ID: 1062587034

View in Genome Browser
Species Human (GRCh38)
Location 9:137254090-137254112
Sequence GGTGCGGGTGACGGCACCGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1062587034_1062587042 2 Left 1062587034 9:137254090-137254112 CCTGCGGTGCCGTCACCCGCACC No data
Right 1062587042 9:137254115-137254137 CCCAGGTCCTCCCCAGACCCAGG No data
1062587034_1062587048 14 Left 1062587034 9:137254090-137254112 CCTGCGGTGCCGTCACCCGCACC No data
Right 1062587048 9:137254127-137254149 CCAGACCCAGGACCCAGACCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1062587034 Original CRISPR GGTGCGGGTGACGGCACCGC AGG (reversed) Intergenic
No off target data available for this crispr