ID: 1062587084

View in Genome Browser
Species Human (GRCh38)
Location 9:137254279-137254301
Sequence GATCCAACCCCCAGCTGGTT CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1062587084_1062587088 2 Left 1062587084 9:137254279-137254301 CCGAACCAGCTGGGGGTTGGATC No data
Right 1062587088 9:137254304-137254326 GGCACTGGAACCCTCGCCCTAGG No data
1062587084_1062587089 3 Left 1062587084 9:137254279-137254301 CCGAACCAGCTGGGGGTTGGATC No data
Right 1062587089 9:137254305-137254327 GCACTGGAACCCTCGCCCTAGGG No data
1062587084_1062587092 16 Left 1062587084 9:137254279-137254301 CCGAACCAGCTGGGGGTTGGATC No data
Right 1062587092 9:137254318-137254340 CGCCCTAGGGCTGACCAACTTGG No data
1062587084_1062587095 23 Left 1062587084 9:137254279-137254301 CCGAACCAGCTGGGGGTTGGATC No data
Right 1062587095 9:137254325-137254347 GGGCTGACCAACTTGGCCAGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1062587084 Original CRISPR GATCCAACCCCCAGCTGGTT CGG (reversed) Intergenic
No off target data available for this crispr