ID: 1062579887

View in Genome Browser
Species Human (GRCh38)
Location 9:137224803-137224825
Sequence CCTGCCTCGCCGGGGCTTTG AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 206
Summary {0: 1, 1: 0, 2: 0, 3: 21, 4: 184}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1062579887 Original CRISPR CCTGCCTCGCCGGGGCTTTG AGG Exonic
900033347 1:387135-387157 CCTGACTGGCCTGGGCTCTGGGG - Intergenic
900054185 1:617024-617046 CCTGACTGGCCTGGGCTCTGGGG - Intergenic
900175042 1:1287875-1287897 CCTGCCCAACCTGGGCTTTGGGG + Intronic
900189190 1:1346142-1346164 TCTGCCTGGCCTGGGCTGTGGGG - Intronic
900193631 1:1362486-1362508 CTTGCCTGGCCGAGACTTTGTGG - Intergenic
900512220 1:3066211-3066233 CCTGCCTGGCAAGGGCTTTGGGG - Intergenic
900603878 1:3515329-3515351 GCTGCCTCGCCTGGGCTGTTGGG - Intronic
901008097 1:6181238-6181260 ACTGCCTCGCAGGGGCACTGGGG + Intergenic
901160711 1:7174802-7174824 TCTGCCTCGCCTGGGCCGTGGGG - Intronic
901540064 1:9910027-9910049 CGCGCCGCGCCGGGGCTTGGGGG - Intronic
902879027 1:19358795-19358817 CCTGCCACACCGTGGCTTTGGGG - Intronic
903273846 1:22208593-22208615 CCTGCCTCTCTGGGGCCTTCAGG - Intergenic
904276958 1:29391068-29391090 CCTGCCTTGTTGGGGCTGTGGGG + Intergenic
904861335 1:33540451-33540473 CTTGCCTCCTCGGAGCTTTGTGG - Intronic
908498044 1:64714664-64714686 TCTGCCTCTCCGAGGCTGTGTGG - Intergenic
914666921 1:149840229-149840251 TCGGCCTCGCCGGGGTTCTGCGG - Exonic
914668846 1:149853561-149853583 TCGGCCTCGCCGGGGTTCTGCGG + Exonic
916785019 1:168080581-168080603 CCTGCCTCTTAGGGGCTTGGAGG + Exonic
920511790 1:206557271-206557293 CCTGACTCGTCCGGGCTCTGCGG - Intronic
922255709 1:223891289-223891311 CCTGACTAGCCTGGGCTCTGGGG - Intergenic
922740122 1:228009822-228009844 CCTGCCTCCCCAGGGCTGGGTGG + Intronic
924336905 1:242994154-242994176 CCTGACTGGCCTGGGCTCTGGGG - Intergenic
1062824849 10:559780-559802 CCTGCCAGGCCGGGGCCATGGGG - Intronic
1063371521 10:5525617-5525639 CCTGCCTCCCCTGGGCACTGTGG + Exonic
1064209099 10:13348170-13348192 CCTGCCTCGGCGCGGCCCTGCGG + Exonic
1067699188 10:48556376-48556398 CCTGCCTAGCCTGGGGGTTGGGG - Intronic
1071251347 10:83822982-83823004 CCTGCCTCGCCTAGTCTCTGGGG - Intergenic
1071465045 10:85932062-85932084 CCTGCCTAACCTGGGCTTTCTGG + Intronic
1073148138 10:101293523-101293545 CCTGCCTCGCCTGAGCCTGGAGG - Intergenic
1073190329 10:101646426-101646448 CCTGCCTAGCCTGGGCCTTCTGG - Intronic
1073324400 10:102634080-102634102 CCTGCCTCTCCAGGGCTGGGGGG + Intergenic
1074571802 10:114631489-114631511 CCTGCCACGGCTGGGCTGTGTGG - Intronic
1074830165 10:117241962-117241984 GCTGCCGCGCCGGGGCTAGGAGG + Intronic
1075800660 10:125151769-125151791 CCTACCTTGCCGGGGCCTCGCGG + Intronic
1076675625 10:132146151-132146173 CCACCCTGGCCCGGGCTTTGTGG + Intronic
1077236520 11:1484500-1484522 TCTGCCTGGCCGGGTCTTGGGGG - Intronic
1077322203 11:1947490-1947512 CCTGCCTCGCCCGGGCCAGGAGG - Intronic
1078083022 11:8217687-8217709 CCTGCTTCACCTGGGCTTTCAGG - Intergenic
1083184797 11:61011271-61011293 CTTGCCTCCCCGGGGCTCTCTGG + Intronic
1083389516 11:62337673-62337695 CCTTCGGCGCCGGGGCTTGGAGG + Intronic
1083596259 11:63919426-63919448 CCTGCCGCCCCGGGGCTGCGGGG + Intergenic
1084900163 11:72303575-72303597 CCTGCCTCACCAGGGGTCTGAGG + Intronic
1085050228 11:73376580-73376602 CCTGCCTCCCCGTGTCTCTGAGG + Intronic
1088808324 11:113371673-113371695 CCTGCCTCTCCGGGTCTTGTTGG - Intronic
1089564695 11:119364385-119364407 CCTGCCTGGCCGGGGGTCAGCGG - Intronic
1202805221 11_KI270721v1_random:2803-2825 CCTGCCTCGCCCGGGCCAGGAGG - Intergenic
1091718080 12:2794356-2794378 GCTGCCTGGCCGGGGCTTCTCGG + Intergenic
1093991340 12:25592597-25592619 CCTGCCTCACAGGGTCCTTGGGG + Intronic
1096538342 12:52289386-52289408 GCTGCCAGGCCGGGGCTGTGTGG - Intronic
1096540435 12:52303978-52304000 GCTGCCAGGCCGGGGCTGTGTGG + Intronic
1097035512 12:56121144-56121166 CCTTCCTGACAGGGGCTTTGAGG + Exonic
1097521249 12:60673120-60673142 CCTGCCTTGCTGGGGATTTCTGG + Intergenic
1100407920 12:94287092-94287114 CCTGCCTCCCAGGGTTTTTGTGG - Intronic
1101413201 12:104486083-104486105 CCTTCCCTGCCTGGGCTTTGGGG + Intronic
1102229494 12:111252709-111252731 CCAGCCCCGCCTGGGCTCTGAGG + Intronic
1103214956 12:119194876-119194898 ACTGCCTCGCCCAGCCTTTGTGG - Intronic
1104847917 12:131856029-131856051 CCTGCCTGGCCTGGGCTCAGGGG - Intergenic
1104860278 12:131919843-131919865 CCTGGCTCCCCGTGGCCTTGAGG - Intronic
1105779774 13:23695990-23696012 CCTGCCTCCCCCGGGGGTTGGGG + Intergenic
1114636975 14:24193188-24193210 CTTGCCAATCCGGGGCTTTGTGG - Exonic
1117819155 14:59630500-59630522 CCTGCATCGTGCGGGCTTTGGGG + Intronic
1119379168 14:74217889-74217911 CCCGCCTCGCAGGGGCTGCGAGG + Intergenic
1121408824 14:93735343-93735365 CCTGCGTCGCAGGGGCTTCCTGG + Intronic
1124168633 15:27352610-27352632 CCTGCCTCCCCGGGGCAGTGTGG - Intronic
1124376477 15:29132181-29132203 CCTGCCTCGCCCGGGCTGCGGGG + Intronic
1125525164 15:40369841-40369863 CCTGCCTGGCCCGGGTTTTGGGG - Exonic
1126686217 15:51251073-51251095 CCTGCCACGCCCGGGCTGAGGGG + Intronic
1127628296 15:60801663-60801685 CGTGCCTCTCCCGGGCTTTCAGG - Intronic
1128640126 15:69329967-69329989 CCTACCTGGCCAGGGCTATGGGG - Intronic
1132590343 16:723751-723773 CCTGTCTGGCGGGGGCTTGGTGG + Intronic
1132723177 16:1327054-1327076 CCTGGCTCCCCTGGGCTTTGGGG + Intergenic
1133220188 16:4316317-4316339 CCTGTCGCGCCGGGGCTGCGGGG + Intronic
1133294361 16:4743667-4743689 CCTGCCTCCCCTCGCCTTTGTGG - Intronic
1133579303 16:7127754-7127776 CCTGCCTCCACGGGGCTATGAGG - Intronic
1135304651 16:21357594-21357616 CCTGCCTCACTGGGGGTGTGAGG + Intergenic
1136022627 16:27449694-27449716 ACAGCATCTCCGGGGCTTTGTGG + Exonic
1136301394 16:29336721-29336743 CCTGCCTCACTGGGGGTGTGAGG + Intergenic
1141391739 16:83670441-83670463 CCTGCTTCCCTGGGGTTTTGTGG + Intronic
1142063091 16:88043418-88043440 CCTGCCTCACTGGGGGTGTGAGG + Intronic
1142152076 16:88517063-88517085 CCTGCCACGCCAGGGGTTGGAGG + Intronic
1142487960 17:259030-259052 CGTGCCTCCCCGGGGCTCTGTGG + Intronic
1142613710 17:1123420-1123442 CCTGGCGCTCCGGGGCTTCGGGG - Intronic
1142615837 17:1134659-1134681 TCCGCCTTGCCGGGCCTTTGAGG - Intronic
1143323542 17:6083530-6083552 CCTGCCTCGGCTGGGCGTGGTGG - Intronic
1143587564 17:7858134-7858156 CATGCCGCGCCGGGGCCTGGTGG + Exonic
1144252248 17:13429323-13429345 CCTGCCTGGCCAGGGCTGCGAGG + Intergenic
1145159634 17:20565820-20565842 CTTGCCTGGCAGTGGCTTTGCGG + Intergenic
1151555049 17:74842588-74842610 CCTGGCTCTCCGGGGCCTGGGGG - Exonic
1152095132 17:78268220-78268242 CCTGCCTGGCCAGGGCCTTTTGG + Intergenic
1154164425 18:12003762-12003784 CCTGCCATGCCCTGGCTTTGTGG + Intronic
1154324056 18:13377016-13377038 CCTGCCTCGCCTGGCCTTGCAGG + Intronic
1154387622 18:13909723-13909745 CCTGCATCGCTGTGGCTTTCTGG + Intronic
1156948499 18:42864788-42864810 CCTGCCTTGGCGAGGCTTAGTGG - Intronic
1157175579 18:45449114-45449136 CCTGCCTGGAATGGGCTTTGAGG - Intronic
1159658376 18:71060451-71060473 CCTCCCACTCAGGGGCTTTGAGG - Intergenic
1160812680 19:1019781-1019803 ACCGCCGCGCCGGGGCTTGGGGG - Intronic
1160930090 19:1566449-1566471 CCTGCCTCCCCGGGGCCCTCGGG - Intronic
1161042352 19:2116870-2116892 CCTGCCTCGCTGGCCCTGTGTGG - Intronic
1161133866 19:2608332-2608354 CTTGCCTTGCAGGGGCTTCGGGG - Intronic
1161318606 19:3630868-3630890 CCTCCCTCGCGGGGGATCTGAGG + Exonic
1161627909 19:5337841-5337863 CCTGCCTCCCAGGGGATTTCAGG - Intronic
1162931879 19:13961505-13961527 GCTGACTCGCCGGGCCTTGGTGG - Intergenic
1163484572 19:17578173-17578195 GATGCCTAGCCGGGGCTTTGGGG - Intronic
1163737152 19:18988439-18988461 CCTGCCTCTCCGGGACAGTGGGG - Intergenic
1168069837 19:53943213-53943235 CCTCCCTCGACGGGGCCTCGAGG - Exonic
927574480 2:24189967-24189989 CCTGCCTCTTTGGGGCTATGTGG + Intronic
927704881 2:25290880-25290902 CCTGCATCTGCTGGGCTTTGGGG - Intronic
929105301 2:38359392-38359414 CCTCCCTCTCCCGGGCTCTGGGG - Intronic
930036467 2:47088535-47088557 CCTGCCTCTAGGGGGCTATGAGG + Intronic
931168739 2:59779551-59779573 CCTGGCTCACTGTGGCTTTGTGG + Intergenic
934770369 2:96903808-96903830 CCAGCCTCACCGGAGCTTTGAGG - Intronic
941121297 2:161533293-161533315 CCTGCCTAGGTGGGGCCTTGGGG - Intronic
944544059 2:200781649-200781671 CCTCCCTCTCCCGGGCTTGGAGG - Intergenic
946724434 2:222648074-222648096 CCTTCCTCGCGGGGGCTTGATGG - Intronic
947399214 2:229714882-229714904 CCTGCCCTGCCCGGGCCTTGGGG - Intergenic
947999869 2:234558990-234559012 CCTGCCTCACAGGGGTTCTGAGG + Intergenic
1174082363 20:47979580-47979602 ACGGCCACGCCTGGGCTTTGTGG + Intergenic
1174134190 20:48367658-48367680 ACGGCCACGCCTGGGCTTTGTGG - Intergenic
1175862261 20:62156758-62156780 CCTGCCTGCCTGGGGCCTTGGGG - Intronic
1179537701 21:42062998-42063020 CCTGCCTCTCCCAGGCTCTGGGG + Intronic
1180791443 22:18577573-18577595 CCTGGCAGGCCCGGGCTTTGTGG - Intergenic
1181230296 22:21417738-21417760 CCTGGCAGGCCCGGGCTTTGTGG + Intronic
1181248354 22:21517125-21517147 CCTGGCAGGCCCGGGCTTTGTGG - Intergenic
1181985786 22:26799128-26799150 CCTGCCTGGGGGGGGCTCTGGGG - Intergenic
1182189927 22:28448727-28448749 CCTGCATCACCTGGGCTGTGTGG - Intronic
1182430242 22:30294915-30294937 CCTGCCTGCCCGGGGCCTGGTGG + Intronic
1183505795 22:38208222-38208244 CCTGCCTCGCAGGGTTTTGGTGG - Intronic
1184115535 22:42419714-42419736 CCTTCCTCTCCTGGGCTTTGGGG + Intronic
1184416168 22:44352963-44352985 CCTGCCTGCCCCGGGCTCTGAGG + Intergenic
1184597736 22:45524447-45524469 CCAGCCCTGCCGGGGCTCTGGGG - Intronic
1184745183 22:46451997-46452019 CCTGCCTCCCCGGCGCCTGGTGG - Intronic
1185008728 22:48301083-48301105 CCTGACTTGCTGGGGATTTGGGG + Intergenic
1185122759 22:48982394-48982416 CGGGCCTCGCCGGGGCACTGGGG - Intergenic
1185219760 22:49623459-49623481 CCTGCCCAGCGGGGGCTCTGGGG - Intronic
1185367824 22:50445113-50445135 CTGGCCGGGCCGGGGCTTTGGGG - Exonic
949516129 3:4808548-4808570 GCTGCCTCTCCTGTGCTTTGCGG + Intronic
950659364 3:14457268-14457290 CCTGCCCTGCCAGGGTTTTGAGG - Intronic
956675284 3:71726254-71726276 CCCGACTCGCCGGTGCTTTAGGG - Intronic
960055540 3:113274145-113274167 CCTGCCTGGCCAGGGCTCAGGGG - Intronic
961658822 3:128457655-128457677 CCTGCCTGGCCAGGCCTTAGGGG + Intergenic
964003926 3:151808093-151808115 TCTGCCTTGCCAGGGCTTTGAGG - Intergenic
968231674 3:197008206-197008228 CCTGCCTCGGTGTGGCTTGGGGG + Intronic
968618301 4:1592403-1592425 CCTGCCCCTCCGGGACTTTGGGG - Intergenic
969299461 4:6289100-6289122 GCTGCTTCGCCGGTGCTTGGCGG + Exonic
970321264 4:14877796-14877818 CCTGCCCAGCCGGATCTTTGTGG - Intergenic
973578095 4:52313054-52313076 ACTGCCTCACCGGGGTGTTGAGG - Intergenic
976412730 4:84735311-84735333 CCTTCCTTGAAGGGGCTTTGGGG - Intronic
979240219 4:118441150-118441172 CCTGACTGGCCTGGGCTCTGGGG + Intergenic
983212984 4:164977576-164977598 CCTTCCTCGCGGGGGCTCGGTGG - Exonic
984610113 4:181828184-181828206 CCTGCCACGTGTGGGCTTTGAGG + Intergenic
985240893 4:187929834-187929856 CCTGCCTCACGGGGGCCTTGAGG - Intergenic
985963318 5:3320339-3320361 CCTGCCTCAGCGCGGCTTTGAGG - Intergenic
987402407 5:17491723-17491745 CCTGCCAGGCGGTGGCTTTGCGG + Intergenic
987404616 5:17512193-17512215 CCTGCCAGGCGGTGGCTTTGAGG + Intergenic
987412229 5:17625914-17625936 CCTGCCAGGCGGTGGCTTTGTGG + Intergenic
987415266 5:17655493-17655515 CCTGCCAGGCGGTGGCTTTGCGG + Intergenic
987962085 5:24823838-24823860 CCTGCCTCCCTGGGGCTGAGTGG - Intergenic
990311097 5:54539619-54539641 CCTGCCCTGACGGTGCTTTGTGG + Intronic
990982817 5:61617046-61617068 CCTGGATAGCTGGGGCTTTGGGG - Intergenic
993252693 5:85549436-85549458 ACTGCCTCGCCTGGCCTTTGTGG - Intergenic
996073518 5:119161727-119161749 CCAGTCTGGGCGGGGCTTTGGGG + Intronic
998406398 5:141876906-141876928 CCCGCCTCCCCGGAGCTCTGGGG - Intronic
999700268 5:154221358-154221380 TCTGCCTCCCAGGGGCTCTGGGG + Intronic
1001519365 5:172379811-172379833 TCTGCCACTCCTGGGCTTTGTGG - Intronic
1002103281 5:176867891-176867913 CCTGCCTGCCCGGGGCCTTCAGG + Intronic
1002740473 5:181431733-181431755 CCTGACTGGCCTGGGCTCTGGGG + Intergenic
1003465587 6:6376925-6376947 CCTGGCTGCCCGGGGCTTTCAGG - Intergenic
1004620224 6:17325027-17325049 TCTGCCTTGCCAGGGCTTTGAGG + Intergenic
1006788619 6:36684337-36684359 CCGGCCTCGCCGGGGCCCCGTGG - Exonic
1007974018 6:46082234-46082256 CCTGCCTCACTGGGTCATTGTGG - Intergenic
1015181433 6:130365971-130365993 CCCGCCTCTTCGGGGCTTTATGG + Intronic
1017914282 6:158819387-158819409 CCCGCCCCGCCGGGGCTTTTGGG - Exonic
1018757417 6:166862414-166862436 CCTGCCAAGCCAGGGCTCTGGGG + Exonic
1019245584 6:170707333-170707355 CCTGACTGGCCTGGGCTCTGGGG + Intergenic
1019634475 7:2068160-2068182 CCTGCAAAGCCAGGGCTTTGGGG + Intronic
1022098799 7:27157047-27157069 CCTGCCCCGCGGTGGCCTTGTGG + Intronic
1024446109 7:49481278-49481300 CCTGCCTCTTAGGAGCTTTGTGG + Intergenic
1024564946 7:50673262-50673284 CGTGCCTCTCTGGGCCTTTGCGG - Intronic
1029276037 7:99404918-99404940 ACTGCCTCGCCCGGCCTTTGTGG + Exonic
1032540280 7:132697316-132697338 CGTGCCTTGCTGGGGATTTGTGG - Intronic
1034095375 7:148403204-148403226 CCTGCCTGGCCTGTGCTTGGTGG + Intronic
1035191966 7:157177716-157177738 CCTGTCTCTCCTGGGCTTTGCGG + Intronic
1035502541 8:100868-100890 CCTGACTGGCCTGGGCTCTGGGG - Intergenic
1037099801 8:15031303-15031325 CATGCCTCGCCCAGGCCTTGAGG + Intronic
1037754081 8:21700312-21700334 CCTGCCTCCCTGGGGCTCTGTGG - Intronic
1041072237 8:54136585-54136607 CCGGCCCCGCTTGGGCTTTGAGG + Exonic
1045035356 8:98172619-98172641 ACTGCCTCACCGCTGCTTTGTGG + Intergenic
1049586752 8:143435927-143435949 CGTGCCCCGCCAGGGCTCTGAGG + Intergenic
1049604956 8:143525091-143525113 TCTGCCTGGCCTGGGCCTTGGGG - Intronic
1049653736 8:143788717-143788739 CCTGGGTGGCCTGGGCTTTGGGG + Intergenic
1049762053 8:144336198-144336220 CCTGCGGAGCCGGGGCTTGGGGG + Exonic
1049807764 8:144548599-144548621 CCTTCCTCGCTGGGGCCCTGTGG + Intronic
1055669182 9:78583312-78583334 CCAGCCTCCCCCAGGCTTTGGGG + Intergenic
1056831689 9:89922406-89922428 CCTGCCTCACTGGAGCTTGGTGG + Intergenic
1061550825 9:131333849-131333871 CCTGCCTCTGCAGGGCTGTGTGG + Intergenic
1062140146 9:134951644-134951666 CCAGCCCCGCCGGTGCTCTGGGG + Intergenic
1062579887 9:137224803-137224825 CCTGCCTCGCCGGGGCTTTGAGG + Exonic
1062661689 9:137638874-137638896 CCTGCCTCGGCCAGGCTCTGGGG - Intronic
1203774672 EBV:66073-66095 CCTGCCTCCCGGAGGCTCTGCGG + Intergenic
1203605782 Un_KI270748v1:56541-56563 CCTGACTGGCCTGGGCTCTGGGG + Intergenic
1189872292 X:45396920-45396942 CCTGCCTAGATGGGGCCTTGTGG + Intergenic
1198489303 X:137122831-137122853 CCAGCCTCGCTGGTGCCTTGTGG - Intergenic
1200247756 X:154534965-154534987 GCGGCCTGGCCGGGCCTTTGGGG + Intronic
1200248963 X:154542088-154542110 CATGAGTCACCGGGGCTTTGGGG + Intronic
1202387957 Y:24342979-24343001 CCTGACTGGCCTGGGCTCTGGGG + Intergenic
1202482830 Y:25327149-25327171 CCTGACTGGCCTGGGCTCTGGGG - Intergenic