ID: 1062583904

View in Genome Browser
Species Human (GRCh38)
Location 9:137240512-137240534
Sequence ACTGCCCTCGCGGTCGCGTG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1062583904_1062583910 -5 Left 1062583904 9:137240512-137240534 CCTCACGCGACCGCGAGGGCAGT No data
Right 1062583910 9:137240530-137240552 GCAGTGGGCGTGCGGCACCCGGG No data
1062583904_1062583911 1 Left 1062583904 9:137240512-137240534 CCTCACGCGACCGCGAGGGCAGT No data
Right 1062583911 9:137240536-137240558 GGCGTGCGGCACCCGGGAGCAGG No data
1062583904_1062583915 21 Left 1062583904 9:137240512-137240534 CCTCACGCGACCGCGAGGGCAGT No data
Right 1062583915 9:137240556-137240578 AGGAAACTCCGTGGCCTCTGCGG No data
1062583904_1062583909 -6 Left 1062583904 9:137240512-137240534 CCTCACGCGACCGCGAGGGCAGT No data
Right 1062583909 9:137240529-137240551 GGCAGTGGGCGTGCGGCACCCGG No data
1062583904_1062583917 29 Left 1062583904 9:137240512-137240534 CCTCACGCGACCGCGAGGGCAGT No data
Right 1062583917 9:137240564-137240586 CCGTGGCCTCTGCGGCTCTGTGG No data
1062583904_1062583913 12 Left 1062583904 9:137240512-137240534 CCTCACGCGACCGCGAGGGCAGT No data
Right 1062583913 9:137240547-137240569 CCCGGGAGCAGGAAACTCCGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1062583904 Original CRISPR ACTGCCCTCGCGGTCGCGTG AGG (reversed) Intergenic
No off target data available for this crispr