG - Intergenic
1019159795 6:170062352-170062374 CCCCCCTCTGCTGGAGCCATAGG + Intergenic
1019589661 7:1824500-1824522 GCCCCGTGCCCTGGCGCCATCGG + Intronic
1019917483 7:4143176-4143198 GCACCCTGTCCTGGAGCTGCAGG + Intronic
1022140771 7:27491561-27491583 GGTCCCTATTCTGGAGCCATGGG + Intergenic
1026625340 7:71987309-71987331 GGCCCCTGTCCTGAAGCCAGTGG - Intronic
1028806931 7:95038578-95038600 GAGCCTTGTGCTGCAGCCATGGG + Intronic
1034978375 7:155460780-155460802 GCCCACTGGCCTGGAGCCCTGGG + Intronic
1035315867 7:157997389-157997411 GCCCCCTGTCCTGAAGTCAAGGG - Intronic
1037043221 8:14263971-14263993 GGGCCGTGGCCTGGAGCCAGAGG - Intronic
1038011420 8:23479539-23479561 GGGCCCTGTCCTGGCCCCAGAGG - Intergenic
1039434001 8:37547222-37547244 GGGCTCTGTCCTGGTGCCAGAGG - Intergenic
1040477142 8:47788928-47788950 GCCCCCAGGCCTGGAGCCTTTGG + Exonic
1040898189 8:52390089-52390111 CGGCCCTGTCTTAGAGCCATTGG - Intronic
1050074677 9:1851391-1851413 GTGCCCTGTGTTTGAGCCATCGG + Intergenic
1055698496 9:78916064-78916086 ACGCCCTTTCCTGGACACATGGG - Intergenic
1057232817 9:93335130-93335152 GCCCCATGGCCTGGAGCCACAGG - Intronic
1057252695 9:93516491-93516513 GCCCCATGGCCTGGAGCCACAGG + Intronic
1057836849 9:98452077-98452099 GCTCCCTGTCCTAGAGCCTGTGG - Intronic
1058976050 9:110126550-110126572 GCGCCCTATCAAGGAGCCCTCGG - Intronic
1060600904 9:124876704-124876726 GAGCCCTGTCCTGGAGCCGTGGG - Intronic
1060736612 9:126070248-126070270 GCCCCCAGGCCTGGCGCCATGGG - Intergenic
1061218622 9:129236235-129236257 AGGCTGTGTCCTGGAGCCATCGG + Intergenic
1061406071 9:130393743-130393765 GCCCCCTGTCCTGGAGCCGGTGG + Intronic
1061713211 9:132501829-132501851 GCGCCCTTCCCTGGAGTCAGGGG + Intronic
1062579054 9:137221621-137221643 GCGCCCTGTCCTGGAGCCATGGG - Intergenic
1185831890 X:3310585-3310607 GCTCACTGTCCTGGAGCCCATGG - Exonic
1195203078 X:102567954-102567976 CCATCCTGTCCTGGAGCCAATGG + Intergenic
1198420334 X:136465318-136465340 GCACCCTGTCCAGGATACATGGG + Intergenic
1199643043 X:149881792-149881814 GCCCCCTGTCCTGGGGTCCTGGG - Intronic
1199947440 X:152680282-152680304 GCCCCCTGTCCTGGGGTCCTGGG - Intergenic
1199962240 X:152788172-152788194 GCCCCCTGTCCTGGGGTCCTGGG + Intergenic
1200067291 X:153509935-153509957 GCACCCTGCCCTGGCTCCATTGG - Intergenic
1200092495 X:153642474-153642496 GCGGCCTCTCCTGGAGCCGAGGG - Intronic
1200105150 X:153707892-153707914 GTGCCCTGTCCTGGGGGCCTGGG - Intronic
1201244114 Y:11986495-11986517 GCTCACTGTCCTGGAGCCCATGG + Intergenic